1. science
2. biology
3. zoology
4. endangered species

Copeia 103, No. 2, 2015, 272–280
Lack of Hybridization between Naturally Sympatric Populations of Red and
Blacktail Shiner (Cyprinella lutrensis and C. venusta) in Texas, but Evidence
of Introgression among Three Lineages of the C. lutrensis Species Group
Christopher L. Higgins1, Allison Love-Snyder1, Wesley Wiegreffe1, and
Russell S. Pfau1
Hybridization is more common in actinopterygian fishes than any other group of vertebrates. This is especially true for
members of the family Cyprinidae; for example, Hubbs found 68 different combinations of inter-generic and intrageneric hybridization among cyprinids collected east of the continental divide. Hybridization between two cyprinid
species, the red shiner and the blacktail shiner (Cyprinella lutrensis and C. venusta), has been described in detail in
Georgia where C. lutrensis is an introduced species. However, hybridization has not been thoroughly assessed where the
two species are naturally sympatric. Our specific objectives were to determine the extent of ongoing hybridization
between the two species using nuclear markers and morphometrics and to determine the extent of historical
introgression using mitochondrial DNA (mtDNA). We collected 100 individuals from four different locations along the
Bosque River and an additional 100 individuals from four locations along the Paluxy River. We used amplified fragment
length polymorphism (AFLP) to verify species identification and determine hybrid status of each individual. A total of
56 AFLP fragments were scored, with 82.14% (47 fragments) being polymorphic (95% criterion). Based on these nuclear
markers, we only identified two hybrids out of the 200 specimens analyzed; one from the Bosque River, Texas and one
from the Paluxy River, Texas. There were no instances of introgression of mitochondrial DNA (mtDNA) from one species
into the nuclear background of the other species. We did, however, discover the sympatric occurrence of three mtDNA
lineages of C. lutrensis within a single nuclear gene pool; there was only one mtDNA lineage of C. venusta. Overall body
shape was assessed using a truss network and was found to be statistically different with red shiner having the shorter
and deeper body. The minimal amount of hybridization inferred from AFLP data, in combination with the absence of
mtDNA introgression and limited morphological overlap, indicates that pre- or postzygotic isolating mechanisms
effectively minimize genetic exchange between naturally sympatric populations of C. lutrensis and C. venusta within
these two river systems.
F
RESHWATER ecosystems are some of the most diverse
in the world. They contain over 10,000 fish species,
almost 40% of global fish diversity and 25% of total
vertebrate diversity, despite covering less than 1% of
the Earth’s surface (Dudgeon et al., 2006). However, the
distributions of many actinopterygians (i.e., ray-finned
fishes) in North America are shrinking and their abundances
dwindling. In fact, recent estimates suggest that 39% of all
freshwater and diadromous species are imperiled (i.e.,
vulnerable, threatened, or endangered) and in need of
conservation (Jelks et al., 2008). The declines in distribution
and abundance of most North American species are a result
of habitat degradation, pollution, flow regulation and water
extraction, fisheries overexploitation, and the introduction
of non-native species (Strayer and Dudgeon, 2010). Although each of these anthropogenic activities contribute to
the decline in fish diversity, the introduction of non-native
species is considered one of the greatest threats to native
biodiversity (Vitousek et al., 1997; Rahel, 2000). Introduced
species threaten native biodiversity by altering the habitat,
increasing predation pressure, increasing interspecific competition, and/or hybridizing with native species (Fridley
et al., 2007).
Hybridization is more common in actinopterygians than
any other group of vertebrates, largely because of competition for limited spawning habitat, external fertilization,
weak behavioral isolating mechanisms, and unequal abundances of parental species (Hubbs, 1955; Scribner et al.,
2001). These underlying factors can result in four main
outcomes, including the formation of hybrid swarms,
1
hybrid speciation, introgression, and reinforcement of
reproductive isolating mechanisms (Osterberg and Rodriguez, 2006). The specific outcome may depend on many
factors including whether the parental species are naturally
allopatric, parapatric, or sympatric (Woodruff, 1973). When
populations are naturally sympatric, reproductive incompatibility is often strengthened through reinforcement of
pre- and postzygotic barriers (Noor, 1999). When species are
naturally allopatric, but come into secondary contact
through the introduction of non-native species, these
reproductive barriers may not be sufficient to prevent
hybridization (Rhymer and Simberloff, 1996). For example,
Weigel et al. (2003) reported finding hybridization between
introduced rainbow trout (Oncorhynchus mykiss) and native
cutthroat trout (Oncorhynchus clarkii) in 64% of their 80
sampling localities distributed throughout the Clearwater
River Basin, Idaho. In Montana, hybridization between
introduced O. mykiss and native O. clarkii resulted in a
50% decrease in reproductive success of native cutthroat
trout in only a four-year time span (Muhlfeld et al., 2009).
The loss of biodiversity in Cyprinidae, the most speciose
family in North America (Nelson et al., 2004), is of particular
concern because 46% of cyprinids are considered imperiled;
49 are listed as vulnerable, 20 are listed as threatened, 47 are
listed as endangered, and 11 are considered extinct (Jelks
et al., 2008). Hybridization among cyprinids is widespread and
can be intra-generic (i.e., between different species within a
genus) or inter-generic (i.e., between different genera). For
example, Hubbs (1955) found 68 different combinations of
intra-generic and inter-generic hybridization among cyprinids
Department of Biological Sciences, Box T-0100, Tarleton State University, Stephenville, Texas 76402; E-mail: (CLH) higgins@tarleton.edu.
Send reprint requests to CLH.
Submitted: 17 March 2014. Accepted: 1 December 2014. Associate Editor: T. J. Near.
DOI: 10.1643/CG-14-046 Published online: April 30, 2015
F 2015 by the American Society of Ichthyologists and Herpetologists
Higgins et al.—Hybridization and introgression in cyprinids
collected east of the continental divide. Hybridization within
the genus Cyprinella, the second most diverse genera within
Cyprinidae comprised of 30 species (Nelson et al., 2004), is
particularly common. Interspecific hybridization within the
genus Cyprinella is believed to be a threat to diversity in the
southeastern United States (Walters et al., 2008). The primary
hybridizing species is the introduced red shiner (C. lutrensis).
Cyprinella lutrensis is an extremely tolerant species that can
aggressively colonize degraded habitats and thrives under
harsh environmental conditions (Matthews and Hill, 1977;
Marsh-Matthews et al., 2011). The native distribution of C.
lutrensis extends throughout much of the Great Plains,
including populations in the Mississippi River basin and Gulf
Coast drainages to the west (Page and Burr, 2011). However,
they have been introduced into at least five drainages in the
southeastern United States, successfully establishing populations throughout the region (Fuller et al., 1999) and hybridizing with native congeners including the blacktail shiner (C.
venusta; Walters et al., 2008). Cyprinella venusta has a native
distribution that extends throughout the southeastern United
States, including drainages east and west of the Mississippi
River Basin (Page and Burr, 2011).
Much of what we know about hybridization in Cyprinella
is based on introduced populations of C. lutrensis in Georgia
(Walters et al., 2008; Blum et al., 2010; Ward et al., 2012),
but hybrids have been reported elsewhere. Broughton et al.
(2011) identified C. lutrensis 3 C. venusta hybrids in two out
of 20 rivers in Texas and Oklahoma: the North Fork of the
Guadalupe River in Kerr Co., TX and Sycamore Creek in
Edwards Co., TX. Additionally, Jurgens (1951) and Hubbs
et al. (1953) reported hybrid swarms in the San Marcos and
Guadalupe rivers, respectively. The latter two studies
documented hybrids based on phenotype only. The documented hybrids in Georgia and Texas suggest that C.
lutrensis is capable of hybridizing across the extent of the
geographic distribution of C. venusta. However, the Texas
studies did not use multilocus genetic techniques necessary
to address the degree of hybridization, which may vary
depending on whether the parental populations are naturally allopatric, parapatric, or sympatric (Woodruff, 1973).
The overall goal of our study was to examine patterns of
hybridization and introgression in C. lutrensis and C. venusta
from two adjacent tributaries of the Brazos River in Texas,
where the two species are naturally sympatric. Observed
levels of hybridization were compared with those from
Georgia where C. venusta is native and C. lutrensis is
introduced. Our specific objectives were to determine the
extent of ongoing hybridization between C. lutrensis and C.
venusta using nuclear markers and morphometrics and to
determine the extent of historical introgression using
mtDNA as an indicator.
MATERIALS AND METHODS
Study sites.—We surveyed four sites along the Paluxy River
(P1–P4) and four sites along the Bosque River (B1–B4; Fig. 1).
The Paluxy River is located in north central Texas and flows
47 km through Erath, Hood, and Somervell counties before
merging with the Brazos River just east of Glen Rose, Texas.
The Bosque River is a 185 km river that also originates in
Erath Co. and flows through Hamilton, Bosque, and
McLennen counties before emptying into Lake Waco.
Because the Paluxy River covers a fraction of the distance
the Bosque River does, we only sampled sites on the North
Bosque River. Sampling sites along the Paluxy River and the
273
Fig. 1. Map depicting locations of the eight collecting sites on the
Bosque and Paluxy rivers.
Bosque River were located at road crossings, were approximately equidistant from one another, and represented a
gradient of coexistence between C. lutrensis and C. venusta
with proportionately more C. lutrensis in downstream
reaches (Linam and Kleinsasser, 1989; Jones, 2000; Stone,
2012).
Sampling method.—All specimens were collected on 15
August 2011 under permit #SPR-0403-284. At each of the
eight sampling localities, we used a seine (3 mm 3 5 mm
mesh) to harvest the first 50 Cyprinella without regard to
species identification. Because we wanted to determine
whether hybrids were indeed intermediate in phenotype,
we did not attempt to distinguish among C. lutrensis, C.
venusta, or their putative hybrids a priori. Specimens were
immediately stored in 95% ethanol. Upon returning to the
lab, individuals were arranged from smallest to largest in
regard to standard length and numbered 1 through 50. A
random number generator was used to subsample 25
individuals per site for genetic and morphological analyses.
Each individual selected was given a unique number code
for identification purposes (e.g., B2-01 is the first specimen
from the second sampling site along the Bosque River).
Amplified fragment length polymorphisms (AFLP).—We extracted DNA from pectoral fin tissue using phenol:chloroform:
isoamyl alcohol (25:24:1) and ethanol precipitation. Amplified fragment length polymorphism (AFLP) was used to
verify species identification and determine hybrid status of
each individual. The AFLP protocol was a modified version
(Phillips et al., 2007) of the original protocol of Vos et al.
(1995). DNA was digested with the restriction enzymes EcoRI
and MseI followed by ligations using EcoRI and MseI
adapters. A subset of ligated fragments were then amplified
by polymerase chain reaction (PCR) using the following preselective primer pairs: EcoRI-C (59–ACTGCGTACCAATTCC–
39) and MseI-A (59–GATGAGTCCTGAGTAAA–39). A subset of
the resulting preselective PCR products was amplified in a
second PCR reaction using the following three selective
primer pairs: EcoRI-CAC (59–ACTGCGTACCAATTCCAC–39)
paired with MseI-ACC (59–GATGAGTCCTGAGATAACC–39),
MseI-ATT (59–GATGAGTCCTGAGTAAATT–39) and MseIAGC (59–GATGAGTCCTGAGTAAAGC–39). The EcoRI primer
was fluorescently labeled to allow detection by a Beckman-
274
Coulter CEQ8000 Genetic Analysis System (Beckman-Coulter Inc., Fullerton, CA). The size of fragments was based on
an internal size standard, and fragments were automatically
placed into bins (one base pair in size) using BeckmanCoulter software. Results of automated scoring was verified
visually and corrected when necessary. Only fragments that
were unambiguously present or absent across all specimens
were retained.
We conducted admixture analyses of AFLP data using two
different Bayesian clustering approaches known to provide
complementary results (Burgarella et al., 2009), NEWHYBRIDS 1.1 (Anderson and Thompson, 2002) and STRUCTURE 2.3.4 (Pritchard et al., 2000), along with Principal
Coordinate Analysis. NEWHYBRIDS uses Markov chain
Monte Carlo sampling to determine deviation from HardyWeinberg equilibrium among multilocus genotypes. Computations were performed without prior information on
population or allele frequencies and with a burn-in of
100,000 steps and 50,000 iterations with Jeffreys-like priors
for the mixing proportions and allele frequencies. We used
the posterior probabilities obtained from NEWHYBRIDS to
quantify the likelihood that each specimen was categorized
as pure C. lutrensis, pure C. venusta, F1 hybrid, F2 hybrid, C.
lutrensis backcross, or C. venusta backcross. Different criteria
and thresholds can be used to actually classify parental and
hybrid individuals based on these probabilities (Burgarella et
al., 2009). One criterion requires that the posterior probability for each separate category must be greater than or
equal to some a priori threshold. Under this conservative
criterion, it is possible that some of the individuals are not
classified at all if the probabilities are fairly low for all
categories. A second criterion involves setting a threshold
for the purebred categories only (i.e., in order for an
individual to be classified as a pure species the posterior
probability must be greater than some set value) and
categorizing all other individuals as hybrids. Although this
criterion is liberal at identifying hybrid individuals, it does
classify each individual as either a parental species or a
hybrid; this could be important if maintaining sample size is
an important component of the experimental design. A
third criterion involves summing the probabilities from the
four hybrid categories and comparing that total to some
threshold. This particular criterion has been shown to
perform well with simulated data in regard to power and
accuracy (Burgarella et al., 2009). For our study, we used this
last criterion and classified an individual as being a hybrid if
the sum of the posterior probabilities across the four hybrid
categories was $ 0.5, making the probability that it is a pure
species less than 50%.
STRUCTURE uses model-based algorithms for clustering
genetic data assuming Hardy-Weinberg and linkage equilibrium (Pritchard et al., 2000). We used STRUCTURE to
estimate admixture proportions and assign 90% credibility
intervals (Bayesian analogs of confidence intervals) to
identify parental and hybrid individuals Simulations were
carried out with K 5 2 (two distinct genetic entities) under
the admixture model assuming independent allele frequencies. A burn-in of 50,000 steps followed by 50,000 iterations
was used. We considered individuals to be hybrids if the
90% credibility interval was completely contained within
the range of 0.10 and 0.90, which includes admixture
proportions expected for F1 and F2 hybrids (0.50) as well as
backcrosses (0.25, 0.75).
Copeia 103, No. 2, 2015
Principal Coordinate Analysis (PCoA) was used to visualize
patterns of divergence among all 200 specimens using the
software GenAlEx 6.4 (Peakall and Smouse, 2006). PCoA
uses a pairwise, similarity matrix, based on Hamming
distances (Choi et al., 2010), to arrange individuals in
principal coordinate space so that specimens with similar
genetic profiles will be grouped together. Assuming parental
species are distinct and hybrids intermediate in genotype,
one would expect to find hybrid individuals between the
clusters of individuals representing parental species.
Mitochondrial DNA (mtDNA).—Partial cytochrome b (cyt b)
DNA sequences were obtained using polymerase chain
reaction (PCR). Amplifications were carried out in 25 ml
reactions containing 1X Buffer, 1.5 mM MgCl2, 0.8 mM
deoxynucleotide triphosphates, 2.5 mM of both primers,
1.25 units Taq DNA polymerase, and 0.5 ml of DNA. Primer
pairs used were LA (59–TGACTTGAAAAACCACCGTTG–39)
and HA (59–CAACGATCTCCGGTTTACAAGAC–39; Schmidt
et al., 1998). Amplification conditions included an initial
step of 95uC for 5 minutes, followed by 20 cycles of 95uC for
30 s, 56uC (20.5uC per cycle) for 60 s, 72uC for 90 s, and 20
cycles of 95uC for 30 s, 46uC for 60 s, 72uC for 90 s, then held
at 72uC for 10 minutes. PCR products were prepared for
sequencing using ExoSAP-IT and sequenced using a Beckman-Coulter CEQ8000 Genetic Analysis System.
Cyt b sequences were aligned using ClustalX as implemented in BioEdit along with comparison sequences
selected from Scho
¨ nhuth and Mayden (2010) and obtained
from GenBank. They include two from the C. venusta species
group (GQ275207, CV374; GQ275205, CVFC1) and nine
from the C. lutrensis species group (GQ275187, CL112434;
GQ275186, CL767; GQ275201, CL0637; GQ275190, 2433;
GQ275189, CLBC2; DQ324102, CG7891; EU082522, 1499;
GQ275176, DSP0633; GQ275177, CL8811). Cyprinella proserpina and C. labrosa were used as outgroups (DQ324101,
CPR8814; GQ275181, CL38541). Numbers indicate GenBank accessions followed by cyt b designations of Scho
¨ nhuth and Mayden (2010). The best-fit model of nucleotide
substitution (TN93+I) was identified using MEGA 5.2
(Tamura et al., 2011) and used to create a Maximum
Likelihood tree in MEGA 5.2. A neighbor-joining tree was
also constructed using the TN93 model.
Morphometrics.—We used a digital camera to photograph
the lateral view of all 200 specimens, paying close attention
to consistent positioning to obtain unbiased measurements
(Strauss and Bond, 1990). We then digitized 11 anatomic
landmarks (Fig. 2A) on each image using TPSDIG (http://
life.bio.sunysb.edu/morph). We used the landmarks to form
a truss network, which is a systematically arranged set of
distances among a preselected set of anatomical landmarks
(Strauss and Bookstein, 1982), comprised of 20 interlandmark distances (Fig. 2B); the resulting distances served
as a multivariate data set characterizing overall body
morphology. We used a truss network because trusses
generally ensure complete coverage of the body and allow
measurement error to be partitioned statistically from the
variables (Strauss and Bond, 1990).
Using the species/hybrid identities determined by NEWHYBRIDS as a fixed factor, we conducted a multivariate
analysis of variance to determine whether species/hybrids
were morphologically different from one another. We
performed discriminate function analysis (DFA) on log-
Higgins et al.—Hybridization and introgression in cyprinids
Fig. 2. Location of anatomical landmarks (closed circles) and
corresponding distances (dashed lines) used to quantify overall body
morphology (A). Map of morphometric distances used to create truss
network obtained from digitized anatomical landmarks (B).
transformed measurements to ascertain which morphological characters were the most distinguishing features among
species/hybrids and to estimate classification functions to
predict group membership based on phenotypic variation
rather than genotypic differences. DFA provided discriminate scores, which allowed us to visually examine the
maximum separation between species and produced loadings (i.e., vector correlations between morphological variables and discriminate functions) to indicate how well each
variable separated the species. Because all loadings on the
first discriminate axis were positive and of similar magnitude, we performed a ‘‘size-free’’ DFA to determine the
degree to which species could be optimally distinguished
independent of size variation. This size-free DFA was
conducted by finding the pooled within-group principal
components, regressing the first principal component from
each character independently, and using the regression
residuals in a canonical discriminate analysis (Strauss, 1995).
RESULTS
A total of 56 AFLP fragments were included in the dataset,
with 83.9% (47 fragments) being polymorphic (95% criterion) among the 200 individuals. Seven fragments were
fixed in C. lutrensis and absent in C. venusta, and two were
fixed in C. venusta and absent in C. lutrensis. Proportions of
polymorphic fragments in pure C. lutrensis and pure C.
venusta were 69.64% and 44.6%, respectively. Overall, C.
lutrensis was more widely distributed and abundant within
the Bosque River than the Paluxy River (Fig. 3). Cyprinella
venusta was found at all four localities in both rivers, but in
decreasing numbers in the downstream localities, whereas
C. lutrensis was not observed in upstream localities.
Of the 200 specimens examined, only two individuals
were identified as being possible hybrids based on results
from both NEWHYBRIDS and STRUCTURE (Fig. 4); one
from the Bosque River and one from the Paluxy River. B3–15
had a 0.99 probability of being a hybrid with the probability
of being classified as an F2 equal to 0.69; the 90% credibility
interval was completely within the 0.10–0.90 admixture
range (Fig. 3A). P4–14 had a 0.99 probability of being a
hybrid with the probability of being a C. lutrensis backcross
275
Fig. 3. Admixture proportions (qi) from STRUCTURE indicating membership of individual specimens of C. lutrensis and C. venusta from the
(A) Bosque and (B) Paluxy rivers. Individuals with low q-values are C.
venusta. Bars indicate 90% credible regions. Individuals with C.
lutrensis cyt b haplotypes are indicated with filled circles whereas
those with C. venusta haplotypes are indicated with open circles.
equal to 0.88; the 90% credibility interval was completely
within the 0.10–0.90 admixture range (Fig. 3B). PCoA
revealed two distinct clusters of C. venusta and C. lutrensis
with the two hybrids being the most centrally located of all
200 individuals (Fig. 4). The positions of hybrids along the
primary axis, which accounted for 80.3% of the genetic
variation among individuals, were more indicative of
backcrosses than F1 hybrids. There was no evidence of
mitochondrial introgression as all individuals possessed the
mtDNA sequence that was expected based on the proportion
of nuclear DNA that they exhibited.
Both phylogenetic trees placed our specimens and
reference sequences within the same clades, so only the
maximum likelihood tree is shown (Fig. 5). Our specimens
were closely allied with the reference specimens of Scho
¨ nhuth and Mayden (2010), and species identifications based
on mtDNA matched those based on AFLP in all cases.
Additionally, we documented three mtDNA lineages of C.
lutrensis in the Paluxy River and two in the Bosque River
(clades A, B, and C in Fig. 5). The most abundant lineage
(clade A; found in both rivers) is allied with a specimen from
the Rio Grande River of New Mexico in the phylogeny of
Scho
¨ nhuth and Mayden (2010:fig. 6). The second lineage
(clade B; also found in both rivers, but represented by only
seven specimens) is allied with the specimens from the
Mississippi and Rio Grande drainages in the phylogeny of
Scho
¨ nhuth and Mayden (2010:fig. 6). The third lineage
(clade C) is represented in our study by only one specimen
from the Paluxy River and is most closely related to a
specimen of C. lutrensis from the Pecos River of Texas
(CL0637) and C. garmani from Durango, Mexico (CG7891,
1449) in the phylogeny of Scho¨ nhuth and Mayden
(2010:fig. 6).
Cyprinella venusta ranged in size from 2.09 cm to 8.23 cm
(mean6std; 4.2561.36), whereas C. lutrensis ranged in size
from 1.77 cm to 4.47 cm (mean6std; 3.0560.61). The two
species differed in overall body morphology (Wilks’ lambda
276
Fig. 4. Principal coordinate plot based on AFLPs of C. lutrensis (open
symbols) and C. venusta (closed symbols) from the Bosque (squares)
and Paluxy (circles) rivers showing distinct genetic differences between
species. Individuals identified as hybrids are identified with stars.
5 0.101, F3,192 5 12.75, P , 0.001), with the first
discriminant axis accounting for 87.5% of morphological
variation among individuals. The key morphological characters that separated the two species were standard length
(character 20; Fig. 2B) with C. venusta being the longer
species and measures of body depth (characters 11 and 12;
Fig. 2B) in which C. lutrensis has the deeper body. Morphologically, individuals classified as hybrids based on results
from NEWHYBRIDS and STRUCTURE were not intermediate
in reference to parental species. Based on the discriminant
functions of morphological characters, individuals genetically identified as C. lutrensis from the Paluxy River were
correctly classified 100% of the time whereas those from the
Bosque River were correctly classified 92% of the time.
Individuals genetically identified as C. venusta from the
Paluxy River were correctly identified based on morphology
with 97.4% accuracy; C. venusta from the Bosque River were
classified with 93.6% accuracy.
DISCUSSION
Cyprinella lutrensis and C. venusta represent two species
groups consisting of multiple lineages, only some of which
have been formally recognized taxonomically (Scho
¨ nhuth
and Mayden, 2010). Because of current taxonomic uncertainties, we use the names C. venusta and C. lutrensis in a
broad sense to include all lineages not currently described as
unique species by Scho
¨ nhuth and Mayden (2010). Within
this context, the number of individuals classified as hybrids
(2 out of 200 specimens) in our study was unexpectedly low
and appeared to be later generation backcrosses. Furthermore, there were no instances of mtDNA introgression of
one species into the nuclear background of the other
species. The minimal amount of hybridization inferred from
Copeia 103, No. 2, 2015
AFLP data, in combination with the lack of mtDNA
introgression, indicates that pre- or postzygotic isolating
mechanisms effectively prevent genetic exchange between
C. lutrensis and C. venusta within the Bosque and Paluxy
rivers.
The finding of minimal hybridization at our study sites is
in contrast to those of Walters et al. (2008) and Ward et al.
(2012) who reported extensive introgressive hybridization
between C. lutrensis and C. venusta in the upper Coosa River,
Georgia where C. lutrensis is thought to have been
introduced in 1974, and Broughton et al. (2011) who
reported hybridization in two drainages in Texas where
the two species are likely to be naturally sympatric. Walters
et al. (2008), using morphological, microsatellite, and
mtDNA data, found that 34% of their total catch was
represented by hybrids, with only 1.2% represented by C.
lutrensis. Most individuals having hybrid genotypes were
phenotypically indistinguishable from C. venusta. Ward et
al. (2012), using the same morphological and genetic
methodology, found hybrids at all but the uppermost reach
of their transect, with some sites consisting of .20%
hybrids. The majority of hybrids were later-generation, with
C. venusta backcrosses being predominant. Broughton et al.
(2011) sampled small numbers of individuals from multiple
drainages across Oklahoma and Texas and used coloration
along with two mtDNA loci and one nuclear locus to
identify hybrids. They reported a mismatch between nuclear
and mtDNA sequences in two out of 19 specimens from the
two rivers in which hybridization was observed: one from
Sycamore Creek, a tributary of the Rio Grande, on the
county line between Val Verde and Kinney counties, TX
(erroneously indicated as being from Cooke Co., in their
table 1 [Broughton, pers. comm.]) and one from the North
Fork of the Guadalupe River in Kerr Co., TX, representing a
hybrid frequency of 11% and 10%, respectively. Most
individuals from these two rivers were reported as having
intermediate or mixed phenotypes, and several individuals
had nuclear or mtDNA sequences that did not match their
morphology (though not all specimens were represented by
both mtDNA and nuclear sequences). No specimens from
other rivers were documented as having mixed or intermediate morphologies or mismatched DNA sequences; however, rivers in their study were represented by only one to six
specimens.
Earlier reports of hybrids in the San Marcos and Guadalupe rivers of Texas were documented by Jurgens (1951) and
Hubbs et al. (1953) but were based only on phenotype.
Furthermore, the authors did not state which phenotypic
characteristics were relied upon to identify hybrids, thus the
validity of their findings cannot be assessed. Field guides,
such as Freshwater Fishes of Texas: A Field Guide (Thomas
et al., 2007) and Fishes of Oklahoma (Miller and Robinson,
2004), typically indicate that breeding males of C. venusta
have blue dorsal and lateral regions with yellow-white or
yellow fins, respectively. However, the Peterson’s field guide
(Page and Burr, 2011) describes C. venusta in Texas as having
red-orange fins. Within the Bosque and Paluxy rivers, we
routinely observed specimens with the distinct caudal spot
typical of C. venusta in combination with reddish-orange
fins. We examined 16 of these brightly colored specimens,
and they were clearly C. venusta based on AFLP data and
mtDNA cyt b sequences (data not shown). These results
indicate that the bright nuptial coloration typical of male C.
lutrensis (Dugas and Franssen, 2011) can also occur in C.
Higgins et al.—Hybridization and introgression in cyprinids
277
Fig. 5. Maximum likelihood tree of cyt b haplotypes of C. lutrensis and C. venusta from the Bosque and Paluxy rivers along with reference specimens
of other species within these species groups. Only individuals representative of unique haplotypes are shown. Bootstrap values for major clades are
indicated. Reference specimens are indicated by the first three letters of the specific epithet (ven 5 C. venusta, gar 5 C. garmani, lut 5 C. lutrensis,
lep 5 C. lepida, sua 5 C. suavis, pro 5 C. proserpina, lab 5 C. labrosa) followed by the cyt b designations (in brackets) given in Scho¨nhuth and
Mayden (2010). Cyprinella proserpina and C. labrosa are outgroups.
278
venusta. Given that Jurgens (1951) and Hubbs et al. (1953)
may have relied on this combination of characteristics to
identify hybrids, their reports of hybrid swarms should be
viewed with caution.
Although hybridization unquestionably has been documented at other locations (Walters et al., 2008; Broughton et
al., 2011; Ward et al., 2012), we clearly documented that
hybridization is not an inevitable consequence of the two
species occurring sympatrically. Lower hybridization rates in
the Bosque and Paluxy rivers compared to the Coosa River in
Georgia (Walters et al., 2008; Ward et al., 2012) and
Sycamore Creek and the Guadalupe River in Texas
(Broughton et al., 2011) can be explained by several factors,
including differing environmental conditions, population
structure, and prezygotic isolating mechanisms. Postzygotic
barriers seem to be a less likely explanation given the
evidence of intrinsic hybrid viability reported by Blum et al.,
2010, unless hybrids have a selective disadvantage in certain
environments. Increased hybridization may occur under
certain environmental conditions not currently present in
the Bosque and Paluxy rivers. River systems can have
substantial environmental differences, such as stream
discharge and turbidity, which affect reproductive behavior,
altering the ability to discriminate between species. Environmental changes are thought to be responsible for
increased hybridization beyond what historically occurred
in naturally sympatric populations of trout (Young et al.,
2001; Heath et al., 2010). Alternatively, differences in
population structure where one species differs greatly in
abundance may increase hybridization rates (Avise and
Saunders, 1984; Dowling et al., 1989). Such differences
certainly occur between our study sites where both species
are abundant and spatially segregated and the Coosa River,
Georgia, where the native species, C. venusta, greatly
outnumbers the introduced species, C. lutrensis (Walters et
al., 2008; Ward et al., 2012). Additionally, regional differences in hybridization rate could result from differences in
prezygotic isolation between sympatric and allopatric
populations evolved through selective mechanisms (Albert
and Schluter, 2004; Crispo et al., 2011), including reinforcement (Dobzhansky, 1940), adaptation to different niches
(Kilias et al., 1980), direct selection on mating preferences
(Servedio, 2001), or through neutral processes (Edmands,
2002). Differences in premating isolation between allopatric
and sympatric populations have been observed in other
fishes including sticklebacks (Rundle and Schluter, 1998)
and trout (Rubidge and Taylor, 2004) and have been
attributed to reinforcement or spatiotemporal reproductive
segregation. Although assortative mating between C. venusta
and C. lutrensis was documented by Blum et al. (2010),
native populations of C. venusta from the Coosa River,
which have only encountered introduced populations of red
shiner since the 1970s (Fuller et al., 1999), may not possess
the same degree of prezygotic incompatibility as populations that have been in sympatry with C. lutrensis for longer
periods of time.
Furthermore, differences in reproductive compatibility
among populations may have evolved by neutral as opposed
to selective processes (Demuth and Wade, 2005). As lineages
diverge, changes in mating behaviors or genetic differences
resulting in epistasis among derived alleles eventually lead
to reproductive incompatibility even in the absence of
reinforcement or other selective mechanisms. Cyprinella
venusta and C. lutrensis in the Coosa River of Georgia may
Copeia 103, No. 2, 2015
not be of the same genetic lineages as those in Texas and, if
so, they may have accumulated neutral genetic differences
leading to reproductive isolation. Scho
¨ nhuth and Mayden
(2010) showed polyphyletic C. venusta and C. lutrensis
mtDNA clades and reported a highly divergent lineage of
C. venusta (basal to other C. venusta, C. spiloptera, and C.
whipplei) from the Apalachicola and Ochlocknee rivers of
Georgia and Florida (near the Coosa River). Kristmundsdo´ttir and Gold (1996) previously identified this divergent
clade, along with another that included specimens from the
Coosa River, and suggested that C. venusta could be
separated into four different species. Within the Bosque
and Paluxy rivers, we identified three mtDNA lineages of C.
lutrensis and one of C. venusta; however, Walters et al. (2008)
did not provide DNA sequences that could be used to
determine the genetic lineage of their specimens relative to
ours. Given the likelihood that genetic lineages of one or
both species in Texas are different from those in the Coosa
River, Georgia, and that these lineages have been evolving
separately for a considerable length of time, geographic
differences in reproductive compatibility caused by neutral
processes cannot be ruled out as an explanation for
differences in hybridization rates.
Another unexpected finding of our study was the
sympatric occurrence of divergent mtDNA lineages of C.
lutrensis in both the Bosque and Paluxy rivers. These three
lineages occurred within a single, homogenous nuclear
background, demonstrating that they do not represent three
sympatric species. The existence of multiple, divergent
mtDNA lineages of C. lutrensis and paraphyly of the C.
lutrensis species group has been recognized by Broughton
¨ nhuth and Mayden (2010), and
and Gold (2000), Scho
Broughton et al. (2011); however, these lineages have never
been reported as being sympatric. Broughton et al. (2011)
examined specimens from throughout Texas and Oklahoma
and identified four mtDNA clades of C. lutrensis, which
appeared to be geographically restricted to the Red River
drainaige of Oklahoma and Texas, the Arkansas River
drainage of Oklahoma, Croton Creek of the Brazos
River drainage (represented by one specimen), and rivers
of southern Texas and Mexico. The latter clade most likely
represents C. suavis of Scho
¨ nhuth and Mayden (2010),
which did not occur among our samples suggesting that C.
suavis may not occur as far north as hypothesized by
Scho
¨ nhuth and Mayden (2010:fig. 7). Although the four
clades documented by Broughton et al. (2011) appeared to
occur allopatrically, this may simply be an artifact of limited
sampling. The sympatric occurrence of multiple, divergent
mtDNA lineages in the Bosque and Paluxy rivers may be the
product of recent bait bucket introductions or historical
(natural) introgression among members of the C. lutrensis
species group.
Our finding of three, highly divergent mtDNA lineages of
C. lutrensis within a single nuclear gene pool emphasizes a
major weakness in using mtDNA to delimit and identify
species (sometimes referred to as DNA taxonomy and DNA
barcoding, respectively)—namely, the problem of mtDNA
introgression. Although mtDNA studies play a valuable role
in identifying patterns of genetic diversity, multilocus
techniques such as AFLP (and microsatellites) are better able
to delimit gene pools and species (Creer et al., 2004;
Dasmahapatra et al., 2010). Single-nucleotide polymorphisms (SNPs) will be increasingly valuable in this regard
as the use of massively parallel sequencers (using techniques
Higgins et al.—Hybridization and introgression in cyprinids
such as RAD-seq) has become cost effective (Peterson et al.,
2012; Rocha et al., 2013). Because of widespread transport of
Cyprinella for the baitfish trade (e.g., bait distributors in Texas
can obtain C. lutrensis from hatcheries in Missouri) and bait
bucket introductions, it is likely that the historical geographic
range of mtDNA lineages within the C. lutrensis species group
will remain largely unknown. Furthermore, if introgression
among lineages of the C. lutrensis species group (as reported
herein) occurs widely, it may be difficult to fully resolve
longstanding taxonomic issues within this group.
ACKNOWLEDGMENTS
We thank J. Munz for assistance in the field, and acknowledge the Office of Student Research & Creative Activities at
Tarleton State University for monetary support. Specimens
were harvested under CLH’s scientific collecting permit SPR0403-284 with the Texas Parks and Wildlife Department.
LITERATURE CITED
Albert, A. Y. K., and D. Schluter. 2004. Reproductive
character displacement of male stickleback mate preference: reinforcement or direct selection? Evolution 58:
1099–1107.
Anderson, E. C., and E. A. Thompson. 2002. A model-based
method for identifying species hybrids using multilocus
genetic data. Genetics 160:1217–1229.
Avise, J. C., and N. C. Saunders. 1984. Hybridization and
introgression among species of sunfish (Lepomis): analysis
by mitochondrial DNA and allozyme markers. Genetics
108:237–255.
Blum, M. J., D. M. Walters, N. M. Burkhead, B. J. Freeman,
and B. A. Porter. 2010. Reproductive isolation and
the expansion of an invasive hybrid swarm. Biological
Invasions 12:2825–2836.
Broughton, R. E., and J. R. Gold. 2000. Phylogenetic
relationships in the North American cyprinid genus
Cyprinella (Actinopterygii: Cyprinidae) based on mitochondrial ND2 and ND4L gene sequences. Copeia
2000:1–10.
Broughton, R. E., K. C. Vedala, T. M. Crowl, and L. L.
Ritterhouse. 2011. Current and historical hybridization
with differential introgression among three species of
cyprinid fishes (genus Cyprinella). Genetica 139:699–707.
Burgarella, C., Z. Lorenzo, R. Jabbour-Zahab, R. Lumaret,
E. Guichoux, R. J. Petit, A. Soto, and L. Gil. 2009.
Detection of hybrids in nature: application to oaks
(Quercus suber and Q. ilex). Heredity 102:442–452.
Choi, S. S., S. H. Cha, and C. Tappert. 2010. A survey
of binary similarity and distance measures. Journal of
Systematics, Cybernetics, and Informatics 8:43–48.
Creer, S., R. S. Thorpe, A. Malhotra, W. H. Chou, and A. G.
Stenson. 2004. The utility of AFLPs for supporting
mitochondrial DNA phylogeographical analyses in the
Taiwanese bamboo viper, Trimeresurus stejnegeri. Journal of
Evolutionary Biology 17:100–107.
Crispo, E., J. S. Moore, J. A. Lee-Yaw, S. M. Gray, and B. C.
Haller. 2011. Broken barriers: human-induced changes
to gene flow and introgression in animals. Bioessays
33:508–518.
Dasmahapatra, K. K., M. Elias, R. I. Hill, J. I. Hoffman, and
J. Mallet. 2010. Mitochondrial DNA barcoding detects
some species that are real, and some that are not.
Molecular Ecology Resources 10:264–273.
279
Demuth, J. P., and M. J. Wade. 2005. On the theoretical
and empirical framework for studying genetic interactions
within and among species. The American Naturalist
165:524–536.
Dobzhansky, T. 1940. Speciation as a stage in evolutionary
divergence. The American Naturalist 74:312–321.
Dowling, T. E., G. R. Smith, and W. M. Brown. 1989.
Reproductive isolation and introgression between Notropis
cornutus and Notropis chrysocephalus (family Cyprinidae):
comparison of morphology, allozymes, and mitochondrial DNA. Evolution 43:620–634.
Dudgeon, D., A. H. Arthington, M. O. Gessner, Z. Kawabata,
D. J. Knowler, C. Levenque, R. J. Naiman, A. PrieurRishard, D. Soto, M. L. J. Stiassny, and C. A. Sullivan.
2006. Freshwater biodiversity: importance, threats, status
and conservation challenges. Biology Reviews 81:163–182.
Dugas, M. B., and N. R. Franssen. 2011. Nuptial coloration
of red shiners (Cyprinella lutrensis) is more intense in
turbid waters. Naturwissenschaften 98:247–251.
Edmands, S. 2002. Does parental divergence predict
reproductive compatibility? Trends in Ecology & Evolution 17:520–527.
Fridley, J. D., J. J. Stachowicz, S. Naeem, D. F. Sax, E. W.
Seabloom, M. D. Smith, T. J. Stohlgren, D. Tilman, and
B. Von Holle. 2007. The invasion paradox: reconciling
pattern and process in species invasions. Ecology 88:3–17.
Fuller, P. L., L. G. Nico, and J. D. Wiliams. 1999.
Nonindigenous fishes introduced into inland waters of
the United States. American Fisheries Society Special
Publication 27, Bethesda, Maryland.
Heath, D., C. M. Bettles, and D. Roff. 2010. Environmental
factors associated with reproductive barrier breakdown in
sympatric trout populations on Vancouver Island. Evolutionary Applications 3:77–90.
Hubbs, C. L. 1955. Hybridization between fish species in
nature. Systematic Zoology 4:1–20.
Hubbs, C. L., A. Kuehne, and J. C. Ball. 1953. The fishes of
the upper Guadalupe River, Texas. Texas Journal of
Science 5:216–244.
Jelks, H. L., S. J. Walsh, N. M. Burkhead, S. ContrerasBalderas, E. Diaz-Pardo, D. A. Hendrickson, J. Lyons,
N. E. Mandrak, F. McCormick, J. S. Nelson, S. P.
Platania, B. A. Portes, C. B. Renaud, J. J. SchmitterSoto, E. B. Taylor, and M. L. Warren, Jr. 2008.
Conservation status of imperiled North American freshwater and diadromous fishes. Fisheries 33:372–407.
Jones, T. 2000. Fisheries survey of the Bosque River
watershed above Lake Waco. Texas Institute for Applied
Environmental Research, Stephenville, Texas.
Jurgens, K. C. 1951. The distribution and ecology of the
fishes in the San Marcos River. Unpubl. M.S. thesis,
Unviversity of Texas, Austin, Texas.
Kilias, G., S. N. Alahiotis, and M. Pelecanos. 1980. A
multifactorial genetic investigation of speciation theory
using Drosophila melanogaster. Evolution 34:730–737.
Kristmundsdo
´ ttir, A. Y., and J. R. Gold. 1996. Systematics
of the blacktail shiner (Cyprinella venusta) inferred from
analysis of mitochondrial DNA. Copeia 1996:773–783.
Linam, G. W., and L. J. Kleinsasser. 1989. Fisheries use
attainability study for the Bosque River. Resource Protection Division, Texas Parks and Wildlife Department,
Austin, Texas.
Marsh-Matthews, E., W. J. Matthews, and N. R. Franssen.
2011. Can a highly invasive species re-invade its native
280
community? The paradox of the red shiner. Biological
Invasions 13:2911–2924.
Matthews, W. J., and L. G. Hill. 1977. Tolerance of the red
shiner, Notropis lutrensis (Cyprinidae) to environmental
parameters. The Southwestern Naturalist 22:89–99.
Miller, R. J., and H. W. Robison. 2004. Fishes of Oklahoma.
University of Oklahoma Press, Norman, Oklahoma.
Muhlfeld, C. C., S. T. Kalinowski, T. E. McMahon, M. L.
Taper, S. Painter, R. F. Leary, and F. W. Allendorf. 2009.
Hybridization rapidly reduces fitness of a native trout in
the wild. Biology Letters 5:328–331.
Nelson, J. S., E. J. Crossman, H. Espinoza-Perez, L. T.
Findley, C. R. Gilbert, R. N. Lea, and J. D. Williams.
2004. Common and Scientific Names of Fishes from the
United States, Canada, and Mexico. American Fisheries
Society special publication 29, Bethesda, Maryland.
Noor, M. A. F. 1999. Reinforcement and other consequences
of sympatry. Heredity 83:503–508.
Osterberg, C. O., and R. J. Rodriguez. 2006. Hybridization
and cytonuclear associations among native westslope
cutthroat trout, introduced rainbow trout, and theu
hybrids with the Stehekin River drainage, North Cascades
National Park. Transactions of the American Fisheries
Society 135:924–942.
Page, L. M., and B. M. Burr. 2011. Peterson’s Field Guide to
Freshwater Fishes of North America North of Mexico.
Houghton Mifflin Harcourt, Boston.
Peakall, R., and P. E. Smouse. 2006. GenAlEx 6: genetic
analysis in Excel. Population genetic software for teaching
and research. Molecular Ecology Resources 6:288–295.
Peterson, B. K., J. N. Weber, E. H. Kay, H. S. Fisher, and
H. E. Hoekstra. 2012. Double digest RADseq: an inexpensive method for de novo SNP discovery and genotyping
in model and non-model species. PLoS ONE 7:e37135.
doi:10.1371/journal.pone.0037135
Phillips, C. D., C. A. Henard, and R. S. Pfau. 2007.
Amplified fragment length polymorphism and mitochondrial DNA analyses reveal patterns of divergence and
hybridization in the hispid cotton rat (Sigmodon hispidus).
Journal of Mammalogy 88:351–359.
Pritchard, J. K., M. Stephens, and P. Donnelly. 2000.
Inference of population structure using multilocus genotype data. Genetics 155:945–959.
Rahel, F. J. 2000. Homogenization of fish faunas across the
United States. Science 288:854–856.
Rhymer, J. M., and D. Simberloff. 1996. Extinction by
hybridization and introgression. Annual Review of Ecology and Systematics 27:83–109.
Rocha, L., M. Bernal, M. R. Gaither, and M. E. Alfaro.
2013. Massively parallel DNA sequencing: the new
frontier in biogeography. Frontiers of Biogeography
5:67–77.
Rubidge, E. M., and E. B. Taylor. 2004. Hybrid zone
structure and the potential role of selection in hybridizing
populations of native westslope cutthroat trout (Oncorhynchus clarki lewisi) and introduced rainbow trout (O.
mykiss). Molecular Ecology 13:3735–3749.
Rundle, H. D., and D. Schluter. 1998. Reinforcement of
stickleback mate preferences: sympatry breeds contempt.
Evolution 52:200–208.
Schmidt, T. R., J. P. Bielawski, and J. R. Gold. 1998.
Molecular phylogenetics and evolution of the cytochrome
b gene in the cyprinid genus Lythrurus (Actinopterygii:
Cypriniformes). Copeia 1998:14–22.
Copeia 103, No. 2, 2015
Scho
¨ nhuth, S., and R. L. Mayden. 2010. Phylogenetic
relationships in the genus Cyprinella (Actinopterygii: Cyprinidae) based on mitochondrial and nuclear gene sequences.
Molecular Phylogenetics and Evolution 55:77–98.
Scribner, K. T., K. S. Page, and M. L. Barton. 2001.
Hybridization in freshwater fishes: a review of case studies
and cytonuclear methods of biological inference. Reviews
in Fish Biology and Fisheries 10:293–323.
Servedio, M. R. 2001. Beyond reinforcement: the evolution
of premating isolation by direct selection on preferences
and postmating, prezygotic incompatibilities. Evolution
55:1909–1920.
Stone, K. 2012. Spatial and temporal variation in fish
assemblage structure along the Paluxy River, Texas.
Unpubl. M.S. thesis, Tarleton State University, Stephenville, Texas.
Strauss, R. E. 1995. Metamorphic growth-gradient changes
in South American loricariid catfishes Loricariichthys
maculatus and Pseudohemiodon laticeps. Studies on Neotropical Fauna and Environment 30:177–191.
Strauss, R. E., and C. E. Bond. 1990. Taxonomic methods:
morphology, p. 109–140. In: Methods for Fish Biology. P.
Moyle and C. Schreck (eds.). American Fisheries Society,
Bethesda, Maryland.
Strauss, R. E., and F. L. Bookstein. 1982. The truss: body
form reconstruction in morphometrics. Systematic Zoology 31:113–135.
Strayer, D. L., and D. Dudgeon. 2010. Freshwater biodiversity conservation: recent progress and future challenges.
Journal of the North Americal Benthological Society
29:344–358.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei,
and S. Kumar. 2011. MEGA5: Molecular Evolutionary
Genetics Analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28:2731–2739.
Thomas, C., T. H. Bonner, and B. G. Whiteside. 2007.
Freshwater Fishes of Texas: A Field Guide. Texas A&M
University Press, College Station, Texas.
Vitousek, P. M., H. A. Mooney, J. Lubchenco, and J. M.
Melillo. 1997. Human domination of Earth’s ecosystems.
Science 277:494–499.
Vos, P., R. Hogers, M. Bleeker, M. Reijans, T. van de Lee,
M. Hornes, A. Frijters, J. Pot, J. Peleman, M. Kuiper, and
M. Zabeau. 1995. AFLP: a new technique for DNA
fingerprinting. Nucleic Acids Research 23:4407–4414.
Walters, D. M., M. J. Blum, B. Rashleigh, B. J. Freeman, B. A.
Porter, and N. M. Burkhead. 2008. Red shiner invasion
and hybridization with blacktail shiner in the upper Coosa
River, USA. Biological Invasions 10:1229–1242.
Ward, J. L., M. J. Blum, D. M. Walters, B. A. Porter, N.
Burkhead, and B. Freeman. 2012. Discordant introgression in a rapidly expanding hybrid swarm. Evolutionary
Applications 5:380–392.
Weigel, D. E., J. T. Peterson, and P. Spruell. 2003. Introgressive hybridization between native cutthroat trout and
introduced rainbow trout. Ecological Applications 13:38–50.
Woodruff, D. S. 1973. Natural hybridization and hybrid
zones. Systematic Zoology 22:213–218.
Young, W. P., C. O. Ostberg, P. Keim, and G. H.
Thorgaard. 2001. Genetic characterization of hybridization and introgression between anadromous rainbow
trout (Oncorhynchus mykiss irideus) and coastal cutthroat
trout (O. clarkii clarki). Molecular Ecology 10:921–930.