1. health and fitness
2. disease

EDITORIAL BOARD
DR K M L PATHAK
Deputy Director-General (Animal Sciences)
Indian Council of Agricultural Research, Krishi Bhavan, New Delhi 110 114
DR M K BHOWMIK
Foremerly Director (Research), P-26, Udyan Park, 3, Chanditala
Branch Road, P.O. New Alipur, Kolkata 700 053
DR P K JOSHI
Director, National Academy of Agricultural Research
Management, Hyderabad, Andhra Pradesh 500 030
DR N KONDAIAH
Director, National Research Centre on Meat, Hyderabad,
Andhra Pradesh 500 030
DR LAL KRISHNA
Assistant Director-General (Animal Health), Indian Council of
Agricultural Research, Krishi Bhavan, New Delhi 110 014
SHRI R R LOKESHWAR
Former Chief Editor (Eng.), 5712 Vedavathy Block, Nandi
Enclave, 2nd Cross, 3rd Phase, 5th Block, Banashanker
Stage-3, Bangalore, Karnataka 560 085
DR (MRS) A A SHERIKAR
Formerly Professor and Head, Atlanta Co-op. Housing Society,
6-Sherikar Niwas, Plot 29, Sector 40, Nerula (Sea woods),
Navi Mumbai 400 706
DR K T SAMPAT
Director, National Institute for Animal Nutrition and Physiology,
Adugodi, Bangalore, Karnataka 560 030
DR B C SARKHEL
Director, Biotechnology Centre, Jawaharlal Nehru Krishi Vishwa
Vidyalaya, Jabalpur, Madhya Pradesh 482 104
DR M C SHARMA
Director, Indian Veterinary Research Institute, Izatnagar, Uttar
Pradesh 243 122
DR A K SRIVASTAVA
Director, National Dairy Research Institute, Karnal, Haryana
132 001
DR T P TRIVEDI
Project Director, Directorate of Information and Publications
of Agriculture, KAB I, Pusa, New Delhi 110 012
DR A K MISHRA
Project Director, Project Directorate on Cattle, Meerut Cantt,
Uttar Pradesh 250 001
Assistant Editor
:
ARUNA T KUMAR
Incharge (English Editorial Unit)
:
DR R P SHARMA
Chief Production Officer
Technical Officer (Production)
:
:
VIRENDER KUMAR BHARTI
ANIL KUMAR SETH
Senior Artist
:
NARENDRA BAHADUR
Annual Subscription
Individual
Institutional
Single copy
Inland
Rs 500
Rs 1500
Rs 125
Foreign
US $ 125
US $ 375
US $ 32
For any editorial enquiry please contact:
ARUNA T KUMAR, Ph: 011–25841004, 011–25842221 EXTN 612
E-mail: editorijans@icar.org.in ijans@icar.org.in
For subscription and advertisement please contact:
S K JOSHI
Business Manager
DIRECTORATE OF INFORMATION AND PUBLICATIONS OF AGRICULTURE
INDIAN COUNCIL OF AGRICULTURAL RESEARCH
KRISHI ANUSANDHAN BHAVAN, NEW DELHI 110 012
Telefax: 011–25843657, E-mail: bmicar@icar.org.in
• All disputes are subject to the exclusive jurisdiction of competent courts and forums in Delhi/New Delhi only • The Council does not assume any
responsibility for opinions offered by the authors in the articles and no material in any form can be reproduced without permission of the Council • The
Council is not responsible for any delay, whatsoever, in publication/delivery of the periodicals to the subscribers due to unforeseen circumstances or postal
delay • Readers are recommended to make appropriate enquiries before sending money, incurring expenses or entering into commitments in relation to
any advertisement appearing in this publication. The Council does not vouch for any claims made by the advertisers of products and services. The publisher
and the editor of the publication shall not be held liable for any consequences in the event of such claims not being honoured by the advertisers.
THE INDIAN JOURNAL OF
ANIMAL SCIENCES
Previous Issue : Vol. 80, No. 3, pp. 189–272
Vol. 80, No.4
April 2010
CONTENTS
ANIMAL HEALTH
Molecular detection of Staphylococcus aureus mastitis in crossbred cows based on genus specific
gap gene and species specific aroA gene PCR assay
Neelesh Sindhu, Anshu Sharma and V K Jain
Detection and differentiation of leptospires using real-time polymerase chain reaction
G Malathi, K G Tirumurugaan, K Vijayarani and K Kumanan
Activity of extracts of Synzium aromaticum against microbes of veterinary importance
Meenakshi Virmani, S L Garg, Nitin Virmani and S K Batra
Uterine torsion in bovines: a review
S P S Ghuman
Insulin-like growth factor-I and -II in buffalo ovary: mRNA expressions and partial sequences
R Dev, M K Sharma and Dheer Singh
Effect of Bt cotton plants on oxidative stress in sheep
B Anilkumar, A Gopala Reddy, B Kalakumar, K Jyothi and K S Gopi
Micro-minerals status in goats of different age in semi arid region of India
Neeru Bhooshan, Puneet Kumar and M C Yadav
Effect of age and reproductive state on phosphatase enzymes and steroid hormones profile in Indian goats
Neeru Bhooshan, Puneet Kumar and M C Yadav
275
279
284
289
306
313
317
321
Short Communications
Comparison of PCR with conventional techniques for the diagnosis of brucellosis in cattle
P Kaushik, D K Singh and A K Tiwari
Therapeutic and residual efficacy analysis of some anti-tick compounds against natural Boophilus
microplus infestation in crossbred cattle
Hira Ram and A K Sharma
Differentiation of the tubular components and collecting duct system of nephron in buffalo kidney
during prenatal life
Monika Suman, Neelam Bansal and Varinder Uppal
Histogenesis of lingual epithelium during prenatal life in buffalo
Deepanjali Verma, Varinder Uppal and Neelam Bansal
Ultrastructure of gut associated lymphoid tissues in Kadaknath fowl
P C Kalita, G K Singh and B S Dhote
Biochemical and enzymatic changes in downer cow syndrome
Subhash Kachhawaha and R K Tanwar
Alteration in surface body temperature and physiological responses in Sirohi goats during day
time in summer season
S K Phulia, R C Upadhyay, S K Jindal and R P Misra
326
329
331
333
336
338
340
ANIMAL PRODUCTION
Inventorization of Gaushala resources and their use in breed improvement and conservation programmes
Dinesh Kumar Yadav and Pradeep Kumar Vij
Environmental and genetic effects on growth traits of Chokla sheep
B P Kushwaha, Ajoy Mandal, Ravindra Kumar and Sushil Kumar
343
346
Growth rate and wool production of Marwari lambs under arid region of Rajasthan
H K Narula, Ajay Kumar, M Ayub and Vimal Mehrotra
Effect of supplementing bypass fat prepared from soybean acid oil on milk yield and
nutrient utilization in Murrah buffaloes
S S Thakur and S K Shelke
On-farm evaluation of urea molasses multi-nutrient blocks enriched with minerals in goats
R Singh, S Kumar and R Bhardwaj
Carcass and meat quality characteristics of designated indigenous sheep breeds of India
A R Sen and S A Karim
Carcass and meat characteristics of Soviet Chinchilla rabbits as influenced by age
A R Sen and S A Karim
350
354
358
362
366
Short Communications
Identification of single nucleotide variations in the genes related to reproduction in riverine
buffalo (Bubalus bubalis)
J Thanislass, R Sumathy, S Venkatesa Perumal and K V Subba Reddy
Effect of farms on growth pattern of crossbred cattle
Surendra Singh, A K Vasisht, A K Paul and L M Bhar
Influence of genetic and non genetic factors on growth profile of Bharat Merino sheep in
semi arid region of Rajasthan
Ashish Chopra, L L L Prince, G R Gowane and A L Arora
Impact of breed improvement programme on goat production under farmers’ flocks
M K Singh, A K Goel, B Rai, Ashok Kumar and M C Sharma
Evaluation of growth, feed conservation efficiency and carcass traits of Jamunapari goats
under intensive feeding system
M K Singh, T K Dutta, R B Sharma, A K Das and N P Singh
Housing and feeding managemental practices for goats followed in South Gujarat
G P Sabapara, S B Deshpande, V B Kharadi and P K Malik
370
373
376
379
382
385
Indian Journal of Animal Sciences 80 (4): 275–278, April 2010
Molecular detection of Staphylococcus aureus mastitis in crossbred cows based on
genus specific gap gene and species specific aroA gene PCR assay
NEELESH SINDHU1, ANSHU SHARMA2 and V K JAIN3
CCS Haryana Agricultural University, Hisar, Haryana 125 004 India
Received: 5 August 2009; Accepted: 4 October 2009
ABSTRACT
The present study aimed to diagnose Staphylococcus aureus from mastitic milk samples of crossbred cows using
genus specific PCR assay based on gap gene (encoding glyceraldehyde –3–phosphate dehydrogenase) and species
specific PCR assay based on aroA gene (encoding 5–enolpyruvylshikimate–3–phosphate synthase). For internal control,
a set of universal primers were included. Out of 770 milk samples tested, 50.74 and 52.21% samples were diagnosed to
be positive for Staphylococcus spp. by cultural examination and gap gene based genus specific PCR, whereas as many
as 41.91% and 43.38% samples were found positive for Staphylococcus aureus by bacteriological examination and
aroA gene based species specific PCR respectively. The assay could also detect the “no-growth” milk samples. Using
this rapid, sensitive and specific method, staphylococcal isolates can be differentiated at the subspecies or strain level
within 6–8 h and it can contribute to an increased understanding of mastitis epidemiology and control options for
overall increase in lifetime productivity of crossbred cattle
Key words: aroA, Crossbred cows, gap, Mastitis, PCR, Staphylococcus aureus
from functional quarters of lactating crossbred cows (Hariana
× Holstein Friesian with mixed crosses of Jersey, Sahiwal
and Brown Swiss) from organized farms and individual
farmers brought to Veterinary College Central Laboratory,
COVS, CCS Haryana Agricultural University, Hisar, were
included in the present investigation.
Bacteriological examination: Milk (10 microlitres) from
each sample was streaked on 5% sheep blood agar plates
and MacConkey’s lactose agar plates separately. All Gram
positive, catalase positive and oxidase negative isolates were
confirmed as belonging to genus Staphylococcus.
Staphylococcal isolates were further classified as coagulase
positive and coagulase negative by standard citrate and rabbit
plasma coagulase test. Coagulase positive isolates were
further characterized biochemically by standard thermostable
nuclease test, latex agglutination test (Staph latex test kit)
and utilization of mannitol.
DNA extraction from milk: Mastitic milk (1.5 ml) was
centrifuged at 5 000 rpm for 2 min. Pellet was resuspended
in 600 μl NTE buffer [0.1 M NaCl, 20 mM Tris-HCl and 1
mM EDTA], then the suspension was treated with 100μl of
24% sodium dodecyl sulphate and digested with proteinase
K (20 mg/ml) and ribonuclease A for 2 h. 100 μl of 5 M NaCl
and 80 μl of CTAB-NaCl [10% CTAB, 0.7 M NaCl] was added
and incubated in water-bath at 65°C for 10 min. Then phenol:
chloroform: isoamyl alcohol [25: 24: 1] and chloroform:
India stands first in milk production in the world (Lahoti
and Chole 2009). Infection of the cow’s udder (bovine
mastitis) has remained one of the major constraints in growth
of dairy industry in India and abroad (Sasidhar et al. 2002,
Osteras and Solverod 2009). In India, among various
pathogens responsible for mastitis, Staphylococcus aureus
presents growing and formidable challenges for animal health
concerns and remains predominant organism in crossbred
cows (Singh and Kataria 2009, Peer et al. 2009). Several
nucleic acid amplification assays based on specific gene
targets and universal sequences were reported for diagnosis
of Staphylococcus aureus from bovine mastitis in India
(Sindhu et al. 2008, Dubey et al. 2009, Sharma et al. 2009).
The present investigation describes a suitable and specific
method for molecular diagnosis of Staphylococcus aureus
from milk samples from crossbred cows infected with
mastitis using gap gene and aroA gene as target for
amplification.
MATERIALS AND METHODS
Collection of milk samples: Milk samples (770) collected
Present address: 1 Ph.D. Scholar, 3 Associate Professor,
Department of Veterinary Clinical Medicine, Ethics and
Jurisprudence (E mail: drneeleshsindhu@yahoo.com); 2 Scientist
cum-Incharge, Veterinary College Central Laboratory, College of
Veterinary Sciences.
3
276
SINDHU ET AL.
[Indian Journal of Animal Sciences 80 (4)
Table 1. 5’–3’ primer sequences for gene amplification
Name
Primer sequence 5’–3’
Reference
Universal
F: AGTGGAATTCCATGTGTAGC
R: GAGTGCTTAATGCGTTAGCT
F: ATGGTTTTGGTAGAATTGGTCGTTTA
R: GACATTTCGTTATCATACCAAGCTG
F: AAGGGCGAAATAGAAGTGCCGGGC
R: CACAAGCAACTGCAAGCAT
Riffon et al. (2001)
210
Yugeros et al. (2001)
933
Marcos et al. (1999)
1 153
gap
aroA
Expected product
size (bp)
encoding glyceraldehydes–3–phosphate dehydrogenase is a
part of glycolytic operon in Staphylococcus aureus and was
used to characterize Staphylococcus spp. (Yugeros et al. 2000,
Ghebremedhin et al. 2008). 5–enol pyruvlshikimate –3–
phosphate synthase is a key enzyme of aromatic amino acids
and the folate universal biosynthetic pathway and aroA gene,
which encodes this enzyme was described as a tool for
identification of Staphylococcus aureus in milk of cows and
ewes (Marcos et al. 1999, Saei et al. 2009) but on extensive
search of literature, no study was found to be reported from
India regarding diagnosis of mastitis using gap and aroA gene
in crossbred cows.
On bacteriological examination of 770 milk samples, 272
samples were found culturally positive revealing 138
staphylococci, 87 streptococci and 47 E. coli isolates.
Staphylococcal culture isolates were further differentiated
into 114 coagulase positive and 24 coagulase negative
staphylococci. Based on biochemical tests, all coagulase
isoamyl alcohol [24: 1] extraction was done until the interface
was clear. Precipitation of DNA was done by sodium acetate
(pH 5.2) and chilled 100% ethanol. Finally DNA was
dissolved in 50 μl of in TE buffer (pH 8.0) (10 mM Tris HCl,
5 mM EDTA) and stored at –20°C till further use.
DNA extraction from bacterial culture isolates: In brief,
single colony from overnight grown culture was inoculated
in 25μl of TE buffer (pH 8.0) (10 mM Tris HCl, 5 mM EDTA)
and heated at 99°C for 15 min and cooled immediately by
putting on ice. The resultant template DNA was stored at –
20°C and 5μl of each sample was used for PCR analysis.
Amplification and analysis: PCR reactions were
standardized using different MgCl2 concentrations, Taq DNA
polymerase concentrations, primer concentrations, annealing
temperature and number of cycles in thermocycler. The PCR
reaction mixture optimized was 200 μm deoxynucleotide
triphosphate (dNTP) mix, 1X PCR buffer (with 10 mM TrisHCl, pH 8.8, 50 mM KCl and 0.8% Nonidet P 40), 1.5 mM
MgCl2, 20 pmol of each primers, 2.5 U Taq DNA polymerase,
200 ng DNA as template and nuclease free water. Sequences
of oligonucleotide primers taken are indicated in Table 1.
The optimized PCR conditions are indicated in Table 2. DNA
isolated from pure bacterial culture of Staphylococcus aureus
ATCC 25923 was taken as positive control, nuclease free
water was taken as negative control and PCR mixture without
template was taken as PCR control to check the possibility
of contamination. After amplification, amplified products
were subjected to 2% agarose gel prepared using 0.5X TBE
buffer [pH 8.0, 0.045 M Tris borate, 0.001 M EDTA]
containing ethidium bromide (0.2 μg/ml) with 100 bp gene
ruler as marker and visualized using UV transilluminator.
Sensitivity of PCR primers was evaluated by using different
dilutions (CFU/ml) of bacteria. Specificity of PCR primers
was checked with milk samples inoculated with
Streptococcus dysgalactiae, Streptococcus agalactiae,
Streptococcus uberis and E.coli.
L
1
2
3
4
5
6
7
1153 bp
953 bp
210 bp
Fig 1. PCR amplification using universal primers, gap gene and
aroA gene
Lane 1: Sample with Staphylococcus aureus with universal
primers
Lane 2: Sample with Streptococcus spp. with universal primers
Lane 3: Sample with E.coli. with universal primers
Lane 4: Sample with Staphylococcus spp. with gap gene primers
Lane 5: Sample with Staphylococcus aureus with aroA gene
primers
Lane 6: Negative control without DNA
Lane 7: Negative control with nuclease free water
RESULTS AND DISCUSSION
Glyceraldehydes–3–phosphate dehydrogenase catalyses
conversion of glyceraldehyde–3–phosphate to 1, 3 diphospho
glycerate and so enhances binding of transferring and serine
protease plasmin for causing virulence activity. gap gene
4
April 2010]
MOLECULAR DETECTION OF STAPHYLOCOCCUS AUREUS
277
Table 2. Optimized PCR amplification conditions
Action
Universal primers
gap gene
aroA gene
Temperature
(°C)
Duration
Cycles
Temperature
(°C)
Duration
Cycles
Temperature
(°C)
Duration
Cycles
94
94
56
72
72
4
5 min
45 sec
1 min
1 min
10 min
infinite
1
35
35
35
1
–
95
95
55
72
72
4
3 min
30 sec
30 sec
30 sec
7 min
infinite
1
40
40
40
1
–
94
94
58
72
72
4
5 min
1 min
1 min
1 min
10 min
infinite
1
36
36
36
1
–
Initial denat-uration
Denat-uration
Annealing
Extension
Final extension
Storage
Table 3. Comparison of details of bacterial isolates and their correlation with PCR assay
Number of
samples
770
Culturally positive
for Staphylococcus
spp. (both coagulase
positive and coagulase
negative)
Coagulase
positive
(All S.aureus)
gap gene
PCR from
Culture
gap gene
PCR from
milk directly
aroA gene PCR
fromCulture
aroA gene
PCR from
milk directly
138
114
138
142*
114
118*
*4 samples showing negative results for bacterial isolation were positive for gap gene and aroA gene by PCR directly from milk.
positive isolates were identified as Staphylococcus aureus
and no isolate of other coagulase positive staphylococci (viz.
Staphylococcus intermedius and Staphylococcus hyicus) was
found. When staphylococcal isolates (both coagulase positive
and coagulase negative) were subjected to gap gene based
genus specific PCR, all the isolates were found positive for
PCR with amplicons of size 933 bp (Fig. 1). Similar results
were observed when culture isolates positive for
Staphylococcus aureus were screened by aroA gene based
species specific PCR with amplified products of size 1153
bp (Fig. 1), indicating 100% sensitivity of PCR assay on
cultural isolates. The results obtained are in direct accordance
to the studies reported by others (Marcos et al. 1999, Yugeros
et al. 2001, Ghebremedhin et al. 2008, Saei et al. 2009) from
cultural isolates obtained from milk samples of cows and
ewes. None of the isolates were found positive for
Streptococcus dysgalactiae, Streptococcus agalactiae,
Streptococcus uberis and E.coli with PCR when amplified
with primers encoding gap and aroA gene, although all these
samples amplified 210 bp product with universal primers
showing 100% specificity of primers.
When samples were subjected to PCR directly on milk
based on universal primers, gap and aroA genes, 276, 142
and 118 samples were found positive respectively.
Comparison of details of bacterial isolates and their
correlation with PCR assay is shown in Table 3. In our study,
4 culturally negative samples were found positive by PCR
directly on milk. These samples had history of prior
administration with antibiotics for treatment which may have
inhibited growth of bacteria. As reported by Pheuktes et al.
(2001), another reason for negative culture results might be
due to the presence of leucocytes in milk samples with high
somatic cell count. The “no-growth” samples have remained
problematic for mastitis laboratories, veterinarians, and dairy
producers and studies reported failure of growth of bacteria
in up to 30% of milk samples from clinical and subclinical
bovine mastitis even after 48 h of conventional culture
(Sharma et al. 2009, Taponen et al. 2009).
A reduction in morbidity due to preventable and prevalent
endemic diseases like contagious mastitis caused by
Staphylococcus aureus is needed to maximise overall lifetime
productivity of cattle without compromising animal welfare.
The application of molecular or DNA-based methods in
mastitis research and diagnostics has contributed to an
increased understanding of mastitis epidemiology and control
options. Using these methods, staphylococcal isolates can
be differentiated at the subspecies or strain level within 6–
8 h allowing for improved recognition of sources and
transmission routes of pathogens. In conclusion, this assay
based on detection of gap and aroA genes can be adopted for
screening of large organized herd and for direct detection of
Staphylococcus spp. and Staphylococcus aureus from mastitis
samples respectively.
ACKNOWLEDGEMENT
The authors gratefully acknowledge technical help
rendered by Mr Bhupender Singh and Mr Randhir Singh of
Veterinary College Central Laboratory, College of Veterinary
Sciences.
5
278
SINDHU ET AL.
REFERENCES
[Indian Journal of Animal Sciences 80 (4)
J. 2001. Development of a rapid and sensitive test for
identification of major pathogens in bovine mastitis by PCR.
Journal of Clinical Microbiology 39: 2 584–89.
Saei H D, Ahmadi M, Mardani K, Batavani R A. 2009. Molecular
typing of Staphylococcus aureus isolated from bovine mastitis
based on polymorphism of the coagulase gene in the north west
of Iran. Veterinary Microbiology 137: 202–06.
Sasidhar P V K, Reddy Y R and Rao B S. 2002. Economics of
mastitis. Indian Journal of Animal Sciences 72(6): 439–40.
Sharma A, Sindhu N and Jain V K. 2009. 16S–23S rRNA intergenic
spacer based molecular detection of Staphylococcus aureus
directly from mastitic milk of crossbred cows. Indian Journal
of Animal Sciences 79: 350–52.
Sindhu N, Sharma A and Jain V K. 2008. Phenotypic and genotypic
characterization of Staphylococcus aureus isolated from mastitis
cases of cows and buffaloes. Journal of Immunology and
Immunopathology 10(2): 119–23.
Singh J and Kataria A K. 2009. Relationships between bacterial
species and total somatic cell counts in sub-clinical and latent
mastitis in cattle. Indian Journal of Animal Sciences 79(1): 38–
40.
Taponen S, Salmikivi L, Simojoki H, Koskinen M T and Pyorala
S. 2009. Real-time polymerase chain reaction-based
identification of bacteria in milk samples from bovine clinical
mastitis with no growth in conventional culturing. Journal of
Dairy Science 92(6): 2 610–17.
Yugueros J, Temprano A, Sanchez M, Luengo J M and Naharro G.
2001. Identification of Staphylococcus spp. by PCR-restriction
fragment length polymorphism of gap gene. Journal of Clinical
Microbiology 39: 3 693–95.
Dubey A, Ghorui S K and Kashyap S K. 2009. Differentiation of
Staphylococcus aureus strains based on 16S–23S ribosomal
RNA intergenic space polymorphism. Indian Journal of
Biotechnology 8: 276–79.
Ghebremedhin B, Layer F, Konig W and Konig B. 2008. Genetic
classification and distinguishing of Staphylococcus species
based on different partial gap, 16S rRNA, hsp60, rpoB, sodA,
and tuf gene sequences. Journal of Clinical Microbiology 46:
1 019–25.
Lahoti S R and Chole R R. 2009. Dairymen’s preferences for mode
of training. Indian Dairyman 61(5): 53–55.
Marcos J Y, Cascon A, Sanchez M, Hernanz C, Suarez S, Smeltzer
M S and Naharro G. 1999. Rapid identification and typing of
Staphylococcus aureus by PCR-restriction fragment length
polymorphism analysis of the aroA gene. Journal of Clinical
Microbiology 37: 570–74.
Osteras O and Solverod L. 2009. Norwegian mastitis
control programme. Irish Veterinary Journal 62 (supplement):
26–33.
Peer F U, Bhattacharyya H K and Ansari M M. 2009. Studies on
the epidemiology and therapeutic management of bovine
mastitis. Indian Journal of Dairy Science 62 (1): 39–42.
Phuektes P, Mansell P D, and Browning G F. 2001. Multiplex
polymerase chain reaction assay for simultaneous detection of
Staphylococcus aureus and streptococcal causes of bovine
mastitis. Journal of Dairy Science 84: 1 140–48.
Riffon R, Sayasith K, Hayssam K, Dubreuil P, Drolet M and Lagace
6
Indian Journal of Animal Sciences 80 (4): 279–283, April 2010
Detection and differentiation of leptospires using real-time polymerase
chain reaction
G MALATHI1, K G TIRUMURUGAAN2, K VIJAYARANI3 and K KUMANAN4
Tamil Nadu Veterinary and Animal Sciences University,Chennai, Tamil Nadu 600 007 India
Received: 4 March 2009; Accepted: 22 October 2009
ABSTRACT
Leptospirosis, an important emerging infectious disease of man and animals world-wide, is caused by helical motile
spirochetes of the genus Leptospira necessity. In the present study, primer’s targeting the locus LA0322 of L. interrogans
was used to compare the efficiency of conventional and SYBR green based real-time PCR assay. In serum and urine
samples spiked with known amount of leptospires the conventional PCR had a average detection limit of 3.2–4.6 × 103
while real-time PCR was sensitive enough to detect as minimum as 32 to 41 leptospires per milliliter. Melting curve
analysis indicated an average Tm of 79.5°C for L. interrogans, while it was for 85.6°C L. borgpetersenii. Our results
indicate the ability of real-time PCR to differentiate leptospires in a single tube reaction. Further studies are required
with the inclusion of other serovars.
Key words: Conventional PCR, Melting curve, SYBR green real-time PCR, Typing
Leptospirosis, an important emerging infectious disease
of man and animals world-wide, is caused by helical motile
spirochetes of the genus Leptospira (Ko et al. 1999, Levett
2001). Molecular tools such as conventional PCR and realtime PCR (Merien et al. 2005, Palaniappan et al. 2005,
Fearnley et al. 2008) have made a great impact due to their
rapidity, greater sensitivity and specificity in diagnosis during
early stages of the infection. These techniques also have the
ability to differentiate between the pathogenic and nonpathogenic serovars. However, the design of primers to
differentiate non-pathogenic from pathogenic serovars in the
above assays had always remained a challenge. In the present
study, we used the primers targeting the locus LA0322 of L.
interrogans and attempted for a SYBR green based real-time
PCR assay. We compared the efficiency of the real-time PCR
assay for the detection of leptospires with the conventional
PCR, as well as its ability to help in typing.
Table 1. Pathogenic and non-pathogenic Leptospira used
in the study
Serogroup
Serovar
Strain
Pathogenic leptospires (Leptospira interrogans)
Icterohaemorrhagiae
Icterohaemorrhagiae RGA
Hebdomadis
Hebdomadis
Hebdomadis
Pyrogenes
Pyrogenes
Salinem
Canicola
Canicola
Hond Utrecht IV
Javanica
Javanica
Poi
Pomona
Pomona
Pomona
Pathogenic leptospires (Leptospira borgpetersenii)
Sejroe
Sejroe
M84
Ballum
Ballum
Mus 127
Non-pathogenic leptospires (Leptospira biflexa)
Andamana
Andamana
CH11
Semeranga
Patoc
Patoc I
MATERIALS AND METHODS
EMJH liquid medium and maintained in semi-solid media.
Dark field microscopy was used to monitor the growth of
the cultures before using for subsequent procedures. The
cultures diluted in 10 folds were counted using Petroff
Hausser chamber and spiked into serum and urine samples
for use in conventional and real-time PCR assay.
Isolation of genomic DNA from the leptospires: DNA was
isolated from the culture of leptospires as well as the spiked
samples according to Fischer and Lerman (1979). The
precipitated DNA pellet was finally resuspended in TE buffer
Bacterial strains: Six different pathogenic leptospires of
Leptospira interrogans, 2 pathogenic leptospires of L.
borgpetersenii and 2 non-pathogenic leptospires of L. biflexa
belonging different serogroup and serovars used in the study
were maintained at the Leptospira unit of Veterinary College
are listed in the Table 1. The leptospires were cultured in
Present address: 1, 2, 3, 4Department of Biotechnology, Madras
Veterinary College, Chennai 600 007 (e-mail: kumananrani
@hotmail.com)
7
280
MALATHI ET AL.
[Indian Journal of Animal Sciences 80 (4)
to 95°C with a linear temperature transition rate of 0.1°C/.
The first derivate (dF/dT) of the melting curve (performed
automatically by the software) were plotted against
temperature for determination of the melting temperature
(T m). Since all real-time PCR runs were performed in
duplicates, the coefficient of variation for each dilution of
the leptospires was calculated to show the repeatability.
Fig. 1. Agarose gel electrophoresis of 331 bp amplicon of
LA03222 gene sequence amplified only in pathogenic leptospira
species.
Lane M, 100 bp ladder; Lane 1 and 2, negative control; Lane 3, L.
interrogans serovar Pyrogenes; Lane 4, L. interrogans serovar
Hebdomadis; Lane 5, L. interrogans serovar Javanica; Lane 6, L.
interrogans serovar Pomona; Lane 7, L. interrogans serovar
Canicola; Lane 8, L. Borgpetersenii serovar Sejroe; Lane 9, L.
Borgpetersenii serovar Ballum; Lane 10, L. interrogans serovar
Icterohaemorrhagiae; Lane 11 and 12, Non-pathogenic L. biflexa
serovar Patoc and L. Biflexa serovar Andamana.
RESULTS AND DISCUSSION
Conventional PCR assay sensitivity and specificity: The
DNA of the reference leptospira serovars (Table 1) belonging
to 8 different pathogenic species and 2 non-pathogenic
species were included to determine the specificity of the
conventional PCR. All the pathogenic leptospires DNA were
tested positive that resulted in a 331-bp amplicon which was
visualized by agarose gel electrophoresis (Fig. 1). The
amplicons were also sequenced and blast results confirmed
the sequence to be that of LA0322 gene. All the nonpathogenic samples resulted in no amplification (Fig. 1). The
detection limit of the conventional PCR with the spiked
samples corresponded to an average of 3.2–4.6 × 10 3
leptospires.
Sensitivity of the real-time PCR assay: The sensitivity of
the real-time PCR assay to detect leptospires were done by
testing spiked samples with different dilutions of L.
interrogans serovars Canicola and L. borgpetersenii serovar
Sejroe. The obtained Ct values were plotted against the
different dilution of leptospires and the linear regression line
resulted in a correlation coefficient value of more than 0.9.
Thus based on the standard curve, the minimum detection
limit of the real-time PCR assay with the LA0322 primers
corresponded to an average of 32 to 41 leptospires per ml
(Figs 2a and 2b).
Typing of leptospira by melting curve analysis: The
melting curve analysis was performed on the DNA of
different pathogenic L. interrogans and L. borgpetersenii
species. The melting temperature of L.interrogans serovar
Pyrogenes was 79.8°C, L.interrogans serovar Hebdomadis
79.3°C, L. interrogans serovar Javanica 79.4°C,
L.interrogans serovar Pomona 79.1°C, L. interrogans serovar
Canicola 79.1°C and L. interrogans serovar Icterohaemorrhagiae 79.6°C (Fig. 3a). The mean melting temperature of
L. interrogans serovars was found to be 79.3°C. The
L.borgpetersenii serovars Sejroe had a melting temperature
of 85.7°C, while L.borgpetersenii serovars Ballum had
86.0°C with an average temperature of 85.5°C (Fig. 3b).
Compared with the conventional methods for detecting
leptospires, the real-time PCR assay using SYBR Green mix
offers many advantages in that it is simple and in-expensive.
Real-time PCR assays can also detect as little as 2-fold
change. The conventional PCR in spiked samples had a
detection limit that corresponded to an average of 3.2–4.6 ×
103 leptospires. However, real-time PCR targeting LA0322
locus following spiking of known quantities of various
and used as template for standardization of the real-time PCR
assay.
Conventional PCR: PCR was performed in the study using
20 pmoles of the following primers LFB1F (5’CATTCATGTTTCGAATCATTTCAAA-3’) and LFB1R (5’GGCCCAAGTTCCTTCT AAAAG-3’) that targeted a
conserved hypothetical protein of LA0322 gene from
pathogenic leptospira. A 25 ml reaction was performed using
2x Red dye master mix in an Eppendorf gradient cycler under
the following conditions: 94°C for 5 min denaturing, 35
cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 30 sec,
and a final extension at 72°C for 7 min. The PCR amplicons
were checked in a 2% TAE agarose gel and visualized by
staining with ethidium bromide.
Real-time PCR assay for quantitation of leptospires: The
counted cultures of leptospires were spiked into serum or
urine samples in a total volume of 10 ml. The samples were
denatured at 95°C for 10 min and snap cooled. To the
denatured mixture 100 mM of primers (LFB1F and LFB1R)
and the SYBR green master mix were added and the reactions
were performed under the following conditions in an ABI
7 500 machine: 50°C for 2 min, 95°C for 10 min followed
by 50 cycles at 95°C for 15s, 59°C for 32 s, and 60°C for
32s. The ROX dye in the master mix was used as a passive
reference dye. All reactions were carried out in duplicate
with negative and positive controls. The data were accepted
only in the absence of amplification in no template control
(NTC). The data were analyzed using the biosystem sequence
detection software (V.1.3.1.22). The obtained Ct (cycle at
threshold) values were plotted against the log quantity of
the leptospires to determine the standard curve. The curves
with correlation coefficient values of greater than 0.9 were
only accepted.
Real-time PCR assay for typing of leptospires: For typing
the leptospires using real-time PCR, based on melting curves,
the reaction mix and the conditions remained the same as
above except for the inclusion of a single dissociation step
at the end of the 50 cycles. The melting curve analysis was
done by continuous acquisition of the fluorescence from 65
8
April 2010]
DETECTION AND DIFFERENTIATION OF LEPTOSPIRES
281
Delta Rn vs Cycle
Positive control
6
3.2 × 10
3.2 × 104
3
3.2 × 10
2
3.2 × 10
1
3.2 × 10
1.0e+001
1.0e+000
Delta Rn
1.0e-001
1.0e-002
1.0e-003
1.0e-004
y=2.408x + 20.449
R2=0.9979
1.0e-005
1.0e-006
1
3
5
7
9
11
13
15
17
19
21
23 25 27
Cycle number
29
31
33
35
37
39
41
43
45
47
49
Fig. 2a. Representative results of the leptospira amplicon (L. interrogans serovar Javanica) detected by real-time PCR.
Amplification plots of serially diluted leptospira cultures with 3.2 × 105, 3.2 × 104, 3.2 × 103, 3.2 × 102, 3.2 × 101 and 3.2 × 10° organisms.
DNA was replaced with PCR-grade water in no template control. Insert shows the establishment of standard curve with the above dilutions
of the organisms (correlation coefficient= 0.996). Each point represents the average values from 3 different experiments.
Delta Rn vs Cycle
Positive control
5
4.12 × 10
4.12 × 104
3
4.12 × 10
2
4.12 × 10
1
4.12 × 10
1.0e+001
1.0e+000
Delta Rn
1.0e-001
1.0e-002
1.0e-003
1.0e-004
y=3.413x + 18.384
R2=0.9954
1.0e-005
1.0e-006
1
3
5
7
9
11
13
15
17
19
21
23 25 27
Cycle number
29
31
33
35
37
39
41
43
45
47
49
Fig. 2b. Representative results of the leptospira amplicon (L. borgpetersenii serovar Sejroe) detected by real-time PCR.
Amplification plots of serially diluted leptospira cultures with 4.12×105, 4.12×104, 4.12×103, 4.12×102, 4.12×101 and 4.12×10° organisms.
DNA was replaced with PCR-grade water in no template control. Insert shows the establishment of standard curve with the above dilutions
of the organisms (correlation coefficient = 0.996). Each point represents the average values from 3 different experiments.
leptospira serovars was sensitive enough to detect as
minimum as 32 to 41 leptospires per milliliter. The detection
limit of any PCR assay depends on the copy number of the
gene that is being targeted (Palaniappan et al. 2005, Slack et
al. 2007). Slack et al. (2007) had reported an analytical
sensitivity of 10 copies of the gene per reaction in a Taqman
based real-time PCR assay. Targeting of the 16S gene of
leptospira (Smythe et al. 2002) in the real-time PCR showed
the ability to detect as low as 2 cells of leptospira due to the
high copy number of the gene. The slightly lower sensitivity
observed in our study could be because of the low copy
number of the gene that had been targeted for the real-time
PCR assay. In addition, the aim of the study was not only to
detect pathogenic leptospires but also to assess the
applicability of real-time PCR to simultaneously type the
leptospires in a single tube reaction.
Typing of leptospira is routinely being done by serological
methods based on the antigenic difference in the
lipopolysaccharide envelope that surround the cell wall
(Mathew 2001). However, recently several molecular
techniques have been tested for typing of leptospira with
varied sensitivity. These molecular tools also avoid the
tedious procedure of maintaining a panel of reference cultures
and sera. Targeting genes that differ in their GC content in
PCR would result in amplicons that differ in their Tm. These
differences in the Tm would result in changes in their melting
curves that can be appreciated in a SYBR based real-time
PCR with a final dissociation step. Such a methodology was
successfully applied to differentiate bacterial species (Jeffery
et al. 2007,Portoni et al. 2006). Levett et al.(2005) attempted
melting curve analysis for typing the leptospires. Interestingly
in their study, the melting temperatures ranged between
82.5°C and 86°C depending on the species tested. Merien et
al. (2005) were also able to assign a specific Tm to a single
species or a set of species within a range of 3°C. Reports
also indicated that L. alexanderi and L. borgpetersenii
showed a mean highest Tm of 86.5°C, while the mean lowest
Tm of 83.4°C was observed for L. interrogans s.s. and L.
9
282
MALATHI ET AL.
Coefficient of variance = 0.001949
0.24
86°C
0.20
Derivative
borgpetersenii had 85.6°C as mean melting temperature. The
specific single peaks obtained in the melting curve analysis
indicate amplification with no evidence of primer-dimer or
other non-specific products. Our results indicated lower
melting temperature for L. interrogans and a higher Tm L.
borgpetersenii. Hence, in diagnostic laboratories, specific
detection of pathogenic leptospires with the simultaneous
ability to type the leptospires will be of real advantage. This
avoids the need to maintain additional reagents that are
required for conventional serotyping and also had a short
turn around time. The preliminary results obtained in our
study are encouraging and indicate that real-time PCR can
be effectively used differentiate between L. interrogans and
L. borgpetersenii indicating the usefulness of this technique.
However, further studies are required with the inclusion of
various other serovars to assess out the usefulness of this
technique
Dissociation curve
0.28
85.7°C
0.16
0.12
0.08
0.04
0.00
–0.04
–0.08
60
65
70
75
80
85
Temperature (°C)
90
95
Fig. 3a. Melting curve analysis of pathogenic Leptospira
interrogans s.s after real-time PCR following amplification with
primers targeting the LA03222 gene sequence and SYBR Green
dye.
The first derivative of the initial melting curve is plotted against
the temperature for improved determination of the melting
temperature (Tm). Note the duplicates for each sample giving the
same Tm. The Tm of L.interrogans serovar Pyrogenes was 79.8°C,
L.interrogans serovar Hebdomadis 79.3°C, L. interrogans serovar
Javanica 79.4°C, L.interrogans serovar Pomona 79.1°C, L.
interrogans serovar Canicola was 79.1°C, and L. interrogans
serovar Icterohaemorrhagiae was 79.6°C. The mean melting
temperature of L. interrogans s.s is 79.3°C with a co-efficient of
variance of 0.00419.
Dissociation curve
Coefficient of variance= 0.00419
0.50 Average Tm –79.3°C
ACKNOWLEDGEMENTS
We thank the DBT, Government of India, New Delhi, for
the funding and the TANUVAS, Chennai, for providing the
necessary facilities to carryout this research.
REFERENCES
Fearnley C, Wakeley P R, Gallego-Beltran J, Dalley C, Williamson
S, Gaudie C and Woodward M J. 2008. The development of a
real-time PCR to detect pathogenic Leptospira species in kidney
tissue. Research in Veterinary Science 85: 8–16.
Fischer S G and Lerman L S. 1979. Lenth-independent separation
of DNA restriction fragments in two-dimensional gel
electrophoresis. Cell 16: 191.
Jeffery N, Gasser R B, Steer P A and Noormohammadi A H. 2007.
Classification of Mycoplasma synoviae strains using singlestrand conformation polymorphism and high resolution meltingcurve analysis of the vlhA gene single-copy region.
Microbiology 153: 2 679–88.
Ko A I, Galvao Reis M, Ribeiro Dourado C M, Johnson Jr W D
and Riley L W. 1999. Urban epidemic of severe leptospirosis in
Brazil. Salvador Leptospirosis Study Group. Lancet 354: 820–
25.
Levett P N. 2001. Leptospirosis. Clinical Microbiology Review 14:
296–326.
Mathew J R. 2001. Leptospirosis- Medicine. Website
www.emedicine.com/med/topic 1283.htm.
Merien F, Portnoi D, Bourhy P, Charavay F, Berlioz-Arthaud A
and Baranton G. 2005 A rapid and quantitative method for the
detection of Leptospira species in human leptospirosis. FEMS
Microbiology Letter 249: 139–47.
Palaniappan R U, Chang Y F, Chang C F, Pan M J, Yang C W,
Harpending P, McDonough S P, Dubovi E, Divers T, Qu J and
Roe B. 2005. Evaluation of lig-based conventional and real time
PCR for the detection of pathogenic leptospires. Molecular Cell
Probes 19: 111–17.
Portnoi D, Sertour N, Ferquel E, Garnier M, Baranton G and Postic
D. 2006. A single run, real-time PCR for detection and
identification of Borrelia burgdorferi susu lato species, based
0.60
Delta Rn
0.40
0.30
79.8°C
79.3°C
79.4°C
79.1°C
79.1°C
79.6°C
0.20
0.10
0.00
–0.10
60
65
70
80
75
Temperature (°C)
85
90
[Indian Journal of Animal Sciences 80 (4)
95
Fig. 3b. Melting curve analysis of pathogenic Leptospira
borgpetersenii after real-time PCR following amplification with
primers targeting the LA03222 gene sequence and SYBR Green
dye.
The first derivative of the initial melting curve is plotted against
the temperature for improved determination of the melting
temperature (Tm). Note the duplicates for the each giving the same
Tm. The L.borgpetersenii serovars Sejroe had a melting temperature
of 85.7°C while L.borgpetersenii serovars Ballum had 86.0°C with
an average temperature of 85.5°C for L.borgpetersenii serovars
with a coefficient of variance of 0.001949.
santarosai. In our study to assess the ability of real-time PCR
to differentiate pathogenic leptospires the mean melting
temperature for L. interrogans was 79.5°C, whereas L.
10
April 2010]
DETECTION AND DIFFERENTIATION OF LEPTOSPIRES
on the hbb gene sequence. FEMS Microbiology Letter 259: 35–
40.
Slack A, Symonds M, Dohnt M, Harris C, Brookes D and Smythe
L. 2007. Evaluation of a modified Taqman assay detecting
pathogenic Leptospira spp. against culture and Leptospiraspecific IgM enzyme-linked immunosorbent assay in a clinical
283
environment. Diagnostic and Microbiology of Infectious
Diseases 57: 361–66.
Smythe L D, Smith I L, Smith G A, Dohnt M F, Symonds M L,
Barnett L J and McKay D B. 2002. A quantitative PCR (TaqMan)
assay for pathogenic Leptospira spp. BMC Infectitous Diseases
2: 13.
11
Indian Journal of Animal Sciences 80 (4): 284–288, April 2010
Activity of extracts of Synzium aromaticum against microbes of
veterinary importance
MEENAKSHI VIRMANI1, S L GARG2, NITIN VIRMANI3 and S K BATRA4
CCS Haryana Agricultural University, Hisar, Haryana 125004 India
Received: 3 March 2009; Accepted: 20 November 2009
ABSTRACT
The study was conducted with the objective to evaluate the antibacterial as well as antiviral activity of the aqueous
and alcoholic extracts and oil of the flower buds of clove against the microbes responsible for causing diseases in
poultry and livestock. The aqueous and alcoholic extracts of dried flower buds of clove were obtained by extraction in
soxhlet apparatus using water and ethanol (95%) as solvents respectively. Oil was obtained from the clove flower buds
by steam distillation. Both the extracts and oil were assessed for their antibacterial activity against Streptococcus
zooepidemicus, Salmonella Gallinarum, Escherichia coli, Staphylococcus aureus and Pasteurella multocida while antiviral
activity was tested against equine herpes virus – I (EHV I) and infectious bursal disease (IBD) virus. The extracts as
well as oil were effective against the bacteria tested with zone of inhibition ranging from 11.67±0.33 to 24.00±0.00 mm.
The Minimum inhibitory concentration (MIC) values for the extracts ranged from 0.75 to 4.00 mg/ml. Clove was also
found to have potent antiviral activity against EHV–1 up to 104TCID50/ml, while IBD virus was found to be resistant to
the clove extracts.
Key words: Antimicrobial activity, Escherichia coli, Pasteurella multocida, Salmonella gallinarum, Staphylococcus aureus,
Streptococcus zooepidemicus and Synzium aromaticum
there is a need of developing some plant based derivatives
which protect the poultry and livestock against the diseases
as well as maintain or enhance their production performance.
With this aim, we selected Synzium aromaticum to assess its
antibacterial and antiviral activity against pathogens of
animal health importance. The pathogens selected for the
present study included bacteria, viz. Streptococcus
zooepidemicus, Salmonella Gallinarum, Escherichia coli,
Staphylococcus aureus and Pasteurella multocida and virus
(Equine Herpes Virus 1 and infectious bursal disease virus)
which are of veterinary importance as they cause huge
economic losses to the country due to morbidity and mortality
in livestock as well as poultry and thereby leading to decrease
in productivity.
Indians have been traditional users of plant derived
medicines both directly and as an integral constituent of
plethora of packages and practices of indigenous medicine.
These plants and their extracts are being used in the
pharmaceutical preparations of modern medicine, veterinary
and in agriculture (Iyengar 1985, Chopra et al. 1992, Zafar
1999). The antimicrobials obtained from plants are of much
therapeutic potential and are effective in treatment of
infectious diseases while simultaneously mitigating many
of the side effects that are often associated with synthetic
antimicrobials (Kokoska et al. 2002).
Synzium aromaticum (clove, family Myrtaceae) is an
aromatic plant, grown extensively in India and is known for
its antiseptic, carminative, stimulant, analgesic,
antispasmodic properties (Prajapati et al. 2003). Clove is
being used by the Indian Ayurvedic healers since ancient
times to treat various ailments. To have suitable therapeutic
control of the diseases of known importance of the livestock,
MATERIALS AND METHODS
Plant material and preparation of extracts
The dried flower buds of clove were purchased from the
local market.The dried flower buds were ground to powder
form, soaked for 48 hr in distilled water and 95% (v/v) ethanol
for aqueous extraction and alcoholic extraction, respectively
and extracted as per procedure of Virmani et al. (2008). Clove
oil was obtained from the clove buds by steam distillation.
Per cent yield of various extracts from flower buds of clove
Present address: 1Assistant Professor, Department of Veterinary
Physiology, GADVASU, Ludhiana 141 009 Punjab.
3National Research Centre on Equines, Sirsa Road, Hisar 125
001, Haryana, India.
2Department of Veterinary Biochemistry and 4Department of
Veterinary Microbiology, College of Veterinary Sciences.
12
April 2010]
ACTIVITY OF EXTRACTS OF SYNZIUM AROMATICUM AGAINST MICROBES
14
1: 1000 multiplicity of infection (m.o.i) and maintained in MEM
containing 2% foetal calf serum and incubated at 37°C with
5% CO2 tension in an incubator (Virmani et al. 2004)
Cytotoxicity assay: Each extract was separately diluted
1: 10 with the maintenance medium and filter sterilized
through 0.22μ millipore filter. Further dilutions (1: 20, 1:
40, 1: 60, 1: 80 and 1: 160) were made from the stock. The
cytotoxicity assays were carried out using 100μl of cell
suspension containing 104 cells in each well of the microtitre
plate. The highest concentration of each extract found to be
non-toxic to the cells was recorded and used further for
antiviral assay.
Antiviral assay: The non-toxic concentrations of the
extracts were checked for antiviral property by cytopathic
effect inhibition assay in cell monolayers infected with serial
dilutions of virus (101 to 104 TCID50/ml). The cultures were
overlaid with maintenance medium containing plant extracts
at dilutions mentioned in Table 2 and incubated at 37°C for
5 days. Every 24 hr, the observations were made and
cytopathic effects recorded. The antiviral activity was
determined by the inhibition of CPE when compared with
controls.
For IBD virus, Chicken Embryo fibroblast (CEF) cells
were freshly prepared and used for propagation of the virus,
cytotoxicity assay and antiviral assay. The assays were
performed as per the protocol mentioned for Equine Herpes
Virus 1. However, the medium used for CEF was M 199 and
the extracts were diluted in ratio of 1: 50, 1: 100, 1: 150 and
1: 200. Rest of the procedure was similar as for EHV 1.
Phytochemical analysis: The qualitative phytochemical
analysis of the alcoholic extract of flower bud of clove as
well as oil of clove bud was undertaken using standard
qualitative methods as described by other workers (Vogel
1958, Kapoor et al. 1969, Scalbert 1991 and Chukwurah
1997). The plant extracts were screened for the presence of
biologically active compounds including glycosides,
phenolics, alkaloids, tannins, flavonoids and saponins.`
12
% yield
10
8
6
4
2
0
Aq. extr.
Alc. Extr.
285
Oil
Fig. 1 Per cent yield of extractive from Synzium aromaticum
flower bud.
is given in Fig. 1.
Antibacterial sensitivity assay and determination of
minimum inhibitory concentration (MIC)
An inoculum of each of the bacterial strains (single
colony) was suspended in 5 ml of broth (tryptose soy broth
for S. zooepidemicus) and incubated at 37°C for 18 hr. The
antibacterial activity was tested by the disc diffusion assay
(Bauer et al. 1966). 0.1 ml of inoculum (105 CFU/ml) was
spread on sterile Mueller Hinton plates (blood agar for S.
zooepidemicus and P. multocida) and sterile paper discs were
placed on the inoculated surface. The discs were impregnated
with 15μl of each of the extract at 10% concentration, kept
at room temperature for absorption of extract in the medium
and then incubated at 37°C in the incubator for 24 hr. The
antimicrobial activity was evaluated by measuring the
diameter of inhibition zone as per the procedure described
by Kim et al., 1995. The experiment was carried out in
triplicate and the mean of the diameter of inhibition zones
was calculated. Four commercially available antibiotic drugs,
viz. gentamycin, ciprofloxacin, cephotaxime and cefixime
were used simultaneously as control.
For determination of MIC, 1 ml of broth medium was
taken into 10 test tubes for each bacteria. Different
concentrations of plant extracts ranging from 0.25 to 10.00
mg/ml concentration were incorporated into the broth and
the tubes were then inoculated with 0.1 ml of inoculum of
respective bacteria (105 CFU/ml) and kept at 37°C for 24 hr.
The test tube containing the lowest concentration of extract
which showed reduction in turbidity, when compared with
control was regarded as MIC of that extract. The optical
density of each tube was measured in the spectrophotometer
(at 620 nm).
RESULTS AND DISCUSSION
The extracts of Synzium aromaticum (clove) were found
to be active against the bacteria tested (Table 1). The aqueous
and alcoholic extracts of dried flower buds gave the inhibition
zones of diameter ranging from 11.67±0.33 mm to
21.00±0.57 mm, while clove oil showed inhibition zones up
to 24.00±0.00 mm for S. zooepidemicus. Clove oil was
observed to have most potent antibacterial activity with MIC
of 0.75 to 2.00 mg/ml against different bacteria (Fig. 2). Our
findings corroborate with the findings of other workers who
also reported clove to have high antimicrobial activity against
different bacteria (Deans et al. 1995, Ahmad et al. 1999 and
Nascimento Gislene et al. 2000). Arora and Kaur (1999)
tested the spices against human pathogenic bacteria and
yeasts and found that aqueous extract of clove possesses
antimicrobial activity against Shigella flexnerii and Candida
Antiviral activity
Propagation of equine herpes virus 1 in RK–13
monolayer: RK–13 cells, grown as monolayer in MEM
(minimum essential medium) containing 10% foetal calf
serum, were infected with the virus (104.2 TCID50/ml) at
13
286
VIRMANI ET AL.
4
Aqueous extract
Alcoholic extract
of all the 3 extracts (aqueous, alcoholic and oil) was assayed
and their cytotoxic levels were recorded. Alcoholic and
aqueous extracts of Synzium aromaticum were found to be
cytotoxic for both RK–13 cells and Chicken embryo
fibroblasts at the concentration of 5 mg/ml while the oil
extract was found to be cytotoxic at 1250 mg/ml (Table 2).
The extracts of clove (both aqueous and alcoholic) as well
as clove oil showed potent antiviral activity against EHV 1
up to the level of 104TCID50/ml, while none of the extracts
had any antiviral activity against any of the dilutions of IBD
virus. Benecia and Courreges (2000) reported Eugenol, an
active component of clove oil to possess antiviral activity
against Herpes Simplex virus 1 (HSV 1) and Herpes Simplex
virus 2 (HSV 2) viruses and showed inhibitory concentration
50% values for the anti HSV effect to be 25.6 μg/ml and
16.2 μg/ml respectively for HSV 1 and HSV 2. The higher
dose requirement in present study might be due to the crude
preparations used as against the purified eugenol used by
Benecia and Courreges (2000). Vijayan et al. (2004) observed
different parts of medicinal plants of Nilgiris and found
Hypericums myorense, Hypericums. hookerianum and Usnea
complanta to be having antiviral activity against HSV 1
which is a virus belonging to Alpha herpes virinae similar to
Equine Herpes Virus 1.
Phytochemical analysis of the extracts depicted that the
alcoholic extract of flower bud of clove was having
glycosides, flavonoids, phenolics and tannins while only
flavonoids and phenolics were present in oil of the clove
bud. The results are in agreement with the reports of other
workers (Chopra et al. 1992, Bruneton 1995 and Ahmad and
Beg 2001). Sakagami et al. (1995) have suggested that a
major part of antiviral activity in polyphenols probably
derives from their direct inactivation of the virus and or from
the inhibition of the virus binding to the cells. They also
noted the inhibitory effect of polyphenols on the viral
replication enzymes. Kurokawa et al. (1998) extracted the
phenolic compound eugeniin (ellagitannin) from Genum
japonicum and Synzium aromaticum and found it to be having
anti-HSV activity. Kurokawa et al. (1998) and Liu et al.
(1999) reported that one of the major target sites of inhibitory
Oil
3.5
3
MIC (mg/ml)
[Indian Journal of Animal Sciences 80 (4)
2.5
2
1.5
1
0.5
0
P.m.
S.a.
E.c.
S.g.
S.z.
Bacteria
S.z. Streptococcus zooepidemicus S.a. Staphylococcus aureus,
S.g. Salmonella Gallinarum
P.m. Pasteurella multocida
E.c. Escherichia coli
Fig. 2. Minimum inhibitory concentration (MIC) of the extracts
(mg/ml) against bacteria.
species resistant to the antibiotics. Dormans and Deans (2000)
observed that the volatile oils of clove exhibited inhibitory
effects against all the organisms under test mainly
Escherichia coli, Salmonella pullorum, Staphylococcus
aureus, Bacillus subtilis, Clostridium sporogenes, etc. and
were reported to be equally effective against Gram + and
Gram – organisms. Kim et al. (1995) studied the antibacterial
activity of some essential oil components including eugenol
from clove oil against the food borne pathogens at 5, 10, 15
and 20% levels using paper disc method and observed MIC
for eugenol to be 1000 μg/ml for all the bacteria tested.
Eugenol showed dose related increase in the zone of
inhibition against all pathogens. Suresh et al. (1992) found
eugenol to be sensitive at a concentration of 5 g/assay against
E. coli, Enterobacter sakazaki and Klebsiella pneumoniae
which were resistant to antibiotics like ampicillin,
erythromycin and sulfamethizole. The antibacterial activities
of the standard antibiotics, viz. gentamycin, ciprofloxacin,
cephotaxime and cefixime are mentioned in Table 1.
The extracts were screened for antiviral activity against
EHV 1 and IBD virus as well. The cytotoxic concentration
Table 1. Inhibition zone diameter (mm) of extracts against bacteria (mean ± SE)
Plant extract/antibiotics
Aqueous extract
Alcoholic extract
Oil
Gentamycin
Cephotaxime
Ciprofloxacin
Cefixime
- means no activity
S.z.
S.g.
E.c.
S.a.
P.m.
19.00±0.57
15.00±0.00
24.00±0.00
12
26
21
16
21.00±0.57
15.67±0.33
23.33±0.33
24
22
36
24
–
14.33±0.33
16.33±0.33
30
32
30
26
11.67±0.33
17.33±0.67
17.33±0.67
22
31
32
12
20.67±0.67
16.33±0.88
21.83±1.05
24
26
30
24
S.z., Streptococcus zooepidemicus; S.g., Salmonella Gallinarum; E.c., Escherichia coli; S.a. Staphylococcus aureus; P.m., Pasteurella
multocida
14
April 2010]
ACTIVITY OF EXTRACTS OF SYNZIUM AROMATICUM AGAINST MICROBES
287
Table 2. Cytotoxicity assay and antiviral activity of plant extracts against EHV-1 virus
Plant extract
Aqueous extract
Alcoholic extract
Oil
Cytotoxicity
(μg/ml)
Concentration of extract
used for antiviral
activity (μg/ml)
10 TCID50*
102 TCID50
103 TCID50
104 TCID50
4000
4000
1000
3/3
3/3
3/3
3/3
3/3
3/3
3/3
3/3
3/3
3/3
2/3
3/3
5000
5000
1250
CPE inhibition assay
*Each dilution of virus was used in triplicate.Numerator, number of wells showing no CPE, Denominator, total number of wells per
dilution of virus.
action of eugeniin is viral DNA synthesis. Meerbach et al.
(2001) while working with 17 polyhydroxycarboxylates, a
phenolic compound, against herpes simplex virus type 1
(HSV 1), HSV 2, thymidine kinase deficient HSV 1, human
cytomegalovirus (HCMV) and HIV 1 and HIV 2 have
attributed the antiviral properties of phenolic compounds to
the presence of the carboxylic groups which cause inhibition
of the virus adsorption. Phenolic compounds which possess
C3 side chain at a lower level of oxidation and containing no
oxygen are classified as essential oils such as Eugenol and
often cited as antimicrobials (Cowan 1999).
This study is an evaluation of the antibacterial and antiviral
activity of Synzium aromaticum against some important
selected pathogens (bacteria and viruses) of veterinary
importance, which are known to cause huge losses to
livestock and poultry industry. Synzium aromaticum was
found to be effective against all the selected bacteria while
antiviral properties were found against EHV 1 virus only.
Active phytochemicals from Synzium aromaticum in alone
and in synergism with drugs especially such as Acyclovir
against Herpes virus need to be studied further along with
the in vivo trials of the extracts of the plant.
Bauer A W, Kirby W M M, Sherris J C and Turch M. 1966.
Antibiotic susceptibility testing by a standardized single disc
method, American Journal of Clinical Pathology 45: 493–96.
Benecia F and Courreges M C. 2000. In vitro and in vivo activity
of eugenol on human herpes virus. Phytotherapy Research 14:
495–500.
Bruneton J. 1995. Pharmacognosy, Phytochemistry of Medicinal
plants. (Lavoisler, France), 265.
Chopra R N, Nayer S L and Chopra I C. 1962. Glossary of Indian
Medicinal Plants. 3rd edn. Council of Scientific and Industrial
Research, New Delhi, India, 7.
Chukwurah B K C. 1997. Antimicrobial activity of Holarrhena
floribunds stem bark ethanol extracts. Fitoterapia 68: 180–81.
Cowan M M. 1999. Plant products as antimicrobial agents. Clinical
Microbiological Reviews 12: 564–82.
Deans S G, Noble R C, Hiltunen R, Wuryani W and Penzes L G.
1995. Antimicrobial and antioxidant properties of Synzium
aromaticum (L.) Merr. And Perry: impact upon bacteria, fungi
and fatty acid levels in ageing mice. Flavours and Fragrance
Journal 10: 323–28.
Dorman H J D and Deans S G. 2000. Antimicrobial agents from
plants: antibacterial activity of plant volatile oils. Journal of
Applied Microbiology 88: 308–16.
Field A K and Biron K K. 1994. The end of Innocerice revisited:
resistance of herpes virus to antiviral drugs. Clinical
Microbiological Reviews 7: 1–8.
Iyenger M A. 1985. Study of Crude Drugs. 2 nd edn. College of
Pharmaceutical Sciences, Kasturba Medical College, Manipal,
India, 13.
Kapoor L D, Singh A, Kapoor S L, Srivastava S N. 1969. Survey
of Indian medicinal plants for saponins, alkaloids and
flavonoids. Lloyds 32: 297–302.
Kim J, Marshall M R and Wei C. 1995. Antibacterial activity of
some essential oil components against five food borne
pathogens. Journal of Agricultural Food Chemistry 43: 2839–
45.
Kokoska L, Polesny Z, Rada V, Nepovim A and Vanek T. 2002.
Screening of some Siberian Medicinal Plants for antimicrobial
activity. Journal of Ethnopharmacology 82: 51–53.
Kurokawa M, Hozumi T, Basnet P, Nakano M, Kadota S, Namba
T, Kawana T and Shiraki K. 1998a. Purification and
characterization of eugeniin as an anti-herpesvirus compound
from Geum japonicum and Synzium aromaticum. Journal of
Pharmacology and Experimental Therapeutics 284: 728–35.
Liu K C, Lin M T, Lee S S, Chiou J F, Ren S and Lien E J. 1999.
Antiviral tannins from two Phyllanthus species. Planta Medica
65: 43–46.
Meerbach A, Neyts J, Balzarini J, Helbig B, De Clercq E and
ACKNOWLEDGEMENTS
The investigation was financially supported by Scientist’s
Pool Scheme to the first author from the Council of Scientific
and Industrial Research, New Delhi. The authors are thankful
to Dean, College of Veterinary Sciences, CCSHAU, Hisar
for providing the facilities to conduct the present work.
REFERENCES
Ahmad I and Beg A Z. 2001. Antimicrobial and phytochemical
studies on 45 Indian medicinal plants against multi-drug resistant
human pathogens. Journal of Ethnopharmacology 74: 113–23.
Ahmad I, Zaiba, Beg A Z and Mehmood Z. 1999. Antimicrobial
potency of selected medicinal plants with special interest in
activity against phytopathogenic fungi. Indian Veterinary
Medical Journal 23: 299–306.
Anne Xavier S R, Sivsankari V and Mary D P A. 2001. Antibacterial
activity of the essential oils of Anisomelous malabarica R. Br.
and Ocimum gratissimum Hook. Indian Journal of Microbiology
41: 231–32.
Arora D S and Kaur J. 1999. Antimicrobial activity of spices.
International Journal of Antimicrobial Agents 12: 257–62.
15
288
VIRMANI ET AL.
Wutzler P. 2001. In vitro activity of polyhydroxycarboxylates
against herpes viruses and HIV. Antiviral Chem. Chemotherapy
12: 337–45.
Nascimento-Gislene G F, Locatelli-Juliana, Freitas-Paulo C and
Silva-Giuliana L. 2000. Antibacterial activity of plant extracts
and phytochemicals on antibiotic resistant bacteria. Brazilian
Journal of Microbiology 31: 247–56.
Prajapati N D, Purohit S S, Sharma A K and Kumar T. 2003. A
Handbook of Medicinal Plants – A complete sourcebook.
(Agrobios, India). p 226.
Sakagami H, Sakagami T and Takeda M. 1995. Antiviral properties
of polyphenols. Polyphenol Actualites 12: 30.
Scalbert A.1991. Antimicrobial properties of tannins.
Phytochemistry 30: 3875–77.
Somchit M N, Reezal I, Nur I E and Mutalib A R. 2003. In vitro
antimicrobial activity of ethanol and water extracts of Cassia
alata. Journal of Ethnopharmacology 84: 1–4.
Suresh P, Ingle V K and Vijayalakshmi V. 1992. Antibacterial
[Indian Journal of Animal Sciences 80 (4)
activity of Eugenol in comparison with other antibiotics. Journal
of Food Science and Technology 29: 254–56.
Vijayan P, Rsghu C, Ashok G, Dhanaraj S A and Suresh B. 2004.
Antiviral activity of medicinal plants of Nilgiris. Indian Journal
of Medical Research 120: 24–29.
Virmani, Meenakshi, Garg, S.L. and Sharma Anshu 2008. In vitro
studies on antimicrobial activity of Allium sativum against
bacterial and fungal pathogens of animal health importance.
Journal of Immunology and Immunopathology 10(1): 46–49.
Virmani N, Verma P C, Panisup A S, Singh B K and Batra Munish.
2004. Studies on neurotropic properties of indigenous strains
on EHV–1 in murine model. Indian Journal of Animal Sciences
75(4): 393–96.
Vogel A I. 1958. A Textbook of Practical Organic Chemistry. pp
90–92. Longman, Green and Co. Ltd. London).
Zafar M. 1999. ‘Studies on antimicrobial properties of some Indian
medicinal plants.’ PhD thesis submitted to Aligarh Muslim
University, Aligarh (India).
16
Indian Journal of Animal Sciences 80 (4): 289–305, April 2010
Uterine torsion in bovines: a review
S P S GHUMAN1
Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab 141004 India
Received: 7 August 2009; Accepted: 30 October 2009
ABSTRACT
The bovines are at a higher risk of uterine torsion around the start of parturition process. Various existing suppositions
concerning the maternal and the fetal destabilizing factors liable for the occurrence of uterine torsion in bovines are
unrealistic, however some of these have been justified by logical interpretations. Considerable correlation exists between
the constriction of uterine blood vessels and the degree of uterine torsion. This is illustrated by the decrease in blood
circulation to uterus with an increase in the degree of torsion. Pathological changes of uterus and cervix are severe with
an increase in severity (higher degree of torsion persisting for a prolonged duration) of uterine torsion. The occurrence
of uterine torsion increases adrenocortical activity and influences blood vascular cellular components as well as the
metabolism of liver, kidney and muscular system. The recorded alterations in blood parameters are suggestive of
deteriorating condition of the dam and thus help to decide about the institution of various therapies, viz. anti-stress,
liver protection and electrolyte therapy. For considering the prognosis of a uterine torsion case at the time of presentation,
the patients can be categorized into either of the 3 stages, viz. stage of positive prognosis, less positive prognosis or
poor prognosis. Duration and degree of torsion is taken into account while deciding about the survival prognosis of
unborn calf and dam as well as the future reproductive health of dam. Prognosis is best when duration of torsion is <36
h and worsens with the further elapse of time. Ovariohysterectomy is considered to increase the chances of survival of
bovines with severe uterine torsion and uterine tissue compromise. At the end, acute nature of this emergency warrants
timely diagnosis and treatment.
Key words: Bovine, Dystocia, Physiopathology, Survival, Uterine torsion
of great importance due to its incidence. Uterine torsion cases
in buffaloes are 67–83% of the dystocia presented at the
referral hospitals (Vasishta 1983, Malhotra 1990, Singh
1991a, Prabhakar et al. 1994, Srinivas et al. 2007). The cattle
dystocia handled under field conditions or presented at the
referral hospitals report uterine torsion incidence as 3–11%
and 4–28%, respectively (Morten and Cox 1968, Pearson
1971, Schultz et al. 1975, Manning et al. 1982, Singla et al.
1992a, Menard 1994, Frazer et al. 1996, Laven and Howe
2005).
In bovines, the striking feature of uterine torsion is its
association with advanced pregnancy and process of
parturition. Usually, uterine torsion occurs before the onset
or during the late first stage of parturition as the cervix is
partially or completely dilated prior to or immediately after
the correction of torsion (Wright 1958, Pearson 1971, Nanda
and Sharma 1986), and this condition is rarely encountered
during the early second stage of parturition (Noakes et al.
2001). Among the referred cases of torsion, pregnancy period
is generally complete in 83–85% buffaloes (Prabhakar et al.
1994, Srinivas et al. 2007) and 77–100% cattle (Pearson
1971, Manning et al. 1982, Prabhakar et al. 1994, Frazer et
Uterine torsion, first reported in 1766 by Boutrolle, is
rotation of the pregnant uterus on its longitudinal axis
(Fleming 1930). Since then, occurrence of uterine torsion
has been diagnosed in various domesticated species like cattle
(Cergolj et al. 1999), buffalo (Prabhakar et al. 1994), doe
(Dhaliwal et al. 1986), ewe (Ijaz and Talafha 1999), llama
(Hopkins et al. 1991), camel (Cebra et al. 1997), mare (Jung
et al. 2008), bitch (Brown 1974) and queen (Thilagar et al.
2005), and even in laboratory species like rabbit (Hobbs and
Parker 1990) and guinea pig (Kunstyr 1981). Out of the
domestic species mentioned, torsion is limited to a uterine
horn or a part of the horn in bitch and queen, whereas in the
remaining, torsion is of the uterine body (Berchtold and
Rüsch 1993, Prabhakar et al. 1995b, Barrand 2009). In
bovines, torsion of the pregnant horn in front of intercornual
ligament without the involvement of uterine body or nonpregnant horn is rarely encountered (Matthijsen and Putker
1989, Dhaliwal et al. 1993).
As far as bovine species is concerned, torsion of uterus is
Present address: 1 Associate Professor (e-mail: ghuman_s
@yahoo.co.in), Department of Veterinary Gynaecology and
Obstetrics.
17
290
GHUMAN
al. 1996, Srinivas et al. 2007). Occasionally, uterine torsion
can occur around 2 months (Roberts 1986) or between
5–8th month of pregnancy (Singh et al. 1979, Ruegg 1988,
Penny 1999, Biggs and Osborne 2003) as well as when
parturition date is overdue by 1–3 weeks (Manning et al.
1982, Frazer et al. 1996) or even in post-parturient bovines
(Matthijsen and Putker 1989, Willetto et al. 1996).
The incidence of uterine torsion as well as the time of its
occurrence in bovines emphasizes its impact on dam’s health
and thus the dairy herd profitability (Schönfelder and
Hasenclever 2005). Cost-utility analysis of a bovine with
uterine torsion indicated that total loss of untreated or
euthanized animal could be around Rs 30,000–50,000, mainly
due to expenses for the replacement of animal, whereas the
loss of a treated animal could be around Rs 5,000–10,000.
This includes losses due to calf, reduced milk yield and
handling of subsequent conditions, viz. delayed uterine
involution, endometritis and infertility (Schönfelder et al.
2003, 2005a). Moreover, torsion of uterus may accompany
ovarian vein rupture (Blanchard 1981), rotation of urinary
bladder (Kochhar et al. 1994), intestinal obstruction
(Dhaliwal et al. 1992), haemoperitoneum (Jadhao et al.
1993), uterine perforation (Pickel et al. 1990) and formation
of adhesions of uterus with surrounding viscera (Siddiquee
1988).
Thus, looking into the magnitude of adverse impact of
uterine torsion in bovines, the purpose of this review is to
understand: (a) the reasons underlying the predisposition of
bovine uterus to torsion, (b) physiopathological
consequences, (c) diagnosis, (d) treatment, (e) events during
post-detorsion period, and (f) survival and fertility prognosis
of bovines in the event of uterine torsion.
[Indian Journal of Animal Sciences 80 (4)
horns is minimized (Berchtold and Rüsch 1993, Chaney et
al. 2007). However, bovine uterus is conducive to torsion
due to the facts that: (a) bovines have sub-ilial attachment of
broad ligaments, (b) broad ligaments are attached along the
lesser (ventral) curvature of uterus, thus leaving the greater
(dorsal) curvature free, (c) uterine horns are not fixed by the
broad ligaments but are lying free, and (d) as the pregnancy
advances in bovines, there is a relatively small increase in
the length of the broad ligaments but the pregnant horn
extends massively beyond the area of attachment (Wright
1958, Pearson 1971, Schulz et al. 1975, Sloss and Dufty 1980,
Manning et al. 1982, Baker 1988). This relatively unstable
anatomical arrangement predisposes bovines to uterine
torsion during the last trimester of pregnancy (Roberts 1986,
Noakes et al. 2001). This concept is supported by the fact
that uterine torsion is extremely rare in cases of bicornual
pregnancy and feto-pelvic disproportion, both conditions tend
to stabilize the broader base of pregnant uterus, and thus
prevent uterine torsion (Manning et al. 1982, Roberts 1986,
Noakes et al. 2001). Nevertheless, a rare case of uterine
torsion was reported during twin pregnancy (Wardrope and
Boyes 2002).
Between bovine species, anatomical variability in the
attachment of broad ligaments to uterus seems to have a role
in predisposition of pregnant uterus to torsion. The likelihood
of torsion is less in Bos indicus cattle compared to Bos taurus
cattle, crossbred cattle and buffaloes (Prabhakar et al. 1994,
Frazer et al. 1996, Srinivas et al. 2007, Aubry et al. 2008).
In Bos indicus cattle, pregnant uterus is more stable due to
attachment of broad ligaments on the dorsal side in the
anterior two-thirds of uterus and on the ventrolateral side in
the posterior one-third of uterus (Sloss and Dufty 1980,
Roberts 1986). In Bos taurus cattle, crossbred cattle and
buffaloes, pregnant uterus is unstable due to attachment of
broad ligaments on the ventrolateral side of uterus (Wright
1958, Sloss and Dufty 1980, Singh 1991b, Noakes et al.
2001). Additionally, higher incidence of uterine torsion in
buffaloes than cattle is partly due to the big length of broad
ligaments in buffaloes which makes the pregnant uterus less
stable in buffaloes as these ligaments position the uterus at
time of parturition to facilitate the expulsion of fetus (Singh
1991b).
Musculature of the broad ligaments: Role of broad
ligament musculature in the occurrence of uterine torsion is
highlighted from the observation that broad ligaments of
bovines suffering from uterine torsion are thin and have less
muscles compared to their counterparts with other types of
dystocia (Singh 1991b). At least 25% females born to uterine
torsion affected dams and 11% non-pregnant buffaloes have
poorly developed muscles in broad ligaments (Brar et al.
2008). Additionally, broad ligament musculature is better
arranged in cattle compared to buffaloes, thus providing
better stability to the pregnant uterus of cattle (Prabhakar et
al. 1994, Brar et al. 2008).
Predisposition of bovine uterus to torsion
A number of concepts exist for explaining the
predisposition of bovine uterus to torsion; however, the
maternal and the fetal destabilizing factors behind occurrence
of uterine torsion are not well understood (Schönfelder and
Sobiraj 2005). The proposed concepts confront with reality
as only some and not all the bovines develop torsion of uterus.
In fact, uterine torsion is hypothesized to be of fetal and not
maternal origin as the affected animal is not predisposed to
torsion in the future pregnancies (DeBruin 1910, Taylor
1942).
Maternal destabilizing factors
Attachment of the broad ligaments: The uterus is held in
its position mainly by the mesometrium which consists of 2
folds of peritoneum called the broad ligaments. The
importance of attachment of broad ligaments with regard to
occurrence of uterine torsion can be observed from the fact
that in mares, torsion of uterus is less frequent because the
attachment of broad ligaments is sub-lumbar and the ovaries
are fixed in the lumbar region, thus the mobility of uterine
18
April 2010]
UTERINE TORSION IN BOVINES
Enlargement of the pregnant uterine horn: A hypothesis
was proposed that pregnant uterine horn due to its larger
mass and imbalanced suspension protrudes ventrally and
leads to rotation of uterus in the direction of pregnant horn
(Desliens 1967, Pearson 1971). However, this hypothesis
appears doubtful as in 80% uterine torsions, the direction of
torsion is towards non-pregnant horn (Gloor 1973).
Moreover, in cattle with didelphic uterus, in which nonpregnant horn is absent, torsion of the pregnant horn without
the involvement of rudimentary accessory horn is reported
during consecutive pregnancies (Dhaliwal et al. 1988, 1989).
Location of the pregnant uterine horn: For stability, the
pregnant uterine horn is usually located inside bursa
supraomentalis (Schönfelder and Sobiraj 2005). However,
in 80% cattle with uterine torsion, pregnant horn is usually
present outside bursa supraomentalis as observed at the time
of caesarean section (Gloor 1973). This may lead to instability
of pregnant horn, and thus dam is predisposed to the torsion
of uterus (Schönfelder and Sobiraj 2005).
Unfilled rumen: The role of rumen in preventing torsion
of uterus is evident from the fact that presence of rumen on
left side increases the incidence of right side uterine torsion
(Siddquee 1988). If rumen is unfilled, space in the abdominal
cavity is increased and the relatively unstable pregnant uterus
gets predisposed to torsion, especially in case of sudden fall
and the way bovines normally get up and lie down (Moore
and Richardson 1995, Drost 2007). Furthermore, the type of
diet and hence the rumen volume is expected to be the reason
behind variation in incidence of uterine torsion (1–7% of
dystocia) between Australian, European, North American and
British literature. In some regions, bovines that are reared
on concentrate diet have small rumen volume compared to
bovines reared on pasture, and thus there is more space in
the abdominal cavity for the unstable pregnant uterus to rotate
(Morten and Cox 1968, Sloss and Dufty 1980, Manning et
al. 1982).
Body frame of the dam: It was hypothesized that large
framed Brown Swiss cattle is likely to have torsion of uterus
compared to other cattle breeds due to their roomy abdomen
(Desliens 1967, Elmore 1993). Moreover, capacious and
pendulous abdomen seems to facilitate easy rotation of
pregnant uterus in buffaloes compared to cattle and in
pluriparous buffaloes compared to primiparous buffaloes
(Sloss and Dufty 1980, Siddiquee 1988, Singh 1991b). This
concept can be ruled out as the body frame (scapula to tuber
sacral distance as well as depth of the abdomen at fifth lumbar
vertebra) of cattle suffering from uterine torsion had no
relation with torsion of uterus (Berger-Pusterla 1995).
Type of housing: Stall fed, and not the pastured, bovines
were proposed to be more prone to uterine torsion (Williams
1948, Agarwal 1987). Confinement of animals in stables for
long periods may lead to weakness of the abdominal muscles
due to lack of exercise and thus may support the occurrence
of uterine torsion (Sloss and Dufty 1980). This concept is
291
not supported by all studies in which either pastured cattle
are at higher risk or the incidence is similar between stall
fed and pastured cattle (Wright 1958, Desliens 1967).
Nevertheless, a stall fed pregnant cattle housed in a group is
at the risk of torsion of uterus due to the chance of being
bumped on its side by the accompanying cattle (Aubry et al.
2008).
Sudden movements of the dam: Advanced pregnant
bovines may get predisposed to uterine torsion following
sudden fall, sudden push from other animal and bumpy
movements during transportation (Schulz et al. 1975, Elmore
1993, Berger-Pusterla 1995, Moore and Richardson 1995).
In these cases, the fetus may respond with violent movements,
and thereafter the heavy uterus may take time to return to its
original position, while the dam may change their position
quickly to expose unstable pregnant uterus to torsion (Rüsse
1963, Schönfelder and Sobiraj 2005). In addition, while lying
down, bovines go down on forelegs first and while getting
up, the hindquarters are elevated first, thus each time, the
pregnant uterus is temporarily suspended in the abdominal
cavity and is prone to torsion (Drost 2007). However, other
contributory factors must be present in addition to instability
that occurs during sudden movements of the dam, otherwise
uterine torsion would have been frequent in advanced
pregnant animals compared to during the first stage of
parturition (Frazer et al. 1996, Amer and Hashem 2008). In
addition, history of transportation and fight between animals
is absent in uterine torsion cases presented at a referral
hospital (Nanda and Sharma 1986).
Unsteady walk: None of the uterine torsion affected
buffaloes presented at a referral hospital had the history of
wallowing or grazing on hills (Nanda and Sharma 1986).
Unsteady walk of buffaloes in ponds at the time of wallowing
was ruled out as a predisposing factor for uterine torsion
when attempts to induce torsion in advanced pregnant
buffaloes by forced wallowing, for an hour daily for about a
month, were not successful (Agarwal 1987). Moreover, minor
differences in the incidence of uterine torsion in bovines
reared either in the hilly tracts or the plains rules out the
concept of predisposition to uterine torsion during unsteady
walk (Ishaque et al. 1960, Singh 1991a).
Age of the dam: The influence of age on occurrence of
uterine torsion remains controversial, as there is no age
predisposition in torsion-affected buffaloes and cattle of 2–
18 years age (Manning et al. 1982, Agarwal 1987, Tamm
1997). Others propose that 70–77% torsions occur in the
pluriparous and 23–30% in the primiparous cattle and
buffaloes (Pearson 1971, Roberts 1986, Singla 1988, Srinivas
et al. 2007). The proposed reasons include larger abdominal
cavity, stretching of pelvic ligaments, loose and long broad
ligaments together with loosening of uterine tissue and
decreased uterine tone in old aged bovines (Roberts 1986,
Berger-Pusterla 1995, Drost 2007, Aubry et al. 2008). On
the contrary, cattle with minimum 5 parities were at less risk
19
292
GHUMAN
of uterine torsion, as 74% uterine torsions occur in cattle
during first to third parity (Pearson 1971, Frazer et al. 1996).
In addition, increased thickness of uterine muscles in
multiparous bovines rejects the concept of loosening and
destabilization of uterine tissue (Mochow and Olds 1966).
Plasma hormonal profiles: Low progesterone and high
estradiol are essential for the onset of uterine contractions at
the onset of parturition, whereas high progesterone and low
estradiol during immediate pre-partum period may make the
uterus flaccid, and hence increases risk of its torsion (Bugalia
et al. 1995, Nanda and Sharma 1986, Abdel-Ghaffar and
Abou-El-Roos 2002, Prabhakar et al. 2007, Amer
and Hashem 2008). The reason for hormonal imbalance could
be non-conversion of progesterone to estrogen by nonfunctional placenta (Agarwal 1987, Siddique 1988) and
partial degeneration of corpus luteum of pregnancy (Nanda
and Sharma 1986).
[Indian Journal of Animal Sciences 80 (4)
cause the rotation of uterus (Schönfelder and Sobiraj 2005).
In addition, reduced amount of amniotic fluid decreases size
of uterus which allows free intra-abdominal movement of
uterus followed by the occurrence of uterine torsion
(Schönfelder and Sobiraj 2005).
Fetal movements and uterine tone: About 90% uterine
torsions are encountered during the late first stage of
parturition process (Noakes et al. 2001). At this stage,
conditions favourable for torsion are created because cervix
has started to dilate, uterus has begun to contract and gets
molded on fetus (Taylor 1942). However, some active force
must be present during the late first stage of parturition that
should have a role in the development of uterine torsion,
otherwise torsion would have occurred frequently during the
late pregnancy (Frazer et al. 1996). It is hypothesized that
during first stage of parturition, the forces impulsive for the
rotation of unstable uterus are strong intrauterine movements
of fetus that are invoked by myometrial contractions, changes
in intra-uterine pressure as well as changes in fetal blood
flow (Dufty 1973, Jose et al. 1983, Duncanson 1985, Baker
1988). In addition, at this stage, uterine muscles are not in
much tone, thus uterus is not able to restrict the movement
of upper portion of fetus and the relaxed and unstable uterus
may be a cause for the occurrence of uterine torsion (Rüsse
1963, Schönfelder and Sobiraj 2005). In fact, uterine
instability may induce torsion only up to 180º, whereas
torsions of ≥360º require active fetal movements (Noakes et
al. 2001).
Fetal destabilizing factors
Calf birth weight and sex: The concept that excessive calf
birth weight is a predisposing factor for the development of
uterine torsion gets support from the observation that 90%
cattle with uterine torsion deliver calves which have birth
weight above the breed average (Wright 1958, Pearson 1971,
Frazer et al. 1996). During normal parturition, average size
fetus is able to rotate and flex its limbs within the boundaries
of uterine wall, however, when fetus is oversized, fetal limbs
may get entangled in the uterine wall and the continued
vigorous movements of fetus may lead to rotation of uterus
(Frazer et al. 1996). On the contrary, uterine torsion is rare
in cases of feto-pelvic disproportion (Aubry et al. 2008).
Other studies indicate that neither calf birth weight nor sex
have influence on the predisposition of dam to torsion of
uterus (Potjans 1988, Prabhakar et al. 1994, Berger-Pusterla
1995, Matharu and Prabhakar 2001). Pattabiraman et al.
(1979) and Frazer et al. (1996) recorded that 63–69% calves
from torsion-affected dam are male, whereas others record
55–66% as female (Vasishta 1983).
Fetal presentation: Abnormal presentation may not be a
factor in the development of uterine torsion (Wright 1958,
Sloss and Dufty 1980). In fact, 80–100% calves from uterine
torsion-affected bovines usually deliver in anterior
presentation with majority in dorso-ilial (17%) or dorso-pubic
(43%) position (Vasishta 1983, Prabhakar et al. 1994, Frazer
et al. 1996, Drost 2007, Aubry et al. 2008). This is in
concurrence with expected proportion of calvings in posterior
presentation (5–10%) among all normal calvings in bovines
(Noakes et al. 2001).
Reduced amount of the amniotic fluid: This is generally
observed in cattle with uterine torsion and leads to decrease
in distance between the fetus and the uterine wall
(Zimmermann 1950, Uray 1956). Hence, the fetus feels
abrupt movements of dam as a painful stimulus and in
response, performs strong reflexive movements which may
Physiopathological alterations following uterine torsion
Uterine blood flow: Rotation of uterus compresses middle
uterine vein which results in disturbances in venous
circulation and increases carbon dioxide tension in the fetal
blood. Consequently, uncomfortable fetus makes vigorous
movements that may further increase the degree of uterine
torsion. With the increase in degree of torsion, there is
compression of middle uterine artery and oxygen going to
the fetus is decreased (Schultz et al. 1975, Schönfelder et al.
2005b). Doppler ultrasound of uterine arteries in 360° uterine
torsion reveals that blood flow is almost reduced to zero and
there is a good correlation of the degree of torsion with the
constriction of uterine arteries and blood flow resistance as
well as velocity (Schönfelder et al. 2005b). Electrocardiogram alterations following experimental induction of uterine
torsion in buffaloes also reveal cardiac abnormalities
(Siddiquee et al. 1992).
Limited arterial perfusion and venous outflow in the
twisted uterus leads to ischemia, hypoxia and cell death
causing irreversible damage to the endometrium,
myometrium and ultimately death of the fetus. Continued
failure of blood supply results in loss of uterine wall elasticity
and viability, and hence the uterine wall becomes necrosed,
brittle, fragile and prone to rupture (Baker 1988, Pearson
and Denny 1975, Tamm 1997, Noakes et al. 2001). With
20
April 2010]
UTERINE TORSION IN BOVINES
prolonged obstruction, inflammation progresses, and
bacterial infection can spread to fetus, amniotic fluid, placenta
and uterine wall (Frazer et al. 1996, Schönfelder et al. 2005b).
Inflammatory changes can cause adhesions of uterus with
surrounding abdominal tissues (McEntee 1990, Sell et al.
1990). Ultimately, delay in correction of uterine torsion
causes death of the dam due to generalized bacteremia,
endotoxemia or cardiovascular failure (Roberts 1986).
Pathological changes in the uterus: Macroscopically,
following rotation of uterus, the colour of uterine wall
changes from rose-pink to blue-purple and grey indicating
the progressive metabolic deterioration of uterus
(Schönfelder et al. 2007b). Uterine wall may become
inelastic, jammed and in extreme cases can reach a thickness
of 8–12 cm from an initial value of <2 mm (Kuller 1960,
Rüsse and Grunert 1993). The surface of uterus may reveal
congested vessels and hematoma. Amniotic fluid is usually
blood-coloured with strong edema of fetal membranes and
circular hematoma around placentomes. Congestion, edema
and hematoma is present in the uterine ligaments,
mesoovarium and ovaries (Schönfelder et al. 2007b).
Histological examination of endometrium reveals
haemorrhage, edema, thrombosis, coagulative necrosis and
inflammation with varying degree of endometrial gland and
stroma degeneration (Malik 1986, Matharu 1997).
The damage to uterine tissue and its regenerative potential
following the rotation of uterus can be accessed from plasma
indicators, viz. haptoglobin and creatine kinase. Haptoglobin,
an acute phase protein, is a good indicator for the degree of
uterine tissue impairment following spontaneous or assisted
delivery in bovines (Eckersall and Conner 1988, Horadagoda
et al. 1999, Schönfelder et al. 2005c). Uterine-torsion affected
bovines exhibit an increase in plasma haptoglobin, which
increases further following correction of torsion by the rolling
of dam (Schönfelder et al. 2006, Ghuman et al. 2009). During
post-delivery period, plasma haptoglobin remains high in
detorted animals compared to their counterparts in which
fetal delivery was achieved by fetal mutations (Ghuman et
al. 2009). Surgically corrected cases of uterine torsion in
cattle revealed correlation of plasma haptoglobin with the
severity of disease, wound healing and secondary diseases.
In addition, an increase of plasma haptoglobin in about 1
week after surgical treatment of torsion can help in predicting
the regenerative potential and future fertility of uterus
(Schönfelder et al. 2005c). Moreover, the plasma picture of
creatine kinase, a muscle-specific enzyme, can reveal time
required by injured uterine muscles for regeneration in
torsion-affected animals (Schönfelder et al. 2007a).
Clinical consequences of the pathological changes in
uterus appear more severe with increasing degree and
duration of the torsion. With >360° torsion, there is massive
edema, muscle fibre degeneration and necrosis. In long
standing cases, uterine wall becomes brittle and
disintegrating, and is prone to rupture either spontaneously
293
or at the time of detorsion. In rescued cases of torsion,
hypoxemia and regenerative inflammation have a decisive
influence on prospective fertility (Pearson and Denny 1975,
Dzuba 2000).
Cervical damage: The viscoelastic properties of cervix
responsible for the dilatation of cervix are disturbed following
the torsion of uterus (Breeveld-Dwarkasing et al. 2003).
Depending upon the degree and duration of torsion, there is
variable amount of cervical ischemia leading to hypoxic
degeneration of cervical epithelium, marked fragmentation
of elastic fibres and irreparable coagulative necrosis of
smooth cells in the cervical tissue (Singla et al. 1989). A
recent study has categorized the cervical condition of uterine
torsion-affected animals on the basis of per-vaginally
palpable cervical texture and its correlation with
histopathological alterations of the cervix (Honparkhe et al.
2009). Class-A cervix has soft and smooth cervical texture
without any lobulations. Histopathology of this type of cervix
reveals hemorrhage, congestion, edema, occasional patches
of necrosis and intact cervical wall. Class-B cervix is
moderately soft and partially lobulated with marked necrosis,
fibrosis and tearing of cervical wall. Class-C cervix is
described as very hard and completely lobulated (Honparkhe
et al. 2009). Necrotic changes in cervical epithelium and
musculature of class-B and class-C cervix are responsible
for their failure to dilate following successful detorsion of
uterus (Singla et al. 1989, Honparkhe et al. 2009). In fact,
early correction of torsion may prevent cervical fibrosis
(Barber 1995). Following vaginal delivery in successfully
detorted buffaloes, the basal cell layer of epithelium
proliferates, replaces the necrosed epithelium, smooth cells
become hypertrophied and elastic and collagen fibres start
organizing into denser connective tissue (Singla et al. 1989).
Blood cellular components: Uterine-torsion affected
buffaloes suffer from normocytic normochromic anaemia
(decrease in the RBCs, Hb and PCV) due to accumulation of
metabolic waste products or relatively large loss of blood
during abnormal parturition (Amer and Hashem 2008). The
leukogram of these buffaloes reveals lymphocytopaenia,
neutrophilia and monocytosis in association with eosinopenia
(Pattabiraman and Pandit 1980, Kaur et al. 1993, Malhotra
et al. 1993, Amer and Hashem 2008), which continues till
day third postpartum in surgically corrected cases of uterine
torsion (Phogat et al. 1991). Erythrocytes are relatively fragile
in torsion-affected buffaloes and remain so in animals that
fails to survive during post-detorsion period. However, in
the survivors, erythrocytes get stabilized by 18 h postdetorsion due to alleviation of stress of torsion (Ghuman et
al. 1997b).
Liver functions: Normal parturition in bovines has
negligible influence on the plasma enzymes (Schönfelder et
al. 2007a, Hussein and Abd Ellah 2008), however, following
uterine torsion and after its correction by detorsion or surgical
treatment, the activities of aspartate amino transferase (AST),
21
294
GHUMAN
alanine amino transferase (ALT), glutamate dehydrogenase
(GLDH), creatine phosphokinase (CK) and gamma glutamyl
transferase (GGT) are increased (Pattabiraman and Pandit
1980, Frazer 1988, Phogat et al. 1991, Singla et al. 1992b,
Kaur et al. 1993, Kuhad et al. 1996, Amer and Hashem 2008),
which usually gets stabilized within 10 days after surgical
treatment of uterine torsion (Schönfelder et al. 2007a). The
increase in plasma AST and muscle specific CK is attributed
to great muscular exhaustion produced by strong abdominal
contractions following uterine torsion (Kraft and Durr 2005,
Hussein and Abd Ellah 2008). The increase in liver specific
plasma GGT and GLDH in torsion-affected buffaloes that
are subjected to caesarean sections indicates hepatic
dysfunction (Pearson 1990, Hussein and Abd Ellah 2008).
During hepatic dysfunctions, the esterification of cholesterol
is disturbed in the liver, however, no consensus can be drawn
from the results of plasma cholesterol in torsion-affected
bovines, as there is either no alteration (Ghuman et al. 1996,
Hussein and Abd Ellah 2008) or concentrations are high
(Phogat et al. 1991, Singla et al. 1992b). The latter condition
can be due to stress-induced increase in adrenal activity and
thyroid hypofunction.
Renal functions: At the time of presentation of a uterine
torsion case, a substantial increase in plasma urea and
creatinine indicates poor prognosis (Frazer 1988, Schönfelder
et al. 2007a, Amer and Hashem 2008). In uterine torsion,
ureters lying in the broad uterine ligaments are constricted
thus the urine output reduces and renal functions may get
affected (Schönfelder et al. 2007a). Moreover, the presence
of stress-induced decrease in blood flow to kidneys, shock,
dehydration and nephropathy resulting from toxic substances
liberated by dead fetus may cause acute or chronic renal
insufficiency, leading to decrease in the urea and creatinine
elimination (Noakes et al. 2001, Amer and Hashem 2008).
Plasma proteins: Huge decrease in the total plasma
proteins and albumin is consistently observed in torsion
affected buffaloes (Pattabiraman and Pandit 1980, Manju et
al. 1985, Khatri et al. 1986, Singla et al. 1992b, Amer
and Hashem 2008). This hypoproteinemia is associated with
liver malfunction and negative nitrogen balance because of
reduced protein intake (Rowlands et al. 1980, Schoenfelder
et al. 2003).
Plasma cortisol: Occurrence of torsion of uterus is a
highly stressful event as revealed by the huge increase in
plasma cortisol which increases further by 15–30% following
detorsion of uterus through the rolling of dam (Ghuman et
al. 1996, 1997a, Amer and Hashem 2008). The buffaloes that
die subsequent to detorsion of uterus have persistently
elevated plasma cortisol during post-detorsion period
suggesting that continued presence of stress is detrimental
for the dam survivability (Ghuman et al. 1998a).
Plasma glucose: Hyperglycemia in torsion-affected
buffaloes is related to activation of stress axis and increased
cortisol release which leads to gluconeogenesis (Ghuman et
[Indian Journal of Animal Sciences 80 (4)
al. 1996, Amer and Hashem 2008). In fact, plasma ketones
are elevated in these buffaloes due to improper utilization of
glucose (Ghuman et al. 1996).
Plasma electrolytes: In torsion affected cattle, minor
changes can be noticed in plasma calcium, inorganic
phosphorus, sodium and potassium; however the presence
of low plasma magnesium during post-detorsion period
indicates poor prognosis (Schönfelder et al. 2007c).
Hypomagnesaemia leads to decrease in activity of various
tissues like heart and skeletal muscle, nerve tissue, brain and
spinal fluid and liver, which explains muscle tremor,
decreased movement, pain and recumbency following
obstetrical interventions (Schönfelder et al. 2007c). The
importance of plasma magnesium during the initial postoperative period can be further emphasized from the findings
that the uterine torsion affected cattle that are subjected to
caesarean and ultimately fail to survive have marked
hypomagnesaemia and hypomagnesaemia-induced renal
potassium loss by day 4 post-caesarean (Thomas 2005,
Schönfelder et al. 2007c). During this period, regeneration
of liver and all the reactions involving ATP is hampered due
to huge requirement of magnesium for its role in activity of
around 300 enzymes (Kolb 1985, Rükgauer 2005). The
factors responsible for hypomagnesaemia are—stress of
uterine torsion and surgery, lowering down of renal threshold
for the excretion of magnesium due to high-dose glucose
infusion, and reduced food intake during post-caesarean
period (Durlach and Rayssignier 1980, Durlach 1992,
Rükgauer 2005).
Diagnosis
History and external signs: Diagnosis is easy when the
abnormal symptoms appear at time of parturition. Typical
history of a case of uterine torsion will indicate that animal
was about to calve, as exhibited by letdown of milk and
relaxation of pelvic ligaments, but adequate time has passed
and still there is neither the rupture of fetal water bags nor
the appearance of fetus from vulvar lips (Wright 1958,
Prabhakar et al. 1995a). On the contrary, dam is suffering
from tachycardia, tachypnoea, restlessness (frequently gets
up and down), and severe abdominal pain (due to stretching
of the broad ligament) as manifested by kicking of the
abdomen with her hind legs (Wright 1958, Sloss and Dufty
1980, Frazer et al. 1996, Noakes et al. 2001). With the
increase in degree of torsion (>270°), the stretch receptors
present in the vagina are stimulated and lead to severe
abdominal straining (Frazer et al. 1996).
If the uterus is not detorted during this period, then the
history will indicate that the continuous straining initially
exhibited by the animal to deliver the fetus has ceased
followed by the tightening of pelvic ligaments and
reabsorption of milk. If the condition remains undetected
for several days, then appetite diminishes, rumination ceases
and faeces become hard (Pearson 1971, Sloss and Dufty 1980,
22
April 2010]
UTERINE TORSION IN BOVINES
Manning et al. 1982, Ruegg 1988, Singla et al. 1992a, Frazer
et al. 1996, Srinivas et al. 2007).
At the referral hospitals, history will also suggest that
based upon the symptoms of abdominal pain and discomfort,
the farmer was misguided by the unqualified practitioners
and the animal was said to be suffering from a simple case
of digestive disorder and was treated for the same. Later on,
when there were no signs of improvement, animal has been
diagnosed with uterine torsion by other practitioners and is
referred (Personal observations).
External signs of uterine torsion like displacement of upper
commissure of vulva towards inward, left or right, vulvar
edema due to compression of the vaginal veins and lymphatic
drainage, and a slight depression of lumbo-sacral vertebrae
are not the consistent features (Pearson 1971, Frazer et al.
1996, Schönfelder et al. 2003).
Determining time elapsed since the occurrence of uterine
torsion: Estimate of duration of torsion based upon the
behavioral history provided by the farmer is necessary to
have idea about the prognosis of a case. It is not unusual for
a torsion to have occurred between 6 and >72 h before the
case is presented (Roberts 1986, Prabhakar et al. 1995a).
The estimated duration of labor in 63% torsions is between
8–12 h and >12 h in 21% torsions (Manning et al. 1982). In
another study, the percentage of torsions presented in <6 h,
6–24 h, 24–48 h, 72–96 h and 96–168 h after onset of torsion
is 5, 55, 16, 17 and 7, respectively (Frazer et al. 1996). From
a practical point of view, the duration of occurrence of torsion
at the time of case presentation to a veterinarian can be judged
from the status of pelvic ligament relaxation and mammary
gland engorgement. In the buffaloes with uterine torsion of
<36 h and 36–72 h, both these signs are usually evident in
90 and 37% cases respectively. Beyond 72 h, milk usually
gets reabsorbed and pelvic ligaments are tightened in 80%
torsions (Prabhakar et al. 1995a).
295
palpable and cervix is not accessible. In these vaginal folds,
if the fingers go to the left side and the hand to right side
then torsion is of right side; however the side of torsion needs
confirmation by rectal examination (Noakes et al. 2001,
Aubry et al. 2008).
Pre-cervical uterine torsion: During pre-cervical torsion,
the twist of rotated uterus lies on the body of uterus and does
not extend beyond the cervix, thus folds on vaginal wall are
absent and cervix is approachable during vaginal examination
(Noakes et al. 2001). Pre-cervical torsions are more likely
to occur during the last trimester (Sloss and Dufty 1980).
Bos indicus cattle is more prone to pre-cervical torsion (57%;
Roberts and Hillman 1973, Prabhakar et al. 1994, Prasad et
al. 2000), whereas the preponderance of torsion is postcervical in Bos taurus cattle (Pearson 1971), cross-bred cattle
(56–99%; Singla et al. 1992a, Sharma et al. 1995) and
Bubalus bubalis buffaloes (87–99%; Vasishta 1983, Malhotra
1990, Prabhakar et al. 1994, 1997, Sharma et al. 1995,
Srinivas et al. 2007).
Rectal examination
Pre-cervical uterine torsion: During rectal examination,
attention should be paid to the course of broad ligaments to
rule out pre-cervical torsion. In normal pregnant animal, the
broad ligaments can be palpated on the sides of uterus,
whereas in pre-cervical (and post-cervical) torsion, the
orientation of broad ligaments is altered and these can be
felt by crossed and twisted uterus (Noakes et al. 2001).
Direction of uterine torsion: Accurate determination of
the direction of torsion through rectal examination is
necessary prior to making attempts at correction, as detorsion
in the wrong direction will worsen the problem (Noakes et
al. 2001). The direction of post- or pre-cervical torsion is
clockwise (right) or counter-clockwise (left) (Sloss and Dufty
1980, Noakes et al. 2001). The broad ligament ipsilateral to
the side of torsion is pulled vertically downward beneath the
uterus, whereas the contralateral broad ligament is tightly
stretched diagonally above the uterus, thus the examiner’s
hand will move in a pouch formed at either right or left side
of uterus (Pearson 1971, Manning et al. 1982, Berchtold and
Rüsch 1993, Noakes et al. 2001, Drost 2007).
Differences exist between bovine species regarding the
predominance of right or left uterine torsion. It is proposed
that pregnant horn usually rotates over the non-pregnant horn,
thus, left torsions are associated with right horn pregnancies,
and vice versa (Sloss and Dufty 1980). Moreover, it is
presumed that rumen checks the rotation of right horn over
to left (Wright 1958, Sloss and Dufty 1980, Noakes et al.
2001). However, both these concepts do not hold good in
Bos taurus cattle as 59–75% torsions in this species are
towards left (Pearson 1971, Manning et al. 1982, Baker 1988,
Frazer et al. 1996, Aubry et al. 2008). In fact, Bos taurus
cattle has additional muscular fold on the right broad ligament
which prevents the right horn to rotate downward (Singh
Vaginal examination
Post-cervical uterine torsion: Post-cervical torsions can
be easily diagnosed by vaginal examination. About 66–96%
torsions are post-cervical in which the twist of rotated uterus
extends caudal to the cervix and involves the anterior vagina
in rotation (Frazer et al. 1996, Noakes et al. 2001, Aubry et
al. 2008). Anterior vagina is the weakest point of the bovine
genital tract due to the absence of muscles in the cervical
area of broad ligaments (Singh 1991b). In 34% torsions,
vaginal involvement is not obvious during vaginal
examination as the cervix is approachable. This is due to
post-cervical torsion of less degree or if there is pre-cervical
torsion (Pearson 1971, Frazer et al. 1996).
During vaginal examination, if post-cervical torsion is
<180°, then the spiral folds or twists are present in the vaginal
wall along an accessible cervix (Pearson 1971, Noakes et al.
2001, Drost 2007). When post-cervical torsion reaches more
than one revolution (>180°), then only vaginal folds are
23
296
GHUMAN
1991b). On the contrary, rotation of uterus is predominantly
towards right in Bos indicus cattle (83%; Roberts and Hillman
1973, Prabhakar et al. 1994, Prasad et al. 2000), crossbred
cattle (79%; Singla et al. 1992a) and Bubalus bubalis
buffaloes (95–98%; Vasishta 1983, Malhotra 1990, Prabhakar
et al. 1994, Srinivas et al. 2007). In buffaloes, the absence
of a muscular fold on right broad ligament increases the
possibility of right torsion (Singh 1991b).
Degree of uterine torsion: Degree is determined by the
number of twists present on the body of uterus. During rectal
examination, these are palpable like the twists on a screw.
Torsion of >45° may result in dystocia (Sloss and Dufty
1980). Sometimes, dystocia due to fetal positional
abnormalities (dorso-ilial and dorso-pubic) is actually a
uterine torsion of low magnitude (Morten and Cox 1968,
Roberts 1986). In general, torsion of 90°–180° is common,
but a marked difference exists between referral and field cases
(Wright 1958, Pearson 1971, Manning et al. 1982, Frazer et
al. 1996). Torsions of <180° account for 75% torsions handled
in the field and 6–15% torsions handled at the referral
hospitals (Pearson 1971, Sloss and Dufty 1980, Manning et
al. 1982, Aubry et al. 2008). About 57–80% torsions at
referral hospitals are of 180°–270° (Manning et al. 1982,
Frazer et al. 1996, Aubry et al. 2008). At a referral hospital,
where mainly buffaloes are presented, the percentage of
torsions of <90°, 90°–180°, 180°–360° and >360° is 12–21,
57–59, 12–28 and 3% respectively (Malhotra 1990, Singla
et al. 1992a, Srinivas et al. 2007). Interestingly, in one referral
population, 66% torsions are of 360°, although in general,
only 1–9% torsions are >360° and torsions of 720°–1080°
seldom occur (Pearson 1971, Manning et al. 1982, Ruegg
1988, Frazer et al. 1996, Noakes et al. 2001, Aubry et al.
2008).
Peri-uterine adhesions and uterine texture: In delayed
cases, rectal examination is necessary to rule out uterine
adhesions with the other abdominal structures. If adhesions
are present, the examiner will not be able to move his hand
on the either side of uterus during rectal examination (Noakes
et al. 2001). The palpation of uterine texture is important for
determining the prognosis of a case and will be discussed
later in this review.
[Indian Journal of Animal Sciences 80 (4)
and Rudloff 1983). In torsion-affected bovines, clenbuterol
administration helps in better assessment of the direction of
torsion, easier passage of hand through the vaginal folds,
easier rotation of fetus through the vagina and easy detorsion
of the uterus. Moreover, the number of surgical deliveries
decreases with tocolytics as the uterus is maintained in a
relaxed state after detorsion, thus allowing better relaxation
and dilation of the birth canal soft tissues (Menard 1994).
The likelihood of delivery by surgical procedures is much
high if tocolytics are not routinely used in torsion-affected
cattle (64–82% versus 23%; Pearson 1971, Manning et al.
1982, Menard 1994). Nevertheless, use of tocolytics is not
effective in long-standing torsions and in >360° torsion. In
these cases, hampered circulation prevents tocolytics from
reaching and activating sufficient number of receptor sites
thus leads to poor uterine relaxation (Menard and Diaz 1987,
Menard 1994).
Per-vaginal rotation of the fetus: Degree of torsion and
the amount of cervical dilatation are critical factors for the
success of this method (Pearson 1971, Sloss and Dufty 1980,
Noakes et al. 2001, Kruse 2004). With rotations of ≤90°, the
fetus is easily rocked manually into a normal dorso-sacral
position (Drost 2007). Success rate is high if dam is standing,
cervix is sufficiently dilated to grasp the fetus and the fetus
is live. However, increased fetal size and the weight of
reproductive tract can make the correction of torsion difficult
(Morten and Cox 1968, Noakes et al. 2001). This method is
effective in 96% torsions when correction per-vaginum is
attempted as a first choice in the field, however at the referral
hospitals, the success rate of this method is 20–62% due to
more difficult cases of torsion being referred and delay in
handling of torsions (Pearson 1971, Sloss and Dufty 1980,
Manning et al. 1982, Frazer et al. 1996). In fact, a field survey
reported that manipulation per-vaginum is the treatment of
choice, with rolling being the alternate approach (Morten
and Cox 1968).
Rolling of the dam: Rolling is indicated if the dam is
recumbent, the fetus is not approachable due to the severity
of torsion, or if the torsion has occurred before the expected
time of parturition (Roberts 1986, Noakes et al. 2001).
Following the rolling of dam without a plank, detorsion of
uterus is successful in 18–100% cases (Roberts and Hilman
1973, Sloss and Dufty 1980, Frazer et al. 1996, Kruse 2004).
However, success rate is 84–90% using Schaffer’s method
(Schaffer 1946) of rolling in which a plank (12 feet long and
10 inch wide) is placed on the upper paralumbar fossa at the
time of rolling (Arthur 1966, Roberts and Hilman 1973,
Noakes et al. 2001, Aubry et al. 2008).
In Schaffer’s method, theory is to rotate the dam to the
same degree and direction to which the uterus has rotated,
keeping the fetus fixed by fixing uterus with a plank (Schaffer
1946). In brief, after ascertaining the side of torsion, animal
is casted carefully in lateral recumbency on the side of
direction of torsion and the front and hind legs are secured
Treatment
The technique to be selected for detorsion of uterus in
bovines varies with expertise of veterinarian, stage of
pregnancy, severity of torsion as well as condition of dam,
uterus and fetus. The most commonly used techniques are
per-vaginal rotation of fetus, rolling of dam and caesarean
section.
Use of tocolytics prior to uterine detorsion:
Sympathomimetic compounds like clenbuterol selectively
block smooth muscle contraction, can induce uterine
relaxation and their effect on uterus is termed as tocolysis
(Ballarini et al. 1978, Zerobin and Kundig 1980, Bostedt
24
April 2010]
(A)
UTERINE TORSION IN BOVINES
(B)
297
(C)
Fig. 1. Diagrammatic representation of Sharma’s modified Schaffer’s method for uterine detorsion of buffaloes. (A) Three assistants are
standing on the lower end of plank and another assistant is ready to press the upper end of plank, B) and C) while the buffalo is being rolled,
two assistants fix the lower end of plank, one assistant moves upon the plank and other assistant modulates the pressure on the plank by
pressing the upper end of plank.
separately. The plank is placed on the upper paralumbar fossa
of dam in an inclined manner with lower end on ground.
Next step is to slowly roll over the dam on to its back. For
this, the front and hind legs are pulled up and over the
recumbent dam. At the same time, an assistant stands on the
plank to modulate pressure first on left side (when animal is
casted on right side), followed by ventral abdomen and lastly
on right side. After each roll, effectiveness of roll is judged
by vaginal or rectal examination. If the roll is successful,
disappearance of the vaginal spirals or rectal pouch can be
immediately palpated by the examiner. If the roll is not
successful, then the dam is returned slowly to her original
position and the whole procedure needs to be repeated
(Roberts and Hillman 1973, Singla et al. 1992a, Noakes et
al. 2001).
In Egyptian buffaloes, Schaffer’s method was described
as the best method for rolling (El-Naggar 1978, Samad et al.
1981). However, thick skin of Indian buffaloes causes
skidding of the plank at the time of rolling. Moreover,
pendulous abdomen of Indian buffalo warrants greater
pressure for the fixation of pregnant uterus. Therefore,
modifications were made in Schaffer’s method and the
method is termed as Sharma’s modified Schaffer’s method
(Fig 1; Singh and Nanda 1996). The modifications made
were: (a) alteration in the dimensions of plank (length: 11.9
feet, width: 9 inch and thickness: 2 inch) to suite the buffaloes,
(b) while rolling, plank is anchored by 1–2 medium weight
assistants who stand still upon the lower end of plank and
another assistant moves on the plank, (c) an additional
assistant modulates the pressure on the plank by pressing
the upper end of plank, and (d) buffalo is rolled quickly. In
fact, Sharma’s modified Schaffer’s method of detorsion was
developed based upon the principle of lever (fulcrum, load
and effort). In this, fulcrum is lower end of plank that does
not move, load is the weight of assistants standing and moving
on the plank and effort is the force used by the assistant on
the upper end of plank (Fig 1). Using this method, the
detorsion rate in Indian buffaloes was 90% in comparison to
40% success rate achieved by Schaffer’s method (Singh and
Nanda 1996, Srinivas et al. 2007).
The success rate of uterine detorsion after rolling of the
dam depends upon the location, degree and the duration of
torsion. When torsion is pre-cervical and duration is <36 h,
36–72 h or >72 h, the animals successfully detorted are 82,
100 or 67%, respectively (Prabhakar et al. 1997). In buffaloes,
detorsion followed by vaginal delivery is easily accomplished
when torsion is <180°. With an increase in degree of torsion,
more number of rolls is required to detort the uterus as well
as the likelihood of vaginal delivery is decreased (Amer
and Hashem 2008). It is suggested that if the torsion is not
relieved after 3 rolls then failure should be admitted and
surgery is indicated (Nanda et al. 1991). Buffaloes subjected
to injudicious rolling (>3 rolls) has least survival rate as
compared to those where rolling was well planned
(Dhaliwal et al. 1991). Depending upon the prior handling
of a case of torsion, buffaloes subjected to 1–3 rolls had 44–
78% survival rate, whereas those subjected to more than 3
rolls had 35–56% survival rate (Dhaliwal et al. 1991). In
another study, survival rate of buffaloes requiring 1–2 rolls
and 3–4 rolls for complete detorsion of uterus was 85 and
43%, respectively (Ghuman et al. 1997a). Excessive adrenal
stimulation due to 1 to 2 extra rolls causes slower decline in
plasma cortisol during post-detorsion period (Ghuman et al.
1997a).
In long standing cases of torsion (>72 h), with apparent
reabsorption of milk and tightened pelvic ligaments, attempts
to achieve detorsion of uterus are usually unsuccessful due
to development of adhesions between the uterus and the
adjoining abdominal organs (Dhaliwal et al. 1991). Detorsion
of the uterus in these cases is not possible even after
detachment of adhesions (Sharma et al. 1995, Luthra and
Khar 1999). Both tissue anoxia and serosal injury following
the torsion of uterus are important factors in promoting
adhesion formation in the abdominal cavity (Henderson
1982).
Caesarean section: Most uterine torsions do not warrant
surgical intervention and cesarean section is never performed
as the first choice. In a study, where 62% uterine torsion
affected cattle were subjected to caesarean, only in 35% cases
caesarean was the first choice (Frazer et al. 1996). At referral
25
298
GHUMAN
hospitals, caesarean is usually attempted in 11–26% torsions,
in which all other methods of detorsion had failed or there is
failure of complete cervical dilatation subsequent to
successful detorsion (Arthur 1966, Manning et al. 1982,
Baker 1988, Cergolj et al. 1999, Murty et al. 1999, Amer
and Hashem 2008). In these cases, the main hope to deliver
the fetus is caesarean and the uterus is untwisted manually
after suturing (Drost 2007). Delayed (>72 h) uterine torsions
should be directly subjected to caesarean in order to avoid
the undue stress of rolling (Prabhakar et al. 1995a). Animal
with a friable, septic uterus containing an emphysematous
fetus is a poor candidate for the abdominal surgery (Amer
and Hashem 2008). While attempting caesarean, the cost of
operation and value of the animal should be judiciously
considered.
In rare instances, flank laparotomy is indicated when a
preterm torsion is diagnosed and attempts at correction by
rolling the dam are unsuccessful (Roberts 1986). In these
cases, if the uterus has not ruptured and the fetus is still alive,
the pregnancy may be continued under observation (Morten
and Cox 1968).
Reducing the stress of uterine torsion: Uterine torsion
affected buffaloes are under acute stress as suggested by
elevated plasma cortisol and suppressed ruminal, liver and
kidney functions (Ghuman et al. 1996, 1997a, 1998a). In
addition, the process of detorsion further enhances
adrenocortical activity and potentiates the existing stress on
the dam. Attempts made to alleviate stress of uterine detorsion
by administration of tranquilizers, viz. acepromazine,
chlorpromazine or diazepam before subjecting the dam to
detorsion process have failed to achieve desired success as
revealed by the regular monitoring of plasma cortisol
(Ghuman et al. 1997c). However, dexamethasone
administration during immediate post-partum period of
successfully detorted animals decreases stress and thus
increases the chances of survival of dam (Sathya et al. 2005).
Moreover, stress-induced oxidative damage is reduced and
post-dystocia convalescence is improved when antioxidants
like Vitamin E and Selenium are administered to uterine
torsion affected bovines (Sathya et al. 2007).
As revealed by plasma concentrations of liver enzymes
in uterine torsion affected bovines, the first post-operative
week should be critically observed and a liver protection
therapy should be instituted during this period (Singh 1991a).
Uterine torsion cases suffer from respiratory alkalosis
without much metabolic alterations which stabilizes
following detorsion (Ghuman et al. 1998b). Determination
of blood-gas and acid-base parameters followed by
appropriate fluid and electrolyte therapy in torsion affected
bovines shall prognosticate the chances of survival of dam
as well as the calf. As a matter of critical care, monitoring
blood-gas and acid-base status as well as electrolytes should
be a mandatory procedure in torsion affected bovines
(Ghuman et al. 1998b).
[Indian Journal of Animal Sciences 80 (4)
With the increase in duration of uterine torsion, plasma
and blood volume decreases and animal progresses towards
dehydration and toxaemia, this suggests the requirement of
immediate fluid therapy (Dhindsa et al. 2005, 2007). Torsion
cases can be resuscitated successfully using intravenous
administration of small amount of hypertonic saline and
dextran–40 followed by oral administration of large amount
of fresh water. This is a quicker, practical, easy and effective
method compared to intravenous administration of huge
amounts of normal saline (Kumar et al. 2009a). Dextran–40
can maintain elevated plasma and blood volume for longer
durations and thus decreases the degree of dehydration
(Kumar et al. 2009b). In fact, alterations in plasma cortisol,
albumin and glucose following administration of hypertonic
saline, dextran–40 and oral fluids lead to alleviation of stress
(Kumar et al. 2009a).
Events during immediate post-detorsion period
Uterine rupture: Uterine rupture usually occurs when
torsion is >270°. This is due to vascular compromise and
resulting edematous changes which weakens myometrial
fibers (Frazer et al. 1996). In 9–27% torsions, rupture of
uterus can occur either at the time of uterine detorsion or
during obstetrical manipulations in the field or at the referral
hospital (Pearson 1971, Pearson and Denny 1975, Frazer et
al. 1996). Duration of occurrence of uterine rupture can be
judged from the gross appearance of wound edges and the
severity of peritonitis (Pearson 1971). Following uterine
rupture, animals can be euthanized or subjected to corrective
surgery depending upon the viability of uterus (Pearson and
Denny 1975, Frazer et al. 1996).
Cervical dilatation subsequent to the detorsion of uterus:
Following successful detorsion of uterus, 18–50% animals
fail to exhibit complete dilatation of cervix, which warrants
cesarean section for fetal delivery (Manning et al. 1982,
Malhotra 1990, Frazer et al. 1996, Aubry et al. 2008).
Duration of torsion has a significant role in the likelihood
that cervix will completely dilate subsequent to detorsion.
When buffaloes are subjected to detorsion process in <36 h,
36–72 h and >72 h of occurrence of torsion, the possibility
that cervix will dilate and there will be vaginal delivery is
83, 52 and 9%, respectively (Dhaliwal et al. 1991, Prabhakar
et al.1995a, Honparkhe et al. 2009).
Location of uterine torsion also has impact on the
probability of cervical dilatation. Pre-cervical torsion is more
detrimental to cervix due to severe ischemia of cervical tissue
compared to post-cervical torsion. In bovines with precervical torsion of <36 h, the fetuses were delivered through
vaginal route in 67% cases, whereas the cervix failed to dilate
in all the animals which had pre-cervical torsion of >36 h
(Prabhakar et al. 1997).
Uterine contractions induced by live fetus help to achieve
complete dilatation of cervix (Breeveld-Dwarkasing et al.
2003). Thus, viability of fetus at the time of uterine detorsion
26
April 2010]
UTERINE TORSION IN BOVINES
has a major impact on the post-detorsion likelihood of
complete cervical dilatation (Honparkhe et al. 2009). In fact,
cervix seldom dilates if the fetus is found dead immediately
after detorsion (Frazer et al. 1996). It is strongly
recommended that following detorsion, if the fetus is dead,
the dam should be immediately subjected to cervical
dilatation approaches, otherwise leaving even soft (class-A)
or moderately soft (class-B) cervix to dilate on its own will
lead to complete hardening of cervix (class-C) within 24 h,
followed by its failure to dilate (Honparkhe et al. 2009).
Otherwise, if the fetus is alive, one may elect to wait a few
hours to assess if parturition proceeds to second stage.
However, this occurs only in a few cases and waiting period
of >3 h is dangerous, especially if the fetal membranes have
already ruptured (Pearson 1971).
In successfully detorted bovines, non-hormonal and
hormonal approaches can be applied to achieve complete
cervical dilatation followed by fetal delivery. According to
some workers, an indurated cervix is unlikely to dilate and
manual stretching of a partially dilated cervix is seldom
successful (Pearson 1971, Sloss and Dufty 1980). Others
reveal that cervical manipulations through non-hormonal
approaches can effectively dilate cervix, in particular, if
unborn fetus is dead. In this technique, immediately after
detorsion, a soft (class-A) or moderately soft (class-B) cervix
should be subjected to cervical massage (three times, 15 min
each, at 1 h interval) with warm sodium carboxy methyl
cellulose (SCMC) gel (Honparkhe et al. 2009). If the vaginal
canal is relaxed and the fetus is not excessively large,
sectioning of the cervical rim can be attempted. This approach
is contra-indicated if the cervix is thick and indurated
(Pearson 1971). Thus, it is sensible that a successfully
detorted bovine diagnosed with hard cervix and dead fetus
should be immediately subjected to cesarean as non-hormonal
approaches are also unable to dilate cervix of hard texture
(Honparkhe et al. 2009).
Hormones like oxytocin can be used for inducing cervical
dilatation in cattle; however literature has not consistently
proven its efficiency (Sloss and Dufty 1980, Roberts 1986).
Multiple intra-cervical injections of prostaglandin-F2α do
not elicit cervical dilatation (Malhotra et al. 1994).
Furthermore, hyaluronidase reduces the adhesions of cervical
cells by neutralizing hyluronic acid and thus helps in
softening of the cervix and cervical dilatation (Sharma and
Singh 1984). Hyaluronidase injected into the cervix (through
vagina) for cervical dilatation was successful in 83% detorted
animals, and thereafter vaginal delivery occurred between
17–27 h, although this needs further validation as the sample
size (n=6) of the study is insufficient (Malhotra et al. 1994).
Survival of the calf: Survival rate of calves delivered from
torsion affected bovines presented at the referral hospitals
varied between 4–56% (Pearson 1971, Pattabiraman et al.
1979, Manning et al. 1982, Vasishta 1983, Prabhakar et al.
1994, Sharma et al. 1995, Tamm 1997, Schönfelder et al.
299
2005a). Both the duration and the degree of torsion appear
to influence the calf survival rate (Frazer et al. 1996, Amer
and Hashem 2008). Calf survival can be as high as 44–58%
if there is timely diagnosis and correction of torsion (Sloss
and Dufty 1980, Manning et al. 1982). Delay in diagnosis
can cause fetal hypoxia due to placental separation even in
the presence of intact water bags (Sloss and Dufty 1980,
Noakes et al. 2001). Once uterine torsion is corrected, the
delay in achieving complete cervical dilation may further
compromise calf viability (Sloss and Dufty 1980). Delay of
even 2–3 h results in the death of calf (Pearson 1971).
Increasing degree of torsion has impact on uterine vascular
compromise and hence calf survival (Frazer et al. 1996, Amer
and Hashem 2008). Chance of rupture of water bags and
blood colored uterine discharge is less with torsion of <90°
and increases with the degree of torsion (Amer and Hashem
2008). Condition of the dead calf may be fresh or even
autolytic, with 14% being emphysematous, and is influenced
by the duration rather than the degree of torsion (Frazer et
al. 1996).
Survival of the dam: Survival rate of torsion affected
bovines varies between 78–95% depending upon whether
torsion is handled in the field or at the referral hospital
(Pearson 1971, Sloss and Dufty 1980, Frazer et al. 1996).
Main factor playing a role in the survivability of dam is time
elapsed between the onset of parturition and the correction
of torsion. Actually, survival rate in the torsion affected
bovine declines linearly (from 87 to 43%) with an increase
in the duration of torsion (Prabhakar et al. 1995a). When the
buffaloes are subjected to detorsion in <36 h, 36–72 h and
>72 h of exhibition of clinical signs of uterine torsion, there
is a survival rate of 96, 61 and 35%, respectively (Srinivas
et al. 2007). Furthermore, in a study on pre-cervical torsion
in buffaloes, dam survival rate at similar time points is 54,
50 and 47%, respectively (Prabhakar et al. 1997). Survival
rate of buffaloes which have completely dilated, incompletely
dilated or closed cervix at the time of detorsion is 95, 67 and
50%, respectively (Nanda et al. 1991). In these cases, when
more time is taken by the dam for complete cervical
dilatation, she remains under stress for prolonged period
which is fatal for the dam. Moreover, the duration of the
torsion and the time taken for complete dilatation of cervix
determine the severity of uterine necrosis, fetal putrefaction,
maternal toxemia, dehydration, shock and peritonitis which
is fatal to dam (Singh and Dhaliwal 1998, Luthra and Khar
1999, Murty et al. 1999, Matharu and Prabhakar 2001,
Noakes et al. 2001).
Correction method also influences dam survival rate.
Torsions in which detorsion is achieved through the manual
correction or rolling of the dam are usually discharged on
the same day, while most cases subjected to caesarean are
hospitalized for 2–7 days (Frazer et al. 1996). Dam survival
rate following delivery of calf through vagina or caesarean
section is 88–100% and 25–95%, respectively (Pattabiraman
27
300
GHUMAN
et al. 1979, Malhotra 1990, Prabhakar et al. 1995a, Sharma
et al. 1995, Frazer et al. 1996). The survival rate of torsion
affected bovines that are subjected to caesarean for delivery
of fetus is also dependent upon the duration of torsion. When
caesarean section is conducted in <36 h, 36–72 h and >72 h
of occurrence of torsion, the dam survival rate is 100, 57 and
33%, respectively (Srinivas et al. 2007). Also, survival rate
of the dams that are first rolled and thereafter subjected to
cesarean in <36 h and 36–72 h of occurrence of torsion is
100 and 50%, respectively (Srinivas et al. 2007). In studies
where torsion affected bovines are subjected to caesarean,
31–47% animals are euthanized during caesarean due to
compromised state of the uterus (Frazer et al. 1996, Amer
and Hashem 2008). Torsion affected bovines that usually fail
to survive or are euthanized exhibit thrombosed uterine
vessels, intra-mural hemorrhage and necrosis, and fibrinous
peritonitis (Sloss and Dufty 1980, Roberts 1986).
Depending upon injudicious handling of the case, survival
rates of torsion affected animals presented in <36 h, 36–72 h
and >72 h of occurrence of torsion are 52–86, 29–74 and
32–62%, respectively. Cases around lower range of the
survival rate in each time point are those which are first
handled in the field, then subjected to unsuccessful detorsion
at the referral hospital followed by caesarean. Cases around
higher range of the survival rate in each time point have no
history of handling in the field and are delivered through
vaginal route (Dhaliwal et al. 1991). Attempted detorsion
by rolling before caesarean section reduces dam survival rate
as the stress of rolling together with delay in removal of dead
fetus decreases post-operative chances of survival (Nanda
et al. 1991, Dhaliwal et al. 1991).
In a study where dam survival was 69%, the main
factor responsible for dam mortality was an increase in the
degree of torsion (Amer and Hashem 2008). Degree of
torsion and thus the vascular compromise influence the
development of uterine edema and ischemic necrosis which
leads to endotoxic shock (Sloss and Dufty 1980, Manning et
al. 1982).
[Indian Journal of Animal Sciences 80 (4)
examination is a reliable prognostic indicator of congestion
and damage to the uterine wall and thus subsequent survival
and fertility. Bovines with uterine elasticity have better
prognosis and bovines with bulging tense and inelastic uterus
have a greater casualty rate and lower fertility (Schönfelder
et al. 2003). Thus, with the help of case history, external
clinical signs such as mammary engorgement and relaxation
of sacrosciatic ligaments and rectal examination, the owner
can be informed about the prognosis of the presented case
(Pearson 1971, Pattabiraman et al. 1979, Schönfelder et al.
2003). With these parameters, and by taking into account
the degree and duration of torsion as well as the condition of
fetus, a three-stage based classification is provided for
assessing the survival and fertility prognosis of a uterine
torsion affected bovine.
Stage of positive prognosis: Animals have variable degree
(90º–360º) of uterine torsion of short duration (<12–36 h)
and exhibit relaxation of pelvic ligaments and complete milk
letdown (Prabhakar et al. 1995a, Schönfelder et al. 2005a).
During vaginal examination, fetal viability can be checked
through partially dilated cervix if the degree of torsion is
less. Rectal examination will reveal elastic uterine wall with
easily palpable fetal reflexes. Depending upon the degree of
torsion, torsion can be easily corrected by per-vaginal
detorsion of fetus or by the rolling of dam (Noakes et al.
2001, Hantschmann 2004). Chances of calf survival after
correction of torsion are very high if degree is towards lesser
side. Survival and subsequent fertility of bovines is >90 and
70%, respectively (Schönfelder et al. 2005a, 2007b).
Stage of less positive prognosis: Animals have variable
degree (180º–360º) of torsion of long duration (>36–72 h)
and only half of them exhibit relaxation of pelvic ligaments
and complete milk letdown. In the remaining, milk is
reabsorbed and pelvic ligament are tightened (Prabhakar et
al. 1995a, Schönfelder et al. 2005a). Rectal examination will
reveal elasticity in the uterine wall. Subsequent to detorsion,
usually by rolling of the dam, per-vaginal delivery of dead
fetus is possible only after cervical massage and manual
dilatation of cervix (Honparkhe et al. 2009). About 87% cases
will survive when torsion is corrected around 36 h after the
occurrence of torsion (Nanda et al. 1991). Subsequent fertility
of bovines is 40% (Schönfelder et al. 2005a, 2007b).
Stage of poor prognosis: Prognosis for survival is
unfavorable as the presented case will have long standing
(>72 h) torsion of >180º (Schönfelder et al. 2003, Schönfelder
et al. 2005a). In majority of the bovines, milk is reabsorbed
and pelvic ligament are tightened (Prabhakar et al. 1995a).
Congestion resulting from long standing torsion of uterine
vessels causes fetal death and subsequent autolytic and
bacterial changes in fetus which lead to a bulged, tense,
inelastic and fragile uterine wall with an immovable uterus
(Schönfelder et al. 2005a). As the uterine wall is highly
damaged, spontaneous uterine rupture can occur if rolling
of dam is attempted by the plank method.
Prognosis
Survival of a torsion affected bovine depends upon the
severity of vascular compromise that makes uterus friable,
duration of uterine torsion and correct diagnosis followed
by judicious manipulation (Sloss and Dufty 1980, Noakes et
al. 2001, Drost 2007). Subsequent fertility is negatively
correlated with both the degree and duration of torsion
(Schönfelder et al. 2005a).
After general examination of a uterine torsion affected
bovine, the owner is usually impatient to know about the
likelihood of survival of dam and fetus, treatment costs, and
post-delivery duration of illness and livestock use or future
fertility. To respond, a veterinarian requires immediately
identifiable parameters that may help to identify the prognosis
of case. Elasticity of the uterus that is palpable during rectal
28
April 2010]
UTERINE TORSION IN BOVINES
Caesarean is usually advised for detorsion of uterus.
During post-operative period, there is delayed involution due
to overexpansion of uterine structures, perfusion obstruction,
inflammation, accumulation of toxins, and myometrial
damage (Randt 1993, Frazer et al. 1996, Schönfelder et al.
2005a). During caesarean, if uterine wall is found highly
damaged and uterine closure is no longer useful, an
immediate ovariohysterectomy could be an alternative
treatment, especially because of prospective infertility
(Schönfelder and Soboraj 2006a, 2006b, Schönfelder et al.
2005a, 2007b). After the removal of dead fetus, partial (10–
25%) or complete ovariohysterectomy of ischemic or
necrosed uterus is a standardized procedure in cattle and
buffaloes although this procedure requires expertise to
overcome some technical difficulties (Mannari et al. 1982,
Cochran and Cochran 1983, Matthijsen and Putker 1989,
Singh et al. 2006). Ovariohysterectomy can be lifesaving
and should be considered if salvage is desirable to the owner
(Schönfelder and Sobiraj 2006a, Singh et al. 2006). At this
stage of torsion, dam survival rate is <43% (Nanda et al.
1991). Nevertheless, this stage usually leads to infertility
(Schönfelder et al. 2005a, 2007b).
301
appropriate therapies during post-detorsion period. Uterine
torsion cases can be categorized into three stages namely
stage of positive prognosis, less positive prognosis or poor
prognosis. Categorization is based upon the degree and
duration of torsion at the time of admission of animal and
may provide an appropriate survival and fertility prognosis.
Impact of uterine torsion on calf as well as dam mortality
and morbidity can be significantly reduced if abnormal signs
at the time of parturition are treated as an emergency.
REFERENCES
Abdel-Ghaffar A E and Abou-El-Roos M E A. 2002. New trends
regarding the diagnosis, prognosis and treatment of uterine
torsion in buffaloes. Assiut Veterinary Medical Journal 46: 249–
61.
Agrawal R G. 1987. ‘Some studies in uterine torsion with special
reference to its etiology and treatment in buffaloes.’ Dissertation,
Punjab Agriculture University Ludhiana.
Amer H A and Hashem M A. 2008. Relationship between clinical
and biochemical picture of uterine torsion in Egyptian buffaloes
(Bubalus bubalis). The Internet Journal of Veterinary Medicine
4: 1.
Arthur G H. 1966. Recent advances in bovine obstetrics. Veterinary
Record 79: 630–44.
Aubry P, Warnick L D, DesCôteaux L and Bouchard E. 2008. A
study of 55 field cases of uterine torsion in dairy cattle. Canadian
Veterinary Journal 49: 366–72.
Baker I. 1988. Torsion of the uterus in the cow. In Practice 10: 26.
Ballarini G, Belluzi G, Beltrami F, Brisighella G, Fanini G B and
Signorini G C. 1978. Indications for induction of uterine
relaxation in cattle, using clenbuterol. Clinica Veterinaria 101:
766–71.
Barber S M. 1995. Complications of chronic uterine torsion in a
mare. Canadian Veterinary Journal 36: 102–3.
Barrand K R. 2009. Unilateral uterine torsion associated with
haematometra and cystic endometrial hyperplasia in a bitch.
Veterinary Record 164: 19–20.
Berchtold M and Rüsch P. 1993. Birth interference from the mother.
Animal obstetrics. pp. 222–44. (Eds) Richter J, Götze R, Grunert
E and Arbeiter K. Parey Buchverlag Berlin.
Berger-Pusterla J. 1995. ‘Investigations on the aetiology of intrapartum uteri torsio in cattle.’ Dissertation, University of Zurich.
Biggs A and Osborne R. 2003. Uterine prolapse and mid-pregnancy
uterine torsion in cows. Veterinary Record 152: 91–2.
Blanchard T L. 1981 Uterine torsion with ovarian vein rupture in a
ewe. Journal of American Veterinary Medical Association 179:
1402–03.
Bostedt H and Rudloff P R. 1983. Prophylactic administration of
the beta-blocker carazolol to influence the duration of parturition
in sows. Theriogenology 20: 191–96.
Brar P S, Saigal R P, Sharma R D and Nanda A S. 2008. Histology
and histochemistry of broad ligaments in buffaloes. Indian
Journal of Animal Sciences 78: 464–67.
Breeveld-Dwarkasing V N, Struijk P C, Lotgering F K, Eijskoot F,
Kindahl H, van der Weijden G C and Taverne M A. 2003.
Cervical dilatation related to uterine electromyographic activity
and endocrinological changes during prostaglandin F(2alpha)induced parturition in cows. Biology of Reproduction 68: 536–
Future thrust areas
Whether genetic reasons underlie the predisposition of
buffalo uterus to torsion can be explored. Predicting the
chances of cervical dilatation subsequent to detorsion of
uterus needs further research. Still there is lack of an
appropriate treatment that can improve the chances of
cervical dilatation especially in cases where fetus is found
dead following detorsion of uterus. Further attempts should
be made to reduce the amount of stress inflicted upon the
bovines following occurrence of uterine torsion and during
detorsion procedures. Studies on evaluation of blood-gas and
acid-base parameters in bovines with different duration of
torsion have not been carried out. Based upon the results of
these studies, the institution of an appropriate fluid therapy
can improve the likelihood of dam survival during postdetorsion period.
CONCLUSIONS
Reassessment of various speculations made for justifying
the higher incidence of uterine torsion in bovine in
comparison to other species has produced some realistic
explanations. Small quantity of fetal fluids and associated
decrease in size of uterus at the end of pregnancy seems to
be a realistic justification for the occurrence of uterine torsion
in bovines. Destabilizing factors such as weak broad ligament
musculature, lower tone of uterine muscles, uterus outside
bursa supraomentalis along with sudden movements of the
dam and the fetus can further add up to probability of
occurrence of uterine torsion. Physiopathological alterations
suggest that torsion affected bovines are under huge stress
and require timely correction of torsion along with
29
302
GHUMAN
[Indian Journal of Animal Sciences 80 (4)
Durlach J. 1992. Magnesium in clinical practice. pp. 130–67.
Fischer-Verlag, Jena.
Durlach J and Rayssignier Y. 1980. New data on magnesium and
chronic alcoholism. Reviews in Alcohol 26: 1–26.
Dzuba L. 2000. Case report—a complicated bovine uterine torsion.
Bovine Practice 34: 58–59.
Eckersall P and Conner J. 1988. Bovine and canine acute phase
proteins. Veterinary Research Communications 12: 169–78.
Elmore R. 1993. Focus on bovine reproductive disorders:
Diagnosing and treating uterine torsion. Veterinary Medicine
88: 170–73.
El-Naggar M. 1978. Evaluation of field oriented treatment of uterine
torsion in buffaloes in Egypt. Indian Veterinary Journal 55:
61–67.
Fleming G. 1930. Fleming’s Veterinary Obstetrics. pp. 235–50.
Baillière, Tindall and Cox, London.
Frazer G S. 1988. Uterine torsion followed by jejunal incarceration
in a partially everted urinary bladder of a cow. Australian
Veterinary Journal 65: 24–25.
Frazer G, Perkins N and Constable P. 1996. Bovine uterine torsion:
164 hospital referral cases. Theriogenology 46: 739–58.
Ghuman S P S, Nanda A S, Prabhakar S and Sharma R D. 1996.
Stress related endocrine and metabolic changes in normally
calving and torsion affected buffaloes. Indian Veterinary Journal
73: 1142–46.
Ghuman S P S, Sharma R D, Prabhakar S and Nanda A S. 1997a.
Plasma cortisol and blood glucose milieu as an index of stress
in buffaloes with uterine torsion. Indian Journal of Animal
Reproduction 18: 83–84.
Ghuman S P S, Nanda A S, Sharma R D and Prabhakar S. 1997b.
Osmotic resistance of erythrocytes in uterine torsion affected
buffaloes. Indian Journal of Animal Science 67: 139–40.
Ghuman S P S, Nanda A S, Sharma R D and Prabhakar S. 1997c.
The effect of tranquilizers on stress response in buffaloes
affected with uterine torsion. Indian Veterinary Journal 74:
1034–36.
Ghuman S P S, Sharma R D, Nanda A S and Prabhakar S. 1998a.
Effect of certain clinical procedures and stressors on plasma
cortisol milieu in dystocia affected buffaloes. Buffalo Journal
1: 71–79.
Ghuman S P S, Sharma R D, Mirakhur K K, Prabhakar S and Nanda
A S. 1998b. Acid base status and blood gas tensions of normally
calving and uterine torsion affected buffaloes. Buffalo Journal
14: 355–60.
Ghuman S P S, Ajeet Kumar and Honparkhe M. 2009. A preliminary
study on plasma haptoglobin concentrations in buffaloes
following spontaneous or assisted delivery. Buffalo Bulletin 28:
127–30.
Gloor H. 1973. Etiology of uterine torsion in the cow. Schweizer
Archiv für Tierheilkunde 115: 74–80.
Hantschmann B. 2004. Uterine torsion corrected by conservative
method in cattle from the perspective of the practicing
veterinarian. Tierärztliche Umschau 59: 350–52.
Henderson R A. 1982. Controlling peritoneal adhesions. Veterinary
Surgery 11: 30–33.
Hobbs B A and Parker R F. 1990. Uterine torsion associated with
either hydrometra or endometritis in two rabbits. Laboratory
Animal Science 40: 535–36
Honparkhe M, Ghuman S P S, Ajeet Kumar, Sood N K, Gupta K
and Ahuja C S. 2009. Cervical massage with sodium carboxy
42.
Brown A J. 1974. Torsion of the gravid uterus in a bitch. Veterinary
Record 94: 202.
Bugalia N S, Phogat J B and Umed Singh. 1995. Peripheral plasma
progesterone and oestradiol–17ß profiles in buffaloes affected
with uterine torsion. Buffalo Journal 12: 353–56.
Cebra C K, Cebra M L, Garry F B and Johnson L W. 1997. Surgical
and nonsurgical correction of uterine torsion in new world
camelids: 20 cases (1990–1996). Journal of American Veterinary
Medical Association 211: 600–02.
Cergolj M, Tomaskovic A and Makek Z. 1999. Diagnosis and
treatment of uterine torsion during pregnancy in cattle.
Tierärztliche Umschau 54: 79–83.
Chaney K P, Holcombe S J, LeBlanc M L, Hauptman J G,
Embertson R M, Eric Mueller P O and Beard W L. 2007. The
effect of uterine torsion on mare and foal survival: A
retrospective study 1985–2005. Equine Veterinary Journal 39:
33–36.
Cochran M L and Cochran J. 1983 Ovariohysterectomy in
complicated bovine cesarean sections. Journal of American
Veterinary Medical Association 183: 120–21.
DeBruin M G. 1910. Abnormal parturition—dystokia. Bovine
Obstetrics. pp 144–70. (Ed.) Wyman W E A. W R Jenkins Co,
New York.
Desliens L. 1967. Torsion of the uterus in the cow—etiology and
practical considerations. Bulletin de l’Académie vétérinaire de
France 40: 147–56.
Dhaliwal G S, Vashista N K and Sharma R D. 1986. Uterine torsion
in a goat—a case report. Indian Journal of Animal Reproduction
7: 90–91.
Dhaliwal G S, Sharma R D, Singla V K and Prabhakar S. 1988.
Torsion of didelphic uterus in a cow. Indian Journal of Animal
Reproduction 9: 71–72.
Dhaliwal G S, Prabhakar S and Sharma R D. 1989. A note on
recurrence of uterine torsion in a cow with didelphic uterus.
Indian Journal of Animal Reproduction 10: 171–72.
Dhaliwal G S, Prabhakar S, Singh P and Sharma R D. 1991. Effects
of injudicious handling of uterine torsion on survival rate of
dam in buffaloes (Bubalis bubalis). Pakistan Veterinary Journal
11: 117–19.
Dhaliwal G S, Prabhakar S and Sharma R D. 1992. Intestinal
obstruction in association with torsion of uterus in a buffalo.
Pakistan Veterinary Journal 12: 42–43.
Dhaliwal G S, Prabhakar S and Sharma R D. 1993. Torsion of
pregnant horn in a cow—A case report. Indian Journal of Animal
Reproduction 14: 129.
Dhindsa S S, Gandotra V K, Nanda A S, Singh S P S, Jindal R and
Brar P S. 2005. Effect of duration of dystocia on
haematobiochemical alterations in buffaloes. Indian Journal of
Animal Reproduction 26: 117–19.
Dhindsa S S, Gandotra V K and Prabhakar S. 2007. Plasma and
blood volume in dystocia affected buffaloes. Indian Journal of
Animal Sciences 77: 837–39.
Drost M. 2007. Complications during gestation in the cow.
Theriogenology 68: 487–91
Dufty J H. 1973. Clinical studies on bovine parturition—foetal
aspects. Australian Veterinary Journal 49: 177–82.
Duncanson G. 1985. Uterine torsion in cattle—a review of 18 severe
cases. British cattle Veterinary Association Proceedings. pp.
133–35.
30
April 2010]
UTERINE TORSION IN BOVINES
303
1021–23.
Kumar A, Ghuman S P S and Honparkhe M 2009b. Effect of oral
fluid therapy in combination with intravenous dextran–40 and
hypertonic saline solution on plasma and blood volume in
dystocia affected buffaloes. Indian Journal of Animal Science
79: 479–82.
Kunstýr I. 1981. Torsion of the uterus and the stomach in guinea
pigs. Z Versuchstierkd 23: 67–69.
Laven R and Howe M. 2005. Uterine torsion in cattle in the UK.
Veterinary Record 157: 96.
Luthra R A and Khar S K. 1999. Survival rate following different
regimes of treatment in cases of uterine torsion in buffaloes.
Indian Veterinary Journal 76: 399–402.
Malhotra P. 1990. ‘Some studies on the cervical changes in the
uterine torsion cases with special reference to cervical filtration
in buffaloes.’ M.V.Sc. Thesis, Punjab Agriculture University,
Ludhiana, India.
Malhotra P, Sharma R D and Singla V K. 1993. Haematological
studies in periparturient and with uterine torsion buffaloes.
Indian Veterinary Medical Journal 17: 111–14.
Malhotra P, Sharma R D, Singla V K and Pangawkar G R. 1994.
Effect of hyaluronidase and PGF2a on the dilatation of cervix
in buffaloes suffering from uterine torsion. Indian Veterinary
Medical Journal 18: 46–47.
Malik J S. 1986. ‘Histochemical and histopathological studies on
uterine torsin in buffaloes (Bubalus bubalis).’ M.V.Sc. Thesis,
Haryana Agriculture University, Hisar, India
Manju T S, Verma S K, Gupta R C, Manadskhot V M and
Krishnaswamy A. 1985. Profiles of some plasma biochemical
constituents associated with uterine torsion and following its
correction by laprohysterotomy in buffaloes. Indian Journal of
Animal Reproduction 6: 57–61.
Mannari M N, Tadkod D M and Parsania R R. 1982. Partial
resection of the uterus in she-buffalo. Indian Journal of
Veterinary Surgery 3: 103–05.
Manning J, Marsh P, Marshall F and McCorkell R 1982. Bovine
uterine torsion: a review illustrated by cases from the Western
College of Veterinary Medicine, Large animal clinic. Bovine
Practice 17: 94–98.
Matharu S S. 1997. ‘Endocrinological and histopathological
investigations on corpus luteum and uterus of buffaloes affected
with uterine torsion.’ M.V.Sc. Thesis, Punjab Agriculture
University, Ludhiana, India.
Matharu S S and Prabhakar S. 2001. Clinical observations and
success of treatment of uterine torsion in buffaloes. Indian
Journal of Animal Reproduction 22: 45–48.
Matthijsen H F and Putker P H. 1989. Postpartum torsion of the
right uterus horn in a cow. Tijdschrift voor diergeneeskunde
114: 17–19.
McEntee K. 1990. The uterus: degenerative and inflammatory
lesions. In: Reproductive Pathology of Domestic Animals. pp.
143–66. (Ed.) McEntee K. NY Academic Press, New York.
Menard L. 1994. The use of clenbuterol in large animal obstetrics:
Manual correction of bovine dystocias. Canadian Veterinary
Journal 35: 289–92.
Menard L and Diaz C S. 1987. The use of clenbuterol for the
management of large animal dystocias: Surgical corrections in
the cow and ewe. Canadian Veterinary Journal 28: 585–90.
Mochow R and Olds D. 1966. Effect of age and number of calvings
on histological characteristics of the bovine uterus. Journal of
methyl cellulose for achieving complete cervical dilatation in
successfully detorted uterine torsion affected buffaloes. Indian
Journal of Animal Science 79: 26–29.
Hopkins S M, Althouse G C, Jackson L L and Evans L E. 1991
Surgical treatment of uterine torsion in a llama (Lama glama).
Cornell Veterinarian 81: 425–28.
Horadagoda N, Knox K, Gibbs H, Reid W, Horadagoda A, Edwards
S and Eckersall P. 1999. Acute phase proteins in cattle:
discrimination between acute and chronic inflammation.
Veterinary Record 144: 437–41.
Hussein H and Abd Ellah M R. 2008. Effects of dystocia, fetotomy
and caesarian sections on the liver enzymes activities and
concentrations of some serum biochemical parameters in dairy
cattle. Animal Reproduction Science 105: 384–91.
Ijaz A and Talafha A Q. 1999. Torsion of the uterus in an awassi
ewe. Australian Veterinary Journal 77: 652–53.
Ishaque S M, Khan A A, Praced M M, Singh J K and Narayan K G.
1960. Successful caesarean section in a cow with torsion of
uterus. Indian Veterinary Journal 37: 321–25.
Jadhao P T. Markandeya N M and Rautmare S S. 1993. Uterine
torsion along with haemoperitoneum in a buffalo. Indian Journal
of Animal Reproduction 14: 59.
Jose V M, Neelakanta Iyer C P, Madhavan E. 1983. Positional and
postural changes of the foetus prior to and during parturition in
cattle. Aust ralianVeterinary Journal 60: 148–49.
Jung C, Hospes R, Bostedt H and Litzke L F. 2008. Surgical
treatment of uterine torsion using a ventral midline laparotomy
in 19 mares. Australian Veterinary Journal 86: 272–76.
Kaur T, Singh B, Kaur T and Singh B. 1993. Reproductive disorders
in buffaloes: haemato-biochemical studies. Indian Journal of
Veterinary pathology 17: 118–21.
Khatri C K, Khar D K, Singh J and Luthra R A. 1986. Changes in
biochemical blood constituents of buffaloes with uterine torsion
and the effect of caesarean section and certain post-operative
therapeutic measures. Archiv für experimentelle
Veterinärmedizin 40: 461–68.
Kochhar H P S, Prabhakar S, Singh Prakash, Nanda A S and Singh
P. 1994. Rotation of urinary bladder with torsion of uterus in a
buffalo. Indian Veterinary Journal 71: 388–89.
Kolb E. 1985. Recent insights on the biochemical metabolism of
the magnesium in ruminants as well as the emergence and
treatment of hypomagnesemia with particular attention to the
preparation for parturition. Mh Veterinary Medicine 40: 615–
19.
Kraft W and Dürr U. 2005. Clinical laboratory diagnostics in
veterinary medicine, pp. 6. Aufl. Schattauer, Stuttgart, New
York.
Kruse M. 2004. ‘Genetic and environmental influences on the
occurrence of torsio uteri in dairy cows.’ Thesis, Tierärztliche
Hochschule, Hannover.
Kuhad K S, Sharma D K, Singh Prem, Nagi R S, Bugalia N S,
Khanna B M and Singh P. 1996. Serum transaminases in
prolonged cases of uterine torsion in buffaloes. Indian Journal
of Veterinary Surgery 17: 115.
Kuller H. 1960. Casuistic contributions to the surgical treatment
of torsio uteri in cattle and horses. Mh Veterinary Medicine 2:
32–5.
Kumar A, Ghuman S P S, Ahuja C S and Honparkhe M. 2009a.
Effect of oral fluid therapy on endocrine and biochemical status
of dystocia affected buffaloes. Indian Veterinary Journal 86:
31
304
GHUMAN
[Indian Journal of Animal Sciences 80 (4)
torsion. Indian Journal of Animal Sciences 77: 956–59.
Prasad S, Rohit K and Maurya S N. 2000. Efficacy of
laparohysterotomy and rolling of dam to treat uterine torsion in
buffaloes. Indian Veterinary Journal 77: 784–86.
Randt A. 1993. ‘Twins in cattle from obstetric perspective.’
Dissertation, University of Leipzig.
Roberts S J. 1986. Diagnosis and treatment of the various types of
dystocia. Veterinary Obstetrics and Genital Diseases
(Theriogenology). pp. 213–17, 230–33, 337–43, 357–59.
Woodstock, Edwards Brothers Inc.
Roberts S J and Hillman R B. 1973. An improved technique for the
relief of bovine uterine torsion. Cornell Veterinarian 63: 111–
16.
Rowlands G J, Manston R, Sturk A J, Bussell A M, Collis K A and
Collis S C. 1980. Studies on some blood constituents in pregnant
buffaloes. Journal of Agriculture Science Cambridge 94: 517–
27.
Ruegg P L.1988. Uterine torsion of 720 degrees in a midgestation
cow. Journal of American Veterinary Medical Association 192:
207–08.
Rükgauer M. 2005. Magnesium. Laboratory and diagnostics,
indication and evaluation of laboratory results for medical
diagnosis. 6th edn, pp. 492–94. TH-Books Verlagsgesellschaft
mbH, Frankfurt, Germany.
Rüsse M. 1963. ‘The birth sequence in cattle-an examination of
the functional activity of the normal birth.’ Dissertation,
University of Munich.
Rüsse I and Grunert E. 1993. Gravid genitalia. Animal obstetrics.
pp. 58–61. (Eds) Richter J, Götze R, Grunert E and Arbeiter K.
Parey, Berlin.
Samad H A, Ali C S and Ahmad K M. 1981. Schaffer’s method for
the correction of uterine torsion in the buffalo. Pakistan
Veterinary Journal 1: 25–27.
Sathya A, Prabhakar S and Ghuman S P S. 2005. Effects of
dexamethasone administration on cortisol concentration and
biochemical profile in buffaloes suffering from dystocia. Animal
Reproduction 2: 233–39.
Sathya A, Prabhakar S, Sangha S P S and Ghuman S P S. 2007.
Vitamin E and selenium supplementation reduces plasma
cortisol and oxidative stress in dystocia-affected buffaloes.
Veterinary Research Communications 31: 809–18.
Schaffer W. 1946. Schweizer Arch. Tierheilk 88: 44.
Schönfelder A, Richter A and Sobiraj A. 2003. Prognostic indicators
for conservatively incorrectable uterine torsion in the cow.
Tierärztliche Umschau 58: 512–17.
Schönfelder A and Hasenclever D. 2005. Cost-utility analysis of
surgical obstetrics in bovines with torsio uteri intra partum.
Berliner und MünchenerTierärztliche Wochenschrift 118: 490–
94.
Schönfelder A and Sobiraj A. 2005. Etiology of torsio uteri in
cattle—a review. Schweizer Archiv für Tierheilkunde 147: 397–
402.
Schönfelder A, Richter A and Sobiraj A. 2005a. Stages of surgically
incorrectable uterine torsion of cows: associations with clinical
progress. Tierärztliche Umschau 60: 199–205.
Schönfelder A, Richter A and Sobiraj A. 2005b. Doppler ultrasound
studies of the uterine arteries in cows with spontaneous
parturition and with uterine torsion intra partum. Wiener
Tierärztliche Monatsschrift 92: 74–80.
Schönfelder A, Schrödl W, Krüger M, Richter A and Sobiraj A.
Dairy Science 642–46.
Moore A A and Richardson G F. 1995. Uterine torsion and fetal
mummification in a cow. Canadian Veterinary Journal 36: 705–
06.
Morten D H and Cox J E. 1968. Bovine dystocia. A survey of 200
cases met within general practice. Veterinary Record 83: 530–
37.
Murty K K, Prasad V and Murty P R. 1999. Clinical observations
on uterine torsion in buffaloes. Indian Veterinary Journal 76:
643–45.
Nanda A S and Sharma R D. 1986. Studies on serum progesterone
levels in relation to occurrence of uterine torsion in buffaloes
(Bubalus bubalis). Theriogenology 26: 383–89.
Nanda A S, Sharma R D and Nowshehri M A. 1991. Outcome of
various regimes of treatment of uterine torsion in buffaloes.
Indian Journal of Animal Reproduction 12: 197–200.
Noakes D E, Parkinson D J and England G C W. 2001. Maternal
dystocias. Arthurs veterinary reproduction and obstetrics, (Ed.)
Noakes D E. Saunders Harcourt, India.
Pattabiraman S R and Pandit R K. 1980. Studies on haematological
and biochemical constituents in blood of buffaloes with uterine
torsion. Cherion 9: 338–40.
Pattabiraman S R, Singh J, Rathor S S and Dhablania D C. 1979.
Non-surgical method of correction of bovine uterine torsion—
a clinical analysis. Indian Veterinary Journal 56: 424–28.
Pearson H. 1971. Uterine Torsion in Cattle: a review of 168 cases.
Veterinary Record 89: 597–603.
Pearson H and Denny H R. 1975. Spontaneous uterine rupture in
cattle—a review of 26 cases. Veterinary Record 97: 240–44.
Pearson E G. 1990. Diseases of the hepatobiliary system. Large
Animal Internal Medicine. pp. 837. (Ed.) Smith B P. The C V
Mosby Co., St. Louis.
Penny C D.1999. Uterine torsion of 540° in a mid-gestation cow.
Veterinary Record 145: 230.
Phogat J B, Bugalia N S, Verma S K and Singh Inderjeet. 1991.
Plasma cholesterol and haemogram in buffaloes affected with
uterine torsion. Indian Veterinary Journal 68: 1048–52.
Pickel M, Dirksen G and Grunert E.1990. Uterine perforation
following an experiment in the correction of a uterine torsion
in the 5th month of pregnancy. Tierarztliche Praxis 18: 469–
72.
Potjans J. 1988. ‘Contribution to the etiology of torsio uteri in
cattle.’ Dissertation, University of Munich.
Prabhakar S, Singh P, Nanda A S, Sharma R D and Singh P. 1994.
Clinico-obstetrical observations on uterine torsion in bovines.
Indian Veterinary Journal 71: 822–24.
Prabhakar S, Dhaliwal G S, Sharma R D and Nanda A S. 1995a.
Success of treatment in relation to milk letdown and pelvic
relaxation in bovines with torsion of uterus. Indian Journal of
Dairy Science 48: 323–25.
Prabhakar S, Kochhar H P S and Nanda A S. 1995b. Torsion of one
uterine horn in a primigravid Great Dane Bitch. Indian
Veterinary Journal 72: 416–17.
Prabhakar S, Dhaliwal G S, Sharma R D and Nanda A S. 1997.
Success of treatment and dam survival in bovines with precervical uterine torsion. Indian Journal of Animal Reproduction
18: 121–23.
Prabhakar S, Matharu S S, Gandotra V K and Brar R S. 2007.
Corpus luteum does not contribute to higher progesterone
concentration around parturition in buffaloes with uterine
32
April 2010]
UTERINE TORSION IN BOVINES
305
buffaloes—Modification of Schaffer’s method. Indian Journal
of Animal Reproduction 17: 33–34.
Singh M P, Prasad J K, Das A K and Prasad S. 2006. Subtotal
hysterectomy of ischemic uterus during caesarean section in
buffaloes. Indian Journal of Animal Reproduction 27: 89–90.
Singla V K. 1988. ‘Some studies on uterine torsion in buffaloes.’
M.V.Sc. Thesis, Punjab Agriculture University, Ludhiana, India.
Singla V K, Roy K S, Sharma R D, Gandotra V K and Dhaliwal G
S. 1989. Histopathological studies of cervix and vagina in
buffaloes suffering from uterine torsion. Proceedings of VIIIth
National symposium of Indian Society for the Study of Animal
Reproduction, Anand, Gujrat, India.
Singla V K, Sharma R D, Dhaliwal G S, Gandotora V K and
Prabhakar S. 1992a. Uterine torsion in cows—an analysis of
34 cases. Indian Veterinary Journal 69: 281–82.
Singla V K, Sharma R D, Gandotora V K and Prabhakar S. 1992b.
Changes in certain serum biochemical constituents in buffaloes
with uterine torsion. Indian Veterinary Journal 69: 805–07.
Sloss V and Dufty J H. 1980. Obstetrical physiology. Obstetrical
pathology. Obstetrical procedures. Handbook of Bovine
Obstetrics. pp. 39, 105, 108–11, 180–83. (Eds) Sloss V and
Dufiy J H. Williams and Wilkins, Baltimore.
Srinivas M, Sreenu M, Lakshmi Rani N, Subramanyam Naidu K
and Devi Prasad V. 2007. Studies on dystocia in graded murrah
buffaloes: a retrospective study. Buffalo Bulletin 26: 40–45.
Tamm T. 1997. ‘Studies on bovine uterine torsion.’ Dissertation,
Tierärztliche Hochschule Hannover.
Taylor W A. 1942. Torsion of the uterus: with special reference to
epidural anaesthesia. Canadian Journal of Comparative
Medicine: Veterinary Science 6: 102–06.
Thilagar S, Yew Y C, Dhaliwal G K, Toh I and Tong L L.2005.
Uterine horn torsion in a pregnant cat. Veterinary Record 157:
558–60.
Thomas L. 2005. Labor and diagnosis: indication and evaluation
of laboratory results for medical diagnosis. 6th edn, pp. 450.
TH-Books Verlagsgesellschaft mbH, Frankfurt.
Uray H. 1956. The bimanual correction of torsio uteri. Wiener
Tierärztliche Monatsschrift 43: 610–12.
Vasishta N K. 1983. ‘Torsion of uterus in buffaloes in relation to
incidence, etiology and treatment.’ M.V.Sc. Thesis, Punjab
Agriculture University, Ludhiana, India.
Wardrope D D and Boyes G W. 2002. Uterine torsion in twin
pregnancies in dairy cattle. Veterinary Record 150: 56.
Willetto C E, Morin D E and Constable P D. 1996. Uterine torsion
in three post parturient dairy cows. Agriculture Practice 17:
23–27.
Williams W L. 1948. The basic causes of dystocia. Torsion of the
uterus (Uterine volvulus). Veterinary Obstetrics. pp. 196–199,
295–307. (Ed.) Williams W L, Mass, Ethel Williams Plimpton.
Worcester.
Wright J G. 1958. Bovine dystocia. Veterinary Record 90: 347–56.
Zerobin K and Kundig H. 1980. The control of myometrial
functions during parturition with a beta–2 mimetic compound,
Planipart®. Theriogenology 14: 21–35.
Zimmermann K. 1950. About uterine torsion. Wiener Tierärztliche
Monatsschrift 37: 130–34.
2005c. The change of acute phase protein haptoglobin during
regular parturition and caesarean section with or without torsio
uteri intra partum in cattle. Berliner und Münchener
Tierärztliche Wochenschrift 118: 240–46.
Schönfelder A and Sobiraj A. 2006a. Cesarean section and
overiohysterectomy after severe uterine torsion in four cows.
Veterinary Surgery 35: 206–10.
Schönfelder A and Sobiraj A. 2006b. Complications during surgical
treatment of torsio uteri intra partum in cattle and their handling.
Wiener Tierärztliche Monatsschrift 93: 86–89.
Schönfelder A, Schrödl W, Krüger M, Richter A and Sobiraj A.
2006. Plasma haptoglobin concentration in bovine with
surgically corrected torsio uteri intra partum. Berliner und
MünchenerTierärztliche Wochenschrift 119: 81–85.
Schönfelder A, Fürll M, Richter A and Sobiraj A. 2007a. Enzyme
activities and substrate concentrations in blood plasma of
bovines with surgically treated uterine torsion intra partum.
Tierarztliche Praxis 35(G): 101–10.
Schönfelder A, Schoon H-A and Sobiraj A. 2007b. Macroscopical
and histological findings on the uterus in cattle with surgically
treated uterine torsion. Tierarztliche Praxis 35(G): 325–34
Schönfelder A, Fürll M, Richter A and Sobiraj A. 2007c. Dynamic
of the electrolyte concentration in blood plasma of bovines with
surgical treated uterine torsion during parturition. Tierarztliche
Praxis 35(G): 414–21.
Schulz J, Beuche W and Elze K. 1975. Torsio uteri in cattle. Mh
Veterinary Medicine 30: 659–65.
Sell F, Eulenberger K and Schulz J. 1990. Use of clenbuterol to
control dystocia of cattle. Mh Veterinary Medicine 45: 413–17.
Sharma M and Singh V K. 1984. Cervix-hyalse alone and in
combination with other drugs. Journal of Obstetrics and
Gynaecology of India 34: 1023–31.
Sharma S P, Agrawal K B P and Singh D P. 1995. Torsion of gravid
uterus and laparohysterektomy in bovine—a report on 72 clinical
cases. Indian Veterinary Journal 72: 1180–82.
Siddiquee G M. 1988. ‘Studies on etiopathology and therapeutics
of uterine torsion in buffaloes.’ Thesis, Punjab Agriculture
University, Ludhiana, India.
Siddiquee G M, Sharma R D and Sobti V K. 1992. Changes in the
electrocardiogram and cardiac vectors following induction
uterine torsion in buffaloes (Bubalus bubalis). Proceedings of
National Symposium and Xth Annual Convention of Indian
Society for the Study of Animal Reproduction, Madras.
Singh J and Dhaliwal G S. 1998. A retrospective study on
survivability and fertility following caesarean section in bovines.
Indian Journal of Animal Reproduction 19: 21–23.
Singh J, Nauriyal D C, Pattabiraman S R and Sharma R D. 1979.
Uterine torsion at mid-gestation in a buffalo. Indian Veterinary
Journal 56: 700.
Singh M. 1991a. ‘Studies on changes in blood and ruminal functions
in buffaloes with dystocia.’ Thesis, Punjab Agriculture
University, Ludhiana, India.
Singh P. 1991b. ‘Studies on broad ligament in relation to uterine
torsion in buffaloes.’ Thesis, Punjab Agriculture University,
Ludhiana, India.
Singh P and Nanda A S. 1996. Treatment of uterine torsion in
33
Indian Journal of Animal Sciences 80 (4): 306–312, April 2010
Insulin-like growth factor-I and -II in buffalo ovary: mRNA
expressions and partial sequences
R DEV1, M K SHARMA2 and DHEER SINGH3
National Dairy Research Institute, Karnal, Haryana 132 001 India
Received: 5 September 2008; Accepted: 17 October 2009
ABSTRACT
In the present investigation, expressions of mRNAs encoding IGF-I and IGF-II were detected in intact follicles of
different sizes, granulosa cells, corpus luteum (CL) and corpus albicans (CA) from buffalo ovary, using semi-quantitative
RT-PCR technique. The effect of FSH and LH on expression of mRNAs encoding IGFs and sequencing of partial IGFI and IGF-II cDNAs were studied. The results for expression of mRNAs encoding IGF-I and IGF-II in small (< 5 mm),
medium (6–9 mm) and large (> 10 mm) intact follicles and granulosa cells revealed significant increase in mRNAs
expression with increase in follicle size. During luteal phase, the presence of expression of mRNAs encoding IGFs in
corpus luteum (CL) and corpus albicans (CA) indicated their role in growth, differentiation and regression of luteal
tissues. The treatment of granulosa cells culture with varying doses of FSH, did not show any stimulatory effect on
expression of mRNAs encoding IGF-I and IGF-II. However, LH induced significantly IGF-I mRNA expression. The
partial cDNA products of IGF-I and IGF-II, were sequenced. The blasting of IGF-I sequence (196 nucleotides) with that
of other species exhibited the homology in the range of 93–99% whereas it was in the range of 88–100% for IGF-II
sequence (154 nucleotides). The results showed that IGF-I and IGF-II play important role during follicular and luteal
phases of buffalo ovary.
Key words: IGFs, Insulin like growth factor, mRNA Expression, Ovary, Partial cDNA sequences
et al. 2000). The expression of mRNAs encoding IGF-I and
-II in ovarian follicles is developmentally regulated in a
species specific manner (Armsrong et al. 1998). Zhou et al.
(1997), suggested that expression of IGF-I mRNA is FSH
independent. However, bovine (Spicer and Chamberlain
2000) and ovine (Khalid et al. 2000) granulosa cells during
culture, exhibited increased production of IGF-I in response
to FSH. Hirakawa et al. (1999) reported that LH enhances
IGF-I mRNA expression. In view of the importance of these
growth factors and no information on their localization and
expression in buffalo ovary, the present investigation was
envisaged.
In mammalian ovary, the insulin-like growth factor-I and
–II (IGF-I and -II) regulate proliferation and differentiation
of granulosa cells in an autocrine and/or paracrine fashion
synergizing with gonadotropins. The IGFs are mitogenic
polypeptides that stimulate cellular proliferation and
differentiation (Jones and Clemmons 1995). The IGFs exert
their physiological actions by interacting with specific cell
surface membrane receptors, called type I (IGF-IR) and type
II (IGF-IIR) receptors (Nissley and Lopaczynski 1991).
Although IGF-IIR is important for IGF-II internalization and
degradation, it is not much clear whether this receptor actively
mediates IGF-II signaling. In most instances, the metabolic
and growth promoting effects of IGF-II appear to be mediated
by IGF-IR (Willis et al. 1998) or insulin receptor. Whether
IGF-I or -II is primary stimulus to the ovary, may depend on
the species since granulosa cells of human follicles contain
IGF-II mRNA and not IGF-I mRNA (Zhou and Bondy 1993)
whereas bovine granulosa cells contained both (Armsrong
MATERIALS AND METHODS
Eagle’s minimum essential medium (MEM) with HEPES,
fetal bovine serum (FBS), diethylpyrocarbonate (DEPC), TRI
reagent, agarose, chloroform, Trypan blue and ethidium
bromide were procured commercially.
Collection of buffalo ovaries: Buffalo ovaries were
collected in sterile normal saline containing antibiotics
(penicillin 1000 U/ml; streptomycin, 100 μg/ml), from New
Delhi abattoir. These were further washed thoroughly with
normal saline and extra tissues were removed.
Present address: 1House No.: 795, First Floor, Sector-5, Gurgaon
122 001 (e-mail: rishabh_ndri@rediffmail.com)
2, 3Molecular Endocrinology Laboratory, Animal Biochemistry
Division.
34
April 2010]
INSULIN-LIKE GROWTH FACTORS IN BUFFALO OVARY
Isolation of follicles, luteal tissues and granulosa cells:
The non-atretic follicles, based on their morphological
appearances, were isolated mechanically (Moore et al. 1978)
with forcep and scissor asceptically and were pooled based
on the size as small (≥ 5 mm), medium (6–9 mm) and large
(≥ 10 mm), representing different stages of development.
Post-ovulatory structures such as corpus luteum and corpus
albicans were isolated based on morphological appearance.
The granulosa cells were aspirated from small, medium and
large follicles, separately with sterile syringes. The follicular
fluid containing granulosa cells was spinned at 2000 rpm
for 5 min to get pellet of cells for RNA isolation and cell
culture.
Isolation of total RNA: Total RNA was isolated using TRI
reagent by modification of original method of Chomczynski
and Sacchi (1987). TRI reagent (1 ml) was added to granulosa
cell pellet obtained from 2 ml of follicular fluid. Granulosa
cells grown in monolayer culture were lysed directly in
culture dish with 1 ml of TRI reagent/10 cm2 of culture dish
after removal of spent media. Luteal tissues (100 mg) were
immersed in 1 ml of TRI reagent and homogenized. Similarly,
intact 7–8 small, 3–4 medium and 1–2 large size follicles
were homogenized, separately in 1 ml of TRI reagent. After
5 min, the homogenate was centrifuged at 12879 g for 5 min/
4°C to remove debris. The supernatant was transferred to
fresh Eppendorf tube and 0.2 ml chloroform/ml of TRI
reagent was added and shaken vigorously for 15 sec. The
content was kept at room temperature for 15 min and spinned
at 12879 g/15 min/4°C. The aqueous phase was transferred
carefully in fresh Eppendorf tube. RNA was precipitated by
adding isopropanol (0.5 ml/1 ml TRI reagent). After 10 min
at room temperature, the content was centrifuged at 12879
g/15 min/4°C. The pellet so obtained was washed with 1 ml
of 75% ethanol and RNA was collected at 5031 g/5 min/
4°C. The purity of RNA was determined by finding A260/
A280 ratio which was in the range of 1.80–2.00. The integrity
of RNA was evaluated (result not shown) by agarose (1%)
gel electrophoresis, after its denaturation with glyoxal and
dimethylsulfoxide (McMaster and Carmichael 1977).
Reverse transcription-polymerase chain reaction (RTPCR): The RT-PCR protocol was followed according to MMuLV RT-PCR kit with some modifications. First strand
DNA synthesis was done in sterile RNase-free PCR tube in
a 20 μl volume. RNA (1μg) was diluted to 9.5 μl with
nuclease-free water. After adding 0.5 μl of random hexamer
(1μg/μl), a brief spin was given and the content was incubated
at 65°C for 30 min in thermocycler and then kept at room
temperature for 2 min. The RT reaction was carried out by
adding nuclease-free water, 1.5 μl; RT buffer (5X), 4 μl;
dNTP mix (30 mM), 2 μl ; DTT (0.1 M), 1 μl; RNase inhibitor
(10 U/μl), 1 μl and M-MuLV RT enzyme (50 U/μl), 0.5 μl.
The control (RT-) contained 0.5 μl nuclease-free water in
place of enzyme. After brief spin of content, the tubes were
placed in thermocycler and reaction was carried out at 37°C
307
for 1 hr.; 95°C for 5 min and 4°C with pause. The
amplification of RT-product was done in PCR tubes by adding
PCR assay buffer (10X), 5 μl; dNTP mix (30 mM), 1 μl;
gene specific primers (Table 1), 1 μl (final concentration 0.2
μM); cDNA product, 2 μl and Taq DNA polymerase (1 U/
μl), 1 μl. Total volume was made to 50 μl with nuclease-free
water. After brief spin, the PCR cycles were followed as 95°C
for 3 min (inhibition of RT enzyme); 95°C for 1 min
(denaturation of RT product); 55°C (annealing); 72°C for 1
min (extension); 72°C for 4 min (final extension) and 4°C
pause. During PCR with primers for receptors, the annealing
temperature was 60°C for 1 min. The performance of PCR
reaction largely depends on concentrations of primers and
MgCl2 and cycle numbers. Therefore, these parameters were
optimized for each target and control gene.
Analysis of PCR products: The PCR product (7 μl) mixed
with 1.4 μl of 6X gel loading dye was loaded on agaroge
(2%) gel. The samples were run in mini-submarine gel
electrophoresis system in approximately 250 ml of TBE
buffer (1X) at 100 V for 1 hr. The gel was stained with
ethidium bromide (0.5 μg/ml). The amplified products were
visualized on UV-transilluminator. The intensity of individual
bands was measured by densitometry using an image analysis
programme (Quantitation 1). The results were expressed as
ratio obtained by dividing the band intensity of target gene
with intensity of control gene. The statistical analyses for
triplicate observations were carried out by ANOVA followed
by least significance difference (LSD).
Granulosa cell culture: The granulosa cells were cultured
as per Blasubramanian et al.(1997). Approximately 8×106
viable granulosa cells were plated in 6–well culture plate
using bicarbonate buffered MEM (2 ml/well) supplemented
with antibiotics (penicillin, 1000 U/ml and streptomycin, 100
μg/ml) and fetal bovine serum (3%) to permit cell anchorage.
The cells were incubated at 37 °C in CO2 incubator. After
24 h, the cells were observed under microscope for
attachment and viability. The spent media was aspirated and
cells were washed with plain media. The cells were treated
with different concentrations of FSH and LH contained in
plain MEM. For each concentration (0, 5, 25, 50, 100 ng/
well), 3 wells were used for treatment, and similar number
of wells was used as control having plain MEM. After 24 h
of further culturing of cells, spent media was removed and
RNA was isolated from these monolayer cells as described
earlier.
Purification of PCR products, cloning and sequencing:
The standard protocols for purification and cloning were used
as provided with kits. The PCR products were purified using
kit. The purified PCR product for IGF-I was cloned using
TA cloning kit dual promoter. The INVαF’ cells having pCRII
vector containing insert were further grown overnight and
plasmid was isolated. Restriction digestion was done to
confirm the presence of insert in the vector. The amplification
with gene specific primers was also done, using plasmid as
35
308
2
3
4
5
6
7
8
9
10 11 12
1.05
1
0.95
bc
ab
0.9
0.85
c
b a
b
LF
CL
5
6
7
8
IGF-I
IGF-II
b
a
0.75
MF
4
IGF-I
IGF-II
a
SF
3
G3PDH
0.8
0.7
2
G3PDH
IGF-I
IGF-II
c
[Indian Journal of Animal Sciences 80 (4)
1
Ratio of target mRNA/G3PDH rnRNA
Ratio of target mRNA/G3PDH rnRNA
1
DEV ET AL.
CA
1.2
IGF-I
IGF-II
1.1
b
ab
1
0.9
a
a
c
b
0.8
0.7
0.6
GC small
GC medium
GC large
Fig. 1. Expression of mRNAs encoding IGF-I and -II in follicles
and luteal tissues from buffalo ovary. Lanes 2 and 7, small follicles;
lanes 3 and 8, medium follicles; lanes 4 and 9, large follicles; lanes
5 and 10, CL; lanes 6 and 11, CA; lanes 1 and 12, 100 bp DNA
ladder and control, respectively. Values within a column lacking a
common superscript differ significantly (P< 0.05).
Fig. 2. Expression of IGF-I and -II mRNAs in granulosa cells
isolated from different sizes of follicles from buffalo ovary. Lanes
2 and 5, GC small; lanes 3 and 6, GC medium; lanes 4 and 7, GC
large; lanes 1 and 8, 100 bp DNA ladder and control, respectively.
Values within a column lacking a common superscript differ
significantly (P< 0.05).
source of template to reconfirm presence of the insert. The
sequencing of IGF-I cloned PCR product and direct
sequencing of purified IGF-II PCR product was got done
from commercial agency.
differentiated states of follicles. There was significant
increase (P<0.05) in expression of IGF-I mRNA with increase
in size of follicles (Fig.1), being highest in large follicles,
however, its expression was significantly lower (P< 0.05) in
post-ovulatory structures as compared to that in large
follicles. The expression of IGF-II mRNA also showed
similar pattern in follicles, CL and CA.
The expression of mRNAs encoding IGF-I and -II, were
detected in relation to G3PDH as house keeping (control)
gene in granulosa cells isolated from small, medium and large
healthy follicles. Evidently, there was significant increase
(P< 0.05) in expression of mRNAs encoding IGF-I and -II
(Fig. 2) with increase in follicle size. The expression of IGFII mRNA was more than that of IGF-I in granulosa cells
from all sizes of follicles.
Effect of gonadotropins (FSH and LH) on mRNAs
encoding IGF-I and -II in cultured granulosa cells: The
granulosa cells were isolated from large healthy follicles and
cultured as described. The FSH treatment did not exhibit
(Fig. 3) any significant effect in expression of mRNAs
RESULTS AND DISCUSSION
Purity and integrity of isolated RNA: The RNA was
quantified spectrophotometrically and A260/A280 ratio was
found in the range of 1.80–2.00, an acceptable purity index,
for all RNA preparations. The integrity of RNA was evaluated
by agarose (1%) gel electrophoresis, after its denaturation
with glyoxal and dimethylsulfoxide.
Expression of mRNAs encoding insulin-like growth factors
in follicles, luteal tissues and granulosa cells from buffalo
ovary: The expressions of mRNAs encoding insulin-like
growth factors (IGF-I and IGF-II) were detected in relation
to G3PDH (control) gene, in developing healthy follicles.
The small, medium and large follicles represented the
different stages of growth and post-ovulatory structures, such
as corpus luteum (CL) and corpus albicans (CA) were
Table 1. Primers used for amplification during PCR
Name of gene
(Accession No.)
IGF-I (X15726)
IGF-II (X53553)
G–3–PDH (M17701)
Forward primer (5″–3″)
Reverse primer (5″–3″)
DNA product
size (bp)
CTGCGGGGCTGAGTTGGTCCT
TCTGTGCGGCGGGGAGCTGGT
AAACCCATCACCATCTTCCAG
CGACTTGGCGGGCTTGAGAGGC
AGTCTCCAGCAGGGCCAGGTCG
AGGGGCCATCCACAGTCTTCT
196
154
360
36
April 2010]
1
2
INSULIN-LIKE GROWTH FACTORS IN BUFFALO OVARY
3
4
5
6
7
8
1
9 10 11 12
2
3
4
5
6
309
7
8
9 10 11 12
0.95
IGF-I
IGF-I
G3PDH
IGF-II
IGF-I
IGF-II
Ratio of target mRNA/G3PDH rnRNA
Ratio of target mRNA/G3PDH rnRNA
G3PDH
IGF-II
0.9
0.85
0.8
075
0.7
Control
5
25
FSH (ng/ml)
50
100
Fig. 3. Effect of FSH treatment on expression of mRNAs
encoding IGF-I and -II in granulosa cells during culture. Lanes 2
and 7, control; lanes 3 and 8, 5 ng/ml; lanes 4 and 9, 25 ng/ml;
lanes 5 and 10, 50 ng/ml; lanes 6 and 11, 100 ng/ml; lane 1, 100 bp
DNA ladder; lane 12, RT (control).
1
IGF-I
IGF-II
0.95
0.9
0.85
0.8
0.75
ab
a
c
c
bc
0.7
0.65
0.6
Control
5
25
LH (ng/ml)
50
100
Fig. 4. Effect of LH treatment on expression of mRNAs
encoding IGF-I and -II in granulosa cells during culture. Lanes 2
and 7, control; lanes 3 and 8, 5 ng/ml; lanes 4 and 9, 25 ng/ml;
lanes 5 and 10, 50 ng/ml; lanes 6 and 11, 100 ng/ml; lane 1, 100 bp
DNA ladder; lane 12 RT (control).
encoding IGF-I and -II in cultured granulosa cells. The
relative expression of IGF-I mRNA in cultured granulosa
cells was significantly (P< 0.05) increased with increased
dose of LH treatment (Fig. 4). There was no significant
change in expression of IGF-II mRNA.
Sequencing: The presence of 212 bp band (IGF-I) and
170 bp band (IGF-II) indicated (Fig. 5A, B and Fig. 6A, B)
successful insertion of target genes in the vector. However,
little higher size of inserts resulted due to inclusion of
additional base pairs of EcoR1 restriction sites in IGF-I and
IGF-II, respectively. The presence of desired insert was also
confirmed by PCR using vector containing insert as source
of template for IGF-I and IGF-II genes. The presence of bands
at 196 bp (IGF-I, Fig. 5B) and 154 bp (IGF-II, Fig. 6B)
positions ascertained the insertion of partial genes in the
vector. The sequence of cloned partial IGF-I and -II gene
and amplified IGF-I and -II cDNA product was similar
(Fig.7A, B).
The insulin-like growth factors (IGF-I and IGF-II) and
their receptors (IGF-IR and IGF-IIR) are important
components of IGF system and play significant role in the
regulation of ovarian processes such as follicular growth,
development, differentiation, ovulation and steroidogenesis.
The localization and expression of mRNAs encoding these
molecules were found to be species-specific (Armstrong et
al. 2000). The present investigation deals with the detection
of expression of mRNAs encoding these molecules in
granulosa cells of different sizes of follicles and luteal tissues
from buffalo ovary. The relative abundance of mRNAs for
2
1
1
2
3
plasmid
fragment
IGF-I
IGF-I
(212 bp)
A
B
Fig. 5. Cloning of partial IGF-I cDNA in pCRII vector. (A)
agarose (1%) gel electrophoresis of plasmid after restriction
digestion with EcoR1. Plasmid sample was digested with EcoR1
to confirm the insertion of IGF-I cDNA (lane 2) which is of little
larger size than the normal amplified (196 bp) since it contains
part of plasmid being sites for EcoR1. (B) PCR derived confirmation
for insertion of IGF-I cDNA in plasmid. Plasmid containing insert
was used as source of template for amplification of insert. A band
corresponding to 196 bp position (lanes 2, 3) confirms the insertion
of IGF-I cDNA in plasmid. Lane 1, 100 bp DNA ladder.
37
310
DEV ET AL.
1
2
3
[Indian Journal of Animal Sciences 80 (4)
A
CCTCTGCGGGGCTGAGTTGGTGGATGCTCTCCAGTTCGTGTGCGGAGACAGGGGCT
TTTATTTCAACAAGCCCACGGGGTACGGCTCGAGCAGTCGGAGGGCGCCCCAGACA
GGAATCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTGAGGAGGCTGGAGATGTA
CTGCGCGCCTCTCAAGCCCGCCAAGTCG
B
TCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTTGTCTGTGGGGACCGCGGCT
TCTACTTCAGCCGACCATCCAGCCGCATAAACCGACGCAGCCGTGGCATCGTGGAA
GAGTGTTGCTTCCGAAGCTGCGACCTGGCCCTGCTGGAGACT
6
Plasmid
fragment
Fig. 7. Sequence of partial (A) IGF-I cDNA (196 bp) and (B)
IGF-II cDNA (154 bp) from buffalo ovary.
et al. 1992) and sheep (Khan-Dawood et al. 1994). There
was higher expression of mRNAs for IGFs during early luteal
phase followed by a decrease during mid- and late-luteal
phase (Berisha and Schams 2005).
The localization of mRNAs encoding IGFs in ovary was
reported to exhibit marked species specificity. The presence
of IGF-I mRNA expression in buffalo granulosa cells agrees
with previous reports from pig (Yuan et al. 1996) and mouse
(Wandji et al. 1998). The IGF-I mRNA could not be detected
in sheep follicles by in situ hybridization (Perks et al. 1995),
however, its expression was shown in bovine granulosa cells
(Badinga et al. 1992). The expression of IGF-I mRNA could
not be detected in bovine granulosa cells (Armstrong et al.
2000) with RT-PCR but the expression was found in buffalo
granulosa cells using same gene-specific primers at 35
amplification cycles. The expression increased as the size of
follicle increased, a pattern also reported by Yuan et al.(1998).
The expression of IGF-II mRNA was found in buffalo
granulosa cells isolated from all 3 sizes of follicles and was
similar to that in human (Zhou et al. 1993) but in contrast to
sheep granulosa cells (Perks et al. 1995). The expression of
IGF-II mRNA was detected in bovine granulosa cells, using
in situ hybridization (Yuan et al. 1998) but was not detected
in these cells by RT-PCR (Armstrong et al. 2000), instead it
was found in theca cells.
The treatment of buffalo granulosa cells with increasing
concentrations of FSH showed non-significant effect on
expression of mRNAs encoding IGF-I and IGF-II. The IGFI mRNA levels in granulosa cells were not reduced in
hypophysectomized or FSH knockout mice (Zhou et al. 1997)
suggesting that the expression of IGF-I mRNA is independent
of FSH. On the other hand, culturing of bovine (Spicer et al.
2000) and ovine (Khalid et al. 2000) granulosa cells exhibited
increased production of IGF-I in response to FSH. The
expression of pregnancy associated plasma protein-A (PAPPA) is induced by FSH in rat granulosa cells (Resnick et al.
1998), which causes a decrease in IGF binding proteins,
releasing free IGF-I. Recently, FSH was found to increase
PAPP-A mRNA expression in cultured buffalo granulosa cells
(unpublished). Thus, the higher free IGF-I production in
response to FSH might be due to induced PAPP-A making
more free IGF-I available. The LH treatment of buffalo
granulosa cells in vitro resulted in higher IGF-I mRNA
expression whereas increase in IGF-II mRNA was
nonsignificant. There was increased IGF-I mRNA expression
in cultured and LH-treated porcine granulosa cells (Hatey et
IGF-II
(170 bp)
A
B
Fig. 6. Cloning of partial IGF-II cDNA in pCRII vector. (A)
agarose (1%) gel electrophoresis of plasmid after restriction
digestion with EcoR1. Plasmid sample was digested with EcoR1
to confirm the insertion of IGF-II cDNA (lanes 2, 3) which is of
little larger size than the normal amplified (154 bp) since it contains
part of plasmid being sites for EcoR1. (B) PCR derived confirmation
for insertion of IGF-II cDNA in plasmid. Plasmid containing insert
was used as source of template for amplification of insert. A band
corresponding to 154 bp position (lanes 2–6) confirms the insertion
of IGF-II cDNA in plasmid. Lane 1, 100 bp DNA ladder.
target genes was determined by semi-quantitative RT-PCR,
which is a widely used technique (Carding et al. 1992, Ali et
al. 1997). The conditions of RT-PCR in terms of
concentrations of gene specific primers and MgCl2 and
amplification cycle number were optimized in presence of
G3PDH as housekeeping (control) gene since these
parameters influence the PCR performance.
The intact follicles exhibited increased expression of
mRNAs encoding IGF-I and IGF-II as follicular size
increased. The significantly higher expression of IGFs
mRNAs in large follicles (preovulatory) may be related with
the characteristics of dominant follicles. The kind of shift
was demonstrated (Yuan et al. 1998) in expression of IGF-I,
IGF-II and IGF binding protein–2 among dominant (greater
IGFs, near absence of IGFBP–2) and subordinate (less IGFs,
abundant IGFBP–2) follicles in bovine. The low expression
of IGF-I mRNA in bovine small follicles was revealed by in
situ study (Perks et al. 1999), whereas follicular thecal layer
in small healthy follicles exhibited intense IGF-II mRNA
expression. The significant expression of IGFs mRNAs in
buffalo follicles also supports their important role in follicular
development (Badinga et al.1992, Spicer et al. 1994).
The different growth factors, especially IGFs have definite
role in development and completion of dense network of
capillaries (angiogenesis) during follicular growth and corpus
luteum (CL) formation (Schams et al. 2001). In buffalo ovary,
the presence of expression of IGFs mRNA in CL and corpus
albicans (CA) indicated their role in growth, differentiation
and regression of corpus luteum. These results are in
agreement with studies in ovine (Perks et al. 1995) and bovine
(Woad et al. 2000). These IGFs have stimulatory effect on
progesterone secretion by luteal tissues of cattle (Sauerwein
38
April 2010]
INSULIN-LIKE GROWTH FACTORS IN BUFFALO OVARY
al. 1992) when detected using Northern hybridization. LH
increases IGF-I mRNA and IGF-I enhances the half-life of
LHR mRNA (Hirakawa et al. 1999).
The partial IGF-I (196 bp) and -II (154 bp) cDNAs from
buffalo ovary were cloned and were custom sequenced. The
blasting of IGF-I sequence with that of other species revealed
the homology with goat (97%), cattle (99%), sheep (98%),
and pig (93%). The blasting of buffalo IGF-II sequence with
that of other species, showed the homology of 100%, 100%,
92% and 88% with that of cattle, sheep, and pig, respectively.
It is concluded that a significant amount of mRNAs encoding
IGF-I and -II are significantly expressed in follicles,
granulosa cells and post-ovulatory structures from buffalo
ovary representing different stages of growth, development
and differentiation. These growth factors are major intraovarian IGF ligands and have functional importance during
follicular and luteal phases of buffalo ovary. Further attempts
are needed to find out the molecular signaling pathway
induced by IGFs, mediating ovarian steroidogenesis and antiapoptotic processes.
311
Carding SR, Lu D and Botomly K A. 1992. A polymerase chain
reaction assay for detection and quantification of cytokine gene
expression in small number of cells. Journal of Immunology
Methods 159: 277–87.
Chomczynski P and Sacchi N. 1987. Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Analytical Biochemistry 162: 156–59.
Hatey F, Langlois I, Mulsant P, Bonnet A, Benne F and Gasses F.
1992. Gonadotropins induced accumulation of insulin-like
growth factor-I mRNA in pig granulosa cells in vitro. Molecular
Cellular Endrocrinology 86: 205–11.
Hirakawa T, Minegishi T, Abe K, Kishi H, Ibuki Y and Miyamoto
K. 1999. A role of insulin-like growth factor-I in luteinizing
hormone receptor expression in granulosa cells. Endocrinology
140: 4965–71.
Jones J I and Clemmons D R. 1995. Insulin-like growth factors
and their binding proteins: biological actions. Endocrinology
Review 16: 3–34.
Khalid M, Haresign W and Luck M R. 2000. Secretion of IGF–1
by ovine granulosa cells: effects of growth hormone and follicle
stimulating hormone. Animal Reproduction Sciences 58: 261–
272.
Khan-Dawood F S, Gargiulo A R and Dawood M Y. 1994. In vitro
microdialysis of the ovine corpus luteum of pregnancy: effects
of IGF on progesterone secretion. Biology of Reproduction 51:
1299–1306.
McMaster G and Carmichael G G. 1977. Analysis of single and
double stranded nucleic acids on polyacrylamide and agarose
gel using glyoxal and acridine orange. Proceedings of National
Acadamy of Science USA 74: 4835–38.
Moore R M, Hay M F and Cran D G. 1978. Macroscopic
identification and steroidogenic function of atretic follicles in
sheep. Journal of Endocrinology 77: 309–18.
Nissley P and Lopaczynski W. 1991. Insulin-like growth factor
receptor. Growth Factors 5: 29–43.
Perks C M, Denning-Kendall P A, Gilmour R S and Wathes D C.
1995. Localization of messenger ribonucleic acid for insulinlike growth factor I (IGF I), IGF II and type I IGF receptor in
ovine ovary throughout the estrous cycle. Endocrinology 136:
5266–73.
Perks C M, Peters A R and Wathes D C. 1999. Follicular and luteal
expression of insulin-like growth factors-I and-II and type-I IGF
receptor in the bovine ovary. Journal of Reproduction and
Fertility 116: 157–65.
Resnick C E, Fielder P J, Rosenfeld R G and Adashi E Y. 1998.
Characterization and hormonal regulation of a rat ovarian
insulin-like growth factor binding protein–5 endopeptidase: an
FSH inducible granulosa cell-derived metalloprotease.
Endocrinology 139: 1249–57.
Sauerwein H, Miyamoto A, Gunther J, Meyer H H and Schams D.
1992. Binding and action of insulin-like growth factors and
insulin in bovine luteal tissue during the oestrous cycle. Journal
of Reproduction and Fertility 96: 103–15.
Schams D, Kosmann M, Berisha B, Amselgruber W M and
Miyamoto A. 2001. Stimulatory and synergistic effects of
luteinising hormone and insulin-like growth factor 1 on the
secretion of vascular endothelial growth factor and progesterone
of cultured bovine granulosa cells. Experimental Clinical
Endocrinology and Diabetes 109: 155–62.
Spicer L J, Alpizar E and Vernon R K. 1994. Insulin-like growth
ACKNOWLEDGEMENT
The authors are thankful to the Director, National Dairy
Research Institute, Karnal, for providing the necessary
facilities for carrying out this work. The financial assistance
as NDRI (ICAR) Senior Fellowships to Mr Rishabh Dev is
gratefully acknowledged. FSH and LH were generous gift
from Dr A.F. Parlow, National Hormone and Pituitary
Program, Harbour-UCLA Medical Centre, Torrance,
California.
REFERENCES
Ali S A, Sarto I and Steinkasserer A. 1997. Production for PCR
mimics for any semi- quantitative PCR application.
Biotechniques 6: 1060–62.
Armstrong D G, Baxter G, Guiterrez C G, Hogg C O, Glazyrin A L,
Campbell B K, Bramley T A and Webb R. 1998. Insulin-like
growth factor binding protein–2 and –4 messenger ribonucleic
acid expressions in bovine ovarian follicles: effect of
gonadotropins and developmental status. Endocrinology 139:
2146–54.
Armstrong D G, Gutierrez C G, Baxter G, Glazyrin A L, Mann G E,
Wood K J, Hogg C O and Webb R. 2000. Expression of mRNA
encoding IGF I, IGF II and type I IGF receptor in bovine ovarian
follicles. Journal of Endocrinology 165: 101–13.
Badinga L, Driancourt M A, Savino J D, Wolfenson D, Drost M,
delaSota R L and Thatcher W W. 1992. Endocrine and ovarian
responses associated with first wave dominant follicle in cattle.
Biology of Reproduction 47: 871–83.
Berisha B and Schams D. 2005. Ovarian function in ruminants.
Domestic Animal Endocrinology 29: 305–17.
Balasubramanian K, Lavoie H A, Garney J C, Stocco D M
and Veldhius J D. 1997. Regulation of porcine granulosa
cell steroidogenic acute regulatory protein (StAR) by insulin-like
growth factor-I: Synergism with follicle stimulating hormone or
protein kinase A agonist. Endocrinology 138: 433–39.
39
312
DEV ET AL.
[Indian Journal of Animal Sciences 80 (4)
mediated via the type-I IGF receptor. Journal of Clinical
Endocrinology and Metabolism 83: 1256–59.
Yuan W, Lucy M C and Smith M F. 1996. Messenger RNA for
insulin-like growth factor-I and –II, insulin-like growth factor
binding protein–2, gonadotropin receptors and steroidogenic
enzymes in porcine follicles. Biology of Reproduction 55: 1045–
54.
Yuan W, Bao B, Garverick H A, Youngquist R S and Lucy M C.
1998. Follicular dominance in cattle is associated with divergent
pattern of ovarian gene expression for insulin-like growth factor
(IGF-I, IGF-II) and IGF binding protein–2 in dominant and
subordinate follicles. Domestic Animal Endocrinology 15: 55–
63.
Zhou J and Bondy C. 1993. Anatomy of the human ovarian insulinlike growth factor system. Biology of Reproduction 48: 467–
82.
Zhou J, Kumar T R, Matzuk M M and Bondy C. 1997. Insulin-like
growth factor-I regulates gonadotropin responsiveness in the
murine ovary. Molecular Endocrinology 11: 1924–33.
factor–I receptors in ovarian granulosa cells: effect of follicle
size and hormones. Molecular Cellular Endocrinology 102: 69–
76.
Spicer L J and Chamberlain C S. 2000. Production of insulin-like
growth factor-I by granulosa cells but not theca cells is
hormonally responsive in cattle. Journal of Animal Sciences
78: 2919–26.
Woad K J, Baxter G, Hogg C O, Bramley T A, Webb R and
Armstrong D G. 2000. Expression of mRNA encoding insulinlike growth factors I and II and the type 1 IGF receptor in the
bovine corpus luteum at defined stages of the oestrous cycle.
Journal of Reproduction and Fertility 120: 293–302.
Wandji S A, Wood T L, Crawford J, Levison S W and Hammond J
M. 1998. Expression of mouse ovarian insulin growth factor
system components during follicular development and atresia.
Endocrinology 139: 5205–14.
Willis D S, Mason H D, Watson H and Franks S. 1998.
Developmentally regulated responses of human granulosa cells
to insulin-like growth factors (IGFs): IGF-I and IGF-II action
40
Indian Journal of Animal Sciences 80 (4): 313–316, April 2010
Effect of Bt cotton plants on oxidative stress in sheep
B ANILKUMAR1, A GOPALA REDDY2, B KALAKUMAR3, K JYOTHI4 and K S GOPI5
Sri Venkateswara Veterinary University, Tirupati, Andhra Pradesh 500 030 India
Received: 6 April 2009; Accepted: 15 November 2009
ABSTRACT
Sheep (32) of 1–year age belonging to Deccani breed were randomly divided into 4 groups consisting of 8 sheep in
each group. Group 1 was maintained on basal diet (green fodder @ 3 kg + concentrate feed @ 300 gm/sheep/day) and
2 on conventional (non-Bt) cotton plants @1.5 kg + green fodder @1.5 kg + concentrate feed @ 300 g/sheep/day, 3 on
Bt cotton plants @1.5 kg + green fodder @1.5 kg + concentrate feed @ 300 g/sheep/day and 4 on Bt cotton plants ad
lib. + concentrate feed @ 300 g/sheep/day. All the groups were fed for 3 months. Parameters related to oxidative stress
in organs of all groups and the concentration of gossypol in sera samples of groups 2, 3 and 4, and Bt (Cry1Ac) protein
in rumen liquor in groups 3 and 4 were evaluated at the end of third month of feeding, while the concentration of Bt
(Cry1Ac) protein in sera samples of groups 3 and 4 was quantified at monthly intervals for 3 months. The mean
concentration of GSH and TBARS, and the activity of SOD and catalase in liver, kidney and heart showed statistically
nonsignificant difference among the groups. The Bt (Cry1Ac) protein was not detectable in sera samples of groups 3
and 4 at different time intervals, while rumen liquor had detectable concentrations at the end of third month of feeding.
Gossypol was not found in the sera samples of sheep fed on Bt and non-Bt cotton plants. In conclusion, the study
revealed that feeding of Bt cotton plants did not induce oxidative stress in sheep and sera samples were negative for
Cry1 Ac protein and gossypol.
Key words: Bt cotton, Gossypol, Oxidative stress, Sheep
showed tolerance to gossypol toxicity (Reiser and Fu 1962).
In Andhra Pradesh, due to decline of grazing land, the farmers
and shepherds allow their animals into cotton fields after
harvesting the cotton. There were reports in the print media
that sheep died in Telangana region of Andhra Pradesh after
grazing on leaves and pods of harvested Bt cotton plant
residue in fields (Anonymous 2007). Cultivation of Bt cotton
has raised fears among the shepherds and other livestock
owners over the safety of Bt cotton plants and its by-products.
Therefore, there was a need to carry out a study on the toxic
potential, if any, of Bt protein and gossypol that are present
in Bt cotton plants by incorporating in the feed of sheep.
Hence, the present study was undertaken in sheep to estimate
Cry1 Ac protein and gossypol in sera samples and to assess
the biomarkers of oxidative stress in liver, heart and kidney.
A genetically modified (GM) cotton variety, known as Bt
cotton, has been developed to control the menace of pests.
By introducing the genetic information encoding the
insecticidal protein of Bt (Bacillus thuringiensis) (Cry 1Ac)
into plants, the plants would produce their own insecticides
(bio-insecticides) that reduce the application of pesticides,
improve insect control and reduce environmental problems.
Several studies showed that the amount of expression of Bt
protein (Cry 1Ac) in plant is very minute in quantity and its
action is limited to certain larval species and may not cause
toxicity to mammals (Betz et al. 2000). However, it is
desirable to correlate the concentration of Cry 1Ac protein
in ruminal fluid and blood with the effects of feeding on
digestive and other systems. Gossypol is a toxic component
that is produced for defense by the plant and causes
deleterious effects to non-ruminants, although ruminants
1Ph.D.
MATERIALS AND METHODS
2Professor
Present address:
Scholar,
and University
Head, 3 Assistant Professor, Department of Pharmacology. C.V.Sc.
Rajendranagar, Hyderabad 500 030 India (email: gopalareddy123
@rediffmail.com)
4H. No. # 5-4-17/1, Bhavani Colony, Rajendranagar. Hyderabad
500 030 India.
5Veterinary Assistant Surgeon, Veterinary Dispensary, Thaiyur,
Gingee (Taluk), Villupuram (Dt), Tamil nadu 604 205.
Deccani sheep (32),1- year-old, were randomly divided
into 4 groups, consisting of 8 sheep in each group, after an
acclimatization period of 2 weeks. Sheep were dewormed
by administering albendazole (@ 7.5 mg/kg body wt orally)
and vaccinated for FMD, HS, PPR and sheep pox, and
provided with water ad lib. throughout the experiment. Bt
and conventional (non-Bt) cotton crops were cultivated at
41
314
ANILKUMAR ET AL.
Student Farm, College of Agriculture, Acharya N.G Ranga
Agricultural University (ANGRAU), Hyderabad. The groups
were fed as per the following schedule for 3 months:
Group 1: Basal diet (green fodder; APPN1 hybrid Napier
grass) @ 3 kg + concentrate feed* @ 300 g/
sheep/day)
Group 2: Non-Bt cotton plant (50% of greens) @1.5 kg+
green fodder @1.5 kg + concentrate feed @
300 g/sheep/day
Group 3: Bt cotton plants (50% of greens) @1.5 kg+
green fodder @1.5 kg + concentrate feed @
300 g/sheep/day
Group 4: Bt cotton plants ad libitum (3 kg) (without other
green fodder) + concentrate feed @ 300 g/
sheep/day.
*Composition of concentrate feed (ingredients in kg/100 kg
concentrate feed)
Maize
25
Ground nut cake
20
Wheat bran
15
Red gram
15
Deoiled rice bran
15
Sorghum straw
07
Mineral mixture
02
Salt
01
The blood samples (n = 8) were drawn from jugular vein
at monthly intervals for 3 months for estimation of Cry1Ac
protein (groups 3 and 4) and at the end of third month for
quantification of gossypol (groups 2, 3 and 4). The rumen
liquor was collected at the end of third month for
quantification of Cry1Ac protein in groups 3 and 4 (n = 8).
The sheep were sacrificed after third month of feeding and
the liver, kidney and heart tissues were collected (n = 8 for
each organ in each group) and homogenized for the assay of
reduced glutathione (GSH) (Moron et al. 1979),
thiobarbituric acid reacting substances (TBARS)
(Subramanian et al. 1988), super oxide dismutase (SOD)
(Madesh and Balasubramanian 1998) and catalase (Sinha
1971). The protein estimation in the organs was done as per
Lowry et al. (1951). Sera samples were analyzed for gossypol
by HPLC (Nomier and Abou-Donia 1982). The expression
of Bt Cry1Ac protein in biological samples (serum and rumen
[Indian Journal of Animal Sciences 80 (4)
liquor) was done by using ELISA kit for Cry1Ab/Cry Ac.
The experimental protocol was approved by the Institutional
Animal Ethics Committee. The data were subjected to
statistical analysis by applying one-way ANOVA using
statistical package for social sciences (SPSS) version 10.
Differences between means of different groups were tested
using Duncan’s multiple comparison test and significance
was set at P<0.05.
RESULTS AND DISCUSSION
The concentration of TBARS (nM of MDA/g tissue) at
the end of third month in the homogenized tissues of liver,
heart and kidney in basal diet control (group 1) was
371.26±22.53, 349.35±11.22 and 358.44±15.71, respectively,
which did not differ significantly when compared to the
remaining groups. The concentration of GSH (mg/g protein)
of liver, heart and kidney tissue homogenate was 17.73±2.62,
13.30±1.81 and 8.55±0.41, respectively in group 1, which
did not differ significantly when compared to the remaining
groups (Table 1). The activity of SOD (U/mg protein) in the
liver, heart and kidney homogenate of group 1 was
22.33±1.55, 40.42±8.91 and 26.89±5.26, respectively, and
the values did not differ significantly when compared to other
groups. Similarly, the activity of catalase (μg of H2O 2
decomposed/min/mg protein) of liver, heart and kidney
homogenate of group 1 was 5.72±0.69, 2.24±0.98 and
4.25±0.86, respectively, which did not differ significantly
when compared to other groups (Table 2).
The anti-oxidant defense profile was studied to assess the
possibility, if any, of oxidative stress and free radical damage
in the biological system by estimating the concentration of
GSH in the liver, kidney and heart as oxidative stress is the
central mechanism for the occurrence of a number of diseases
and toxicities (Kumar et al. 2002).The concentration of GSH
(non-enzymatic antioxidant) was assessed in liver as it is the
major organ involved in xenobiotic metabolism and in kidney,
which is susceptible to the free radical damage owing to its
richness in peroxidizable fatty acids. The concentration of
TBARS in liver, kidney and heart was analyzed to determine
the extent of lipid peroxidation, and the activity of catalase
and SOD was assessed as they form the major components
of enzymatic antioxidant defense system in vivo. Lipid
Table 1. Concentration of TBARS and GSH in liver, heart and kidney of different groups of sheep at the end of third month of feeding
Group
Basal diet (green fodder +
concentrate)
Non Bt cotton + Basal diet
Bt cotton 50% + Basal diet
Bt cotton ad lib. + concentrate
TBARS (nM of MDA/g protein)
GSH (mg/g protein)
Liver
Heart
Kidney
Liver
Heart
Kidney
371.26±22.53
349.35±11.22
358.44±15.71
17.73±2.62
8.55±0.41
13.30±1.81
374.46±16.41
373.39±12.78
370.72±9.74
356.30±40.57
353.63±9.84
365.38±17.92
360.57± 14.82
355.76± 14.80
355.23± 16.86
14.11±1.84
14.66±0.81
14.76±3.23
9.04±1.46
9.04±1.46
10.93±3.44
12.46±1.89
12.46±1.89
12.65±1.24
Values are mean±SE (n = 8); one-way ANOVA (SPSS).
42
April 2010]
TOXICITY OF BT COTTON IN SHEEP
315
Table 2. Activity of super oxide dismutase (SOD) and catalase in liver, heart and kidney of different groups of sheep at the
end of third month of feeding
Group
Basal diet (green fodder +
concentrate)
Non Bt cotton + Basal diet
Bt cotton 50% +Basal diet
Bt cotton ad lib + Concentrate
SOD (U/mg protein)
Catalase (μg of H2O2 decomposed/
min/mg protein)
Liver
Heart
Kidney
Liver
Heart
Kidney
22.33±1.55
40.42±8.91
26.89±5.26
5.72±0.69
2.24±0.98
4.25±0.86
29.46±2.71
28.70±2.67
26.10±1.94
34.51±3.51
27.82±2.45
21.36±3.21
26.73±2.31
20.26±2.03
19.62±3.93
5.81±0.88
4.31±0.71
4.19±0.67
2.87±0.72
2.01±0.21
2.46±0.37
4.30±1.20
4.08±0.83
5.13±0.64
Values are mean±SE (n = 8); one-way ANOVA (SPSS).
peroxidation biomarker and enzymatic and non-enzymatic
antioxidant defenses did not differ significantly among the
groups in study.
Concentration of Bt (Cry1Ac) protein (μg/g) in rumen
liquor was analyzed at post-prandial period and it was
1.27±0.06 in sheep fed exclusively on Bt cotton plant (group
4) and 0.25±0.03 in sheep fed on diet containing 50% Bt
cotton plants (group 3). Cry1Ac protein was not detected in
sera samples of sheep (groups 3 and 4). The Bt. protein may
be eliminated in faecal material following degradation
without getting concentrated in blood leading to nondetectable levels as observed in this study. Similar estimations
were done earlier by Yonemochi et al. (2002), who
investigated the transgenic Cry9C protein in tissues from
chickens fed maize (event CBH 351) and could not detect
this novel protein in blood, liver or muscle samples. Ash et
al. (2000) also did not detect transgenic CP4 EPSPS protein
in whole egg, egg white, liver and faeces of laying hens fed
a diet containing genetically modified (GM) soybean meal.
The evidence of possible transfer of plant DNA to tissues
and edible products of cattle was studied in animals fed
conventional (non-GM) and genetically modified (GM) Btmaize by Einspanier et al. (2004) and found DNA of plant
chloroplast in duodenal juice and blood lymphocytes in both
the groups, but the DNA was not found in blood, milk and
any other tissues of the cows fed with Bt-maize.
In this study, sera samples were found negative for the
presence of gossypol. In ruminants, gossypol seems to have
little effect when whole cottonseed and by-products are fed
within the safety limits (Calhoun and Holmberg 1991). Even
though toxic effects are expected when high concentrations
of free gossypol are fed, ruminants have the capacity to
detoxify large amounts by binding it to soluble proteins in
the rumen (Reiser and Fu 1962). Gossypol affects liver
functions, erythrocyte oxygen-carrying or releasing capacity,
respiration rate, feed intake, and production and reproduction
efficiency (Gray et al. 1990, Brocas et al. 1997).
In conclusion, the study revealed that feeding of Bt cotton
plants did not induce oxidative stress as evident from
biomarkers of oxidative stress in sheep and further, Bt
(Cry1Ac) protein and gossypol were not detectable in sera
samples of sheep.
ACKNOWLEDGEMENTS
The authors thank Sri Venkateswara Veterinary University,
Tirupati (Andhra Pradesh), for providing necessary financial
assistance, Associate Dean, College of Agriculture,
Hyderabad, for sparing land and facilities for cultivation of
cotton crops and Head, Livestock Research Station, College
of Veterinary Science, Hyderabad, for extending necessary
facilities during the experimentation.
REFERENCES
Anonymous. 2007. News paper reports: Deccan Herald, February
7, 2007; The Hindu, March 2, 2007; GM Watch, March 4, 2007;
Hindustan Times, June 17, 2007; GM Watch, June 18, 2007;
Hindustan Times, June 18, 2007
Ash J A, Scheideler E and Novak C L. 2000. The fate of genetically
modified protein from Roundup Ready soybeans in the laying
hen. Poultry Science 79 (Suppl. 1): 26.
Betz F S, Hammond B G and Fuchs R L. 2000. Safety and
advantages of Bacillus thuringiensis-protected plants to control
insect pests. Regulatory Toxicology and Pharmacology 32: 156–
73.
Brocas C R M, Rivera F F, Paula-Lopez L R, McDowell M C,
Calhoun C R, Staples N S, Wilkinson A J, Boning P J,
Chenoweth and Hansen P J. 1997. Deleterious actions of
gossypol on bovine spermatozoa, oocytes and embryos. Biology
of Reproduction 57: 901.
Calhoun M and Holmberg C. 1991. Safe use of cotton by-products
as feed ingredients for ruminants: A review. Cattle Research
with Gossypol Containing Feeds. pp. 97–129. (Eds) Jones L A,
Kinard D H and Mills J S. National Cottonseed Products
Association, Memphis, TN.
Einspanier R, Lutz B, Rief S, Berezina O, Zverlov V, Schwarz W
and Mayer J. 2004. Tracing residual recombinant feed molecules
during digestion and rumen bacterial diversity in cattle fed
transgene maize. European Food Research Technology 218:
269–73.
Gray M L, Randel R D, Greene L W and Williams G L. 1990.
43
316
ANILKUMAR ET AL.
Metabolic homeostasis and reproductive endocrine function in
post-pubertal beef heifers fed varying levels of dietary free
gossypol. Journal of Animal Science 68 (Suppl. 1): 465
(Abstract).
Kumar D, Lou H and Singal P K. 2002. Oxidative stress and
apoptosis in heart dysfunction. Herz 27: 662–68.
Lowry O H, Rosenbrough M J, Farr A L and Rawdell R A. 1951.
Protein measurement with the Folin phenol reagent. Journal of
Biological Chemistry 193: 265–75.
Madesh M and Balasubramanian K A. 1998. Micro titre plate assay
for super oxide dismutase using MTT reduction by super oxide.
Indian Journal of Biochemistry and Biophysics 35: 185–88.
Moron M S, Depierre J W and Mannervik B. 1979. Levels of
glutathione, glutathione reductase and glutathione S transferase
in rat lung and liver. Biochemica et Biophysica Acta 582: 67–
68.
[Indian Journal of Animal Sciences 80 (4)
Nomier A A and Abou-Donia 1982. Gossypol: High performance
liquid chromatogaphic analysis and stability in various solvents.
Journal of Association of official Analytical chemists 59: 556–
59.
Reiser R and Fu H C. 1962. The mechanism of gossypol
detoxification by ruminant animals. Journal of Nutrition 76:
215–18.
Sinha A K. 1971. Colorimetric assay of catalase. Analytical
Biochemistry 47: 389–94.
Subramanian K A, Manohar M and Mathan V I. 1988. An
unidentified inhibitor of lipid peroxidation in intestinal mucosa.
Biochimica et Biophysica Acta 962: 51–58.
Yonemochi C, Fujisaki H, Harada C, Kusama T and Hanazumi
M. 2002. Evaluation of transgenic event CBH 351 (Star
Link) corn in broiler chicks. Journal of Animal Science 73: 221–
28.
44
Indian Journal of Animal Sciences 80 (4): 317–320, April 2010
Micro- minerals status in goats of different ages in semi-arid region of India*
NEERU BHOOSHAN1, PUNEET KUMAR2 and M C YADAV3
Central Institute for Research on Goats, Makhdoom, Uttar Pradesh 281 122 India
Received: 10 June 2008; Accepted: 30 October 2009
ABSTRACT
The present study was conducted to evaluate and compare blood zinc (Zn), copper (Cu) and cobalt (Co) status of
healthy female goats (210: 105 of Barbari breed and 105 of Jamunapari breed) of different ages, managed under semiintensive system at institute farm. Blood Zn and Cu concentrations were significantly influenced by age of goats, while
blood Co concentration was significantly affected by the breed of goats. In Barbari and Jamunapari goats, Zn levels
further increased during one month of age. Thereafter it decreased significantly with the advancement of age up to 9–10
months of age in Barbari goats. Zn level was significantly low at pubertal age than pre-pubertal age in Barbari goats.
While in Jamunapari goats, Zn level was not different in pre-pubertal, pubertal and post-pubertal age. In these goats, Cu
concentration was low at birth which increased with the advancement of age and attained the highest level at 11 to 12
months of age, while, blood Cu concentration was not different at pre-pubertal, pubertal and post pubertal age. Blood
Co concentration did not change with the advancement of age. Barbari goats have significantly higher blood Co
concentration than Jamunapari goats.
Key words: Age, Cobalt, Copper, Goat, Zinc
Zinc (Zn), copper (Cu) and cobalt (Co) are micro-minerals
essential in multiple enzyme systems. Early deficiency of
zinc reduces feed intake, growth rate and feed efficiency
(McDowell 2003); and cobalt deficiency impairs energy and
protein metabolism and then growth and development of
deficient animal (Kadim et al. 2006). However, goats are
considered as being more resistant to low levels of dietary
cobalt (Mburu et al. 1993).
Mineral concentrations in goat blood are different from
those of other ruminants such as cattle and sheep (Haenlein
1980), there is a need to fully understand its micro-mineral
requirements. Breed, age, productivity, physiological state
of the animal, mineral intake, chemical form of elements
and interrelationships with other nutrients, affect mineral
requirements and status (NRC 1985, Khan et al. 2007). Young
animals absorb minerals more efficiently than older animals
(McDowell 2003). The objective of the present work was to
evaluate and compare micro-minerals status of two breeds
of goats of different age groups on the basis of mineral
concentrations in blood, so as to form the basis for their
optimum growth and fertility.
MATERIALS AND METHODS
Animals and feeding: Healthy indigenous female goats
(210: 105 Barbari and 105 Jamunapari goats) of different
age groups (Table 1) maintained under semi-intensive system
of management at the institute farm were used in this study.
Feeding was done according to NRC (1981). Newly born
kids were fed with mother milk for first 15 days with bottle.
Weaning was done at 3 months of age. After weaning,
experimental goats were allowed 4-6 grazing and were stall
fed with dry roughage ad lib. For Barbari goats, 200 g to 350
g/animal/day pelleted concentrate mixture with 13 and 69%
digestible crude protein (DCP) and total digestible nutrients
(TDN) respectively was given from 2 to 3 months of age to
9 to10 months. An additional 50 g feed per animal was given
to Jamunapari goats. Adult goats above 1 year of age were
given 400 g concentrate mixture daily. Drinking water was
given ad lib. The animals were dewormed regularly as per
standard health practices.
Analysis of micro-minerals: Blood (5 ml) was collected
in nitric acid washed heparinized vials from jugular vein at
days 0 (birth), 30, 90, 180, 270–300, 330–360 besides prepubertal, pubertal and post pubertal (one week after estrus)
* Part of Ph.D. thesis, Submitted to Dr B.R. Ambedkar
University, Agra (Uttar Pradesh).
Present address: 1Scientific Officer, U.P. Council of Agricultural
Research, 8th Floor, Kisan Mandi Bhawan, Vibhuti Khand, Gomti
Nagar, Lucknow, Uttar Pradesh 226 010 (e-mail address:
neerubhooshan@gmail.com).
2Principal Scientist,Division of Goat Physiology.
3Principal, Narain College, Shikohabad, Firozabad, Uttar Pradesh
45
318
BHOOSHAN AND KUMAR
ages for estimation of Zn, Cu and Co. Blood samples were
digested as per the AOAC (1984). Blood Zn, Cu and Co were
estimated in digested samples using flame atomic absorption
spectrophotometer. Element specific hollow cathode lamps
were used and analytical quality was maintained by repeated
analysis of reference samples. Eight working standards were
prepared freshly from stock (Naresh 1997).
Analysis of data: Data obtained was analyzed using mixed
model (MIXMDL PC-2) program with a least square
technique for fitting non-orthogonal data and maximum
likelihood computer program developed by Harvey (1990).
Duncan’s multiple range test (DMRT) modified by Kramer
(1957) was used for pair-wise comparison among least
squares means for age within breed effect to find out any
significant difference among them. Correlation coefficient
(r) was carried out in pooled manner by using standard
method described by Snedecor and Cochran (1994).
[Indian Journal of Animal Sciences 80 (4)
calves (Kincacid and Hodgson 1989). In Barbari goats, 11–
12 months of age the Zn level increased significantly
(P<0.05). Similarly, in cattle, calves did not carry higher
concentration of total body Zn than did mature animals (Akan
et al. 1991). In Jamunapari goats, Zn level increased at 11–
12 months of age though not significantly. In Barbari goats,
the Zn level was significantly (P<0.05) low at pubertal age
than pre-pubertal age. While in Jamunapari goats, the Zn
level was not different in pre-pubertal, pubertal and postpubertal age. Similarly, no significant difference between
the age groups was found in Assami goats (Bhattacharyya et
al. 1995) and in Kivircik lambs (Akdogan et al. 2000).
In this study, blood Cu concentration was affected
significantly by age (P < 0.01) but no obvious affect of breed
and interaction between breed and age on Cu concentration
was found. Blood copper concentration increased with the
advancement of age which may be due to increasing
physiological demands of growth. In Barbari and Jamunapari
goats, blood copper concentration was low (Table 1) at birth,
which increased with the advancement of age and attained
the highest level at 11 to 12 months of age. Copper
concentrations are related to age in sheep (Church 1993), in
beef and dairy calves (Puschner et al. 2004) and in Sudanese
camels (Camelus dromedarius) (Mohamed 2004). Ahmed
et al. (2001) showed that an association exists between age
and the physiological status of dairy Nubian goats, pregnancy,
lactation and concentration of copper and zinc. Plasma copper
levels increased significantly in adult compared to young
animals. The increase in Cu level with age could be associated
with higher concentrations of circulating oestrogens in the
mature animals as a consequence of oestrous cycle (Desai et
al. 1978) and probably for normal functioning of endocrine
glands during puberty (Pathak et al. 1986). In these goats,
blood copper concentration was not different at pre-pubertal,
pubertal and post pubertal age. Contrary to this, blood copper
concentration was significantly higher on the day of oestrus
than during the other stages of reproduction in Assami goats
RESULTS AND DISCUSSION
In this study, the overall means of blood zinc (ppm),
copper (ppm) and cobalt (ppm) for Barbari and Jamunapari
goats irrespective of age are given in Table 1. In sheep, the
blood plasma concentration of Zn, Cu and Co was 8–12 ppm,
0.7–1.3 ppm and 0.1–0.3 ppm respectively (Radostits et al.
2000). Similarly, in adult lactating healthy cow, the Zn, Cu
and Co concentration was 8.46 ± 1.10 ppm, 0.62 ppm and
0.40 ± 0.03 ppm respectively (Naresh 1997).
Least square analysis of variance indicated that goat blood
Zn concentration was significantly (P<0.01) affected by age
but not with breed. Concentrations of Zn fluctuate with age,
stress, infections and feed restriction (Kincaid 1999). In
Barbari and Jamunapari goats at birth, the Zn levels further
increased (Table 1) during 1 month of age. Thereafter it
decreased significantly (P<0.05) with the advancement of
age up to 9–10 months of age in Barbari goats. Similarly,
plasma Zn concentration decreased significantly with
increase in age in Nubian goats (Ahmed et al. 2001) and in
Table 1. Least square mean ± SE of zinc (ppm), copper (ppm) and cobalt (ppm) at various ages for Barbari and Jamunapari goats
Age (days)
Birth
30
90
180
270–300
330–360
Pre-pubertal
Pubertal
Post-pubertal
Overall
n
8
8
15
6
21
9
14
12
12
105
Zinc (ppm)
Copper (ppm)
Cobalt (ppm)
Barbari
Jamunapari
Barbari
Jamunapari
Barbari
Jamunapari
5.74abc±0.73
6.03abc±0.73
4.51c±0.53
4.29 c ±0.84
4.82 c ±0.45
5.18abc±0.68
6.65ab±0.55
4.84bc±0.59
6.88a±0.59
5.44±0.21
4.26 ±0.69
4.94 ±0.69
4.67 ±0.50
4.89 ±0.79
4.91 ±0.42
5.93 ±0.65
5.40 ±0.65
5.63 ±0.56
5.64±0.56
5.14 ±0.20
0.76 ± 0.10
0.87 ± 0.10
0.91 ± 0.07
0.77 ± 0.12
0.96 ± 0.06
1.08 ± 0.09
0.97 ± 0.07
1.02 ± 0.08
0.96 ± 0.08
0.92 ± 0.03
0.52c ± 0.08
1.01ab ± 0.08
1.02ab ± 0.06
0.90ab ± 0.10
1.03ab ± 0.05
1.08a ± 0.08
0.85b ± 0.06
0.92ab ± 0.07
0.93ab ± 0.07
0.92 ± 0.02
0.41ab ± 0.06
0.34 ab ± 0.06
0.39 ab ± 0.04
0.39 ab ± 0.07
0.24 b ± 0.05
0.25 ab ± 0.06
0.22 b ± 0.05
0.38 ab ± 0.05
0.44 a ± 0.05
0.34 ± 0.02
0.27 ± 0.07
0.27 ± 0.07
0.21 ± 0.05
0.26 ± 0.09
0.27 ± 0.05
0.26 ± 0.07
0.23 ± 0.06
0.29 ± 0.06
0.28 ± 0.06
0.26 ± 0.02
Means marked with different a, b, c superscripts in a column between ages indicates DMRT significance (P<0.05)
n= denotes the no. of observations for each age group of each breed.
46
April 2010]
MICRO-MINERALS AND BIOCHEMICAL PROFILE OF MARWARI GOATS
(Bhattacharyya et al. 1995) and in nulliparous heifers (Small
et al. 1997).
In the present study, blood Co concentration was
significantly (P<0.01) affected by breed but not with age.
Barbari goats have significantly (P<0.01) higher blood Co
concentration than Jamunapari goats. Zadjali et al. (2004)
also reported that there are likely genetic differences between
breeds of the same species. Co plays a more important role
in early growth and development (Kadim et al. 2006). In
Barbari and Jamunapari goats, Co concentration did not
change with the advancement of age. Contrary to this, kids
in the age group of 1–3 months showed significantly (P<
0.05) lower levels of serum vitamin B 12 than the older
animals (Zadjali et al. 2004). Robertson (1971) suggested
that need of the young animal for serum vitamin B12 is greater
than that of adults because of their higher metabolic rate.
Although in Barbari goats, cobalt level slightly decreased at
9 to 10 months of age and remained low up to pre-pubertal
age. At puberty, it again increased (though not significantly).
While in Jamunapari goats, it did not show any change with
the advancement of age. In young lambs (up to 2 months of
age) if weaned early, likewise have a need for dietary vitamin
B12 (NRC 1985). Cobalt deficiency reduced lamb survival
and increased susceptibility to parasitic infection in cattle
and sheep (Ferguson et al. 1998).
Balanced feeding of Zn, Cu and Co in the diet of
indigenous goats is very essential for optimum growth,
production and reproduction to achieve maximum output in
terms of economic returns as healthy, growing and
performing kid which survives, reproduces and produces milk
and mutton economically.
319
Church C D. 1993. El ruminates: fisiologia digestive ynutricionpp.
397–408.(Ed.) Acribia S A. Zaragoza, Espana.
Desai M C, Thakkar T P, Ami D R and Janakiraman K. 1978. A
note on serum copper levels in relation to reproductive
performance in Surti buffaloes. Indian Journal of Animal
Science 47: 398–409.
Ferguson E G W, Mitchell G B and Mac Pherson A. 1988. Cobalt
deficiency and Ostertagia circumcincta infection in the lambs.
Veterinary Record 124: 20.
Haenlein G F W. 1980. Mineral nutrition of goats. Journal of Dairy
Science 30: 1729–42.
Harvey W R. 1990. User’s Guide for MIXMDL PC-2 version Mixed
Model Least –Squares and Maximum Likelihood Computer
Program (Mimeo). Ohio State University, Columbus, OH.
Kadim I T, Mahgoub O, Al-Ajmi D, Al-Habsi K R and Johnson E
H. 2006. Comparative effects of low levels of dietary cobalt
and parenteral injections of Vitamin B12 on body dimensions
in different breeds of Omani goats. Small Ruminant Research
66: 244–52.
Khan Z I, Hussain A, Ashraf M,Ashraf M Y and McDowell L R,
2007. Macromineral status of grazing sheep in a semi-arid region
of Pakistan. Small Ruminant Research 68: 279–84.
Kincacid R L. 1999. Assessment of trace mineral status
of ruminants: A review. Proceedings of American Society of
Animal Science. www.asas.org/JAS/symposia/proceedings/
0930.pd.
Kincaid R L and Hodgson A S. 1989. Relationship of selenium
concentrations in blood of calves to blood selenium of the dam
and supplemental selenium. Journal of Dairy Science 72: 259–
263.
Kramer C Y. 1957. Extension of multiple range tests to group
correlated adjusted means. Biometrics 13: 13–18.
Mburu J N, Kamau J M Z and Badamana M S. 1993. Changes in
serum levels of vitamin B12, feed, live weight and
haematological parameters in cobalt deficient small East African
goats. International Journal of Vitamin Nutrition and Research
63: 135–139.
McDowell L R. 2003. Minerals in Animal and Human Nutrition.
2nd edn, 644 pp. Elsevier Science, Amsterdam.
Mohamed H E. 2004. The zinc and copper content of the plasma
of Sudanese camels (Camelus dromedarius). Veterinary
Research Communications 28: 359–63.
Naresh R. 1997. ‘Studies on profile of trace and toxic heavy metals
in mastitis and ameliorative effects of ascorbic acid therapy.’
M.V.Sc. Thesis, I.V.R.I., Izatnagar.
National Research Council (NRC). 1981. Nutrient Requirement of
Domestic Animal. No. 15 Nutrient requirement of goats. Angora,
Dairy and meat goats in temperate and tropical countries.
National Academic of Sciences, Washington, D.C.
Osman N I, Johnson E H, Al-Busaidi R M and Suttle N F. 2003.
The effects of breed, neonatal age and pregnancy on the plasma
copper status of goats in Oman. Veterinary Research
Communications 27: 219–29.
Pathak M M, Patel A V and Jankiraman K. 1986. Blood serum
copper at different stages of pregnancy in Surti buffalo. Indian
Journal of Animal Sciences 56: 1202–04.
Puschner B, Thurmond M C and Choi Y K. 2004. Influence of age
and production type on liver copper concentrations in calves.
Journal of Veterinary Diagnostic and Investigations 16: 382–
87.
ACKNOWLEDGEMENT
The authors are thankful to the Director, Central Institute
for Research on Goats, Makhdoom, and Dr D Swarup, Head,
Division of Medicine, Indian Veterinary Research Institute,
Izatnagar, for providing necessary facilities.
REFERENCES
Ahmed M M M, Hamed T F M and Barri M E S. 2001. Variation of
Zinc and Copper concentrations in the plasma of Nubian goats
according to physiological state. Small Ruminant Research 39:
189–93.
Akan V D, De Bont J, Holm V and Ramawana S S E. 1991. A
study of mineral status of cattle in a dairy farm in Sri Lanka.
Indian Veterinary Journal 68: 371–74.
Akdogan-Kaymaz A, Bakirel U, Cagtay P and Jan H. 2000. The
effects of serum IgG and traceelements Copper and Zinc on the
developments of Kivircik lambs following colostrums intake.
Veteriner-Fakultesi Dergisi Istanbul 26: 475–78.
AOAC.1984. Association of Official Analytic Chemists. Virginia.
pp. 444–476.
Bhattacharyya B N, Talukdar S C, Baruah R N, Baruah K K Sr,
Baruah K K Jr and Baruah A. 1995. Studies on circulatory levels
of trace mineral at different reproductive status in goat. Indian
Journal of Animal Reproduction 16: 96–98.
47
320
BHOOSHAN AND KUMAR
Radostits O M, Goy C C, Blood D C and Hinchclig R W. 2000.
Veterinary Medicine: A Textbook the Diseases of Cattle, Sheep,
Pigs, Goats and Horses. W.B. Saunders, London.
Robertson W W.1971. Cobalt deficiency in ruminants. Veterinary
Record 89: 5–12.
Small J A, Charmely E, Rodd A V and Fredeen A H. 1997. Serum
mineral concentration in relation to estrus and conception in
[Indian Journal of Animal Sciences 80 (4)
beef heifers and cows fed conserved forage. Canadian Journal
of Animal Science 77: 63–68.
Snedecor G W and Cochran W G. 1994. Statistical Methods. 8th
edn. Iowa State University Press Ames- Iowa.
Zadjali A Al, Johnson E H and Srikandakuma A. 2004. Serum
vitamin B12 level in Omani goats. Tropical Animal Health and
Production 36: 437–82.
48
Indian Journal of Animal Sciences 80 (4): 321–325, April 2010
Effect of age and reproductive state on phosphatase enzymes and steroid
hormones profile in Indian goats*
NEERU BHOOSHAN1, PUNEET KUMAR2 and M C YADAV3
Central Institute for Research on Goats, Makhdoom, Uttar Pradesh 281 122 India
Received: 19 July 2008;Accepted 20 October 2009
ABSTRACT
Healthy female goats (290; 145 of Barbari breed and 145 of Jamunapari breed) of different ages, viz. 0 (birth), 30,
90, 180, 270–300, 330–360 days, pre-pubertal, pubertal and post-pubertal (1 week after oestrus), managed under semiintensive system of production were used to evaluate and compare the alkaline and acid phosphatases enzyme activity
and estrogen and progesterone steroid hormones profile. The activity of alkaline phosphatase was the highest at birth in
both the breeds. The alkaline phosphatase activity decreased as age of goats increased. While the activity of alkaline
phosphatase increased at pre-pubertal age in Barbari breed, it did not increase in Jamunapari breed. The activity of
alkaline phosphatase in Jamunapari breed at pre-pubertal age was lowest. Low level of alkaline phosphatase activity
might be the cause of delayed maturity in Jamunapari goats. Acid phosphatase activity was highest at birth in Barbari
goats and at 3 months of age in Jamunapari goats. The lowest values of acid phosphatase were observed at pre-pubertal
age in both the breeds. The values of alkaline phosphatase activity increased at pubertal and post-pubertal ages in both
the breeds. In Barbari and Jamunapari goat breeds, the estrogen level was high at birth. Thereafter, it decreased abruptly
and remained low up to pre-pubertal age. At puberty, the estrogen level was maximum in both the breeds. The progesterone
level was highest at birth in Barbari and Jamunapari goat breeds. Thereafter it decreased and remained low till pubertal
age. It increased and obtained the highest level at post-pubertal age or one week after oestrus. Estrogen (+0.13) and
progesterone (+0.30) showed significant positive correlation with alkaline phosphatase enzyme activity. A nonsignificant
association of acid phosphatase was observed with estrogen (–0.04). A significant positive correlation of acid phosphatase
with progesterone (+0.19) was observed.
Key words: Acid phosphatase, Age, Alkaline phosphatase, Estrogen, Goat, Progesterone
MATERIALS AND METHODS
Alkaline phosphatase enzyme is involved in energy
transfer reactions (Freeland and Szepesi 1971). Phosphatases
are thought to be influenced by steroid hormones. The activity
and location of these enzymes change during growth and
puberty. The aim of this study was to evaluate and compare
the steroid hormone and phosphatases profile of two breeds
of goat at different age groups and reproductive states to
facilitate use of modern technologies of hormonal
improvement of fertility in Barbari and Jamunapari goats.
For this study, 290 experimental female goats (145 Barbari
and 145 Jamunapari goats) of 0 (birth), 30, 90, 180, 270 to
300, 330 to 360 days, pre-pubertal, pubertal and post pubertal
age (1 week after showing estrus) maintained under semiintensive system of management at Central Institute for
Research on Goats, Makhdoom (latitude 27° 10’ N and
longitude 78° 02’ E) were used. Feeding was done according
to NRC (1981). For the first 15 days, newly born kids were
nourished with mother’s milk with the help of bottle. Weaning
was done at 3 months of age. After weaning, experimental
goats were allowed 4-6 h grazing. Pelleted concentrate
mixture with 13% DCP and 69% TDN was offered @ 200 g
to 350 g/animal/day to Barbari goats from 2–3 months of
age to 9 –10 months. An additional 50 g per animal to
Jamunapari goats was offered. The adult goats were provided
with 400 g concentrate feed. Drinking water was given ad
lib. The animals were dewormed regularly as per the standard
health practices.
*Part of Ph.D. thesis, Submitted to Dr B.R. Ambedkar
University, Agra, Uttar Pradesh
Present address: 1Scientific Officer, U.P. Council of Agricultural
Research, 8th Floor, Kisan Mandi Bhawan, Vibhuti Khand, Gomti
Nagar, Lucknow, Uttar Pradesh 226 010(e-mail address:
neerubhooshan@gmail.com).
2Principal Scientist,Division of Goat Physiology.
3Principal, Narain College, Shikohabad, Firozabad, Uttar
Pradesh
49
322
BHOOSHAN ET AL.
Blood samples were collected by jugular venipuncture
from each animal into nitric acid washed heparinized vials;
10 ml heparinized blood was centrifuged at 2 500 rpm for 15
min, separated plasma was stored at –20°C till analysis.
Alkaline and acid phospatases were estimated in plasma by
using commercial kits. In plasma, steroid hormones
(progesterone and estrogen) were quantitatively analyzed by
an enzyme immuno assay (EIA) method with commercially
available diagnostic kits (Bhooshan and Kumar 2007).
Standards were provided in the kits. For progesterone,
standard ranged from 0 to 50 ng/ml and for estrogen, from 0
to 1000 pg/ml. The minimum detectable concentration of
progesterone and estrogen 0.05 ng/ml and 1 pg/ml,
respectively. Average intra assay variation for progesterone
and estrogen was 10.92 and 7.92% respectively. Inter assay
variation for progesterone and estrogen was 17.01 and
11.75% respectively.
Results were treated statistically by using mixed model
(MIXMDL PC-2) program with a least square technique for
fitting non-orthogonal data and maximum likelihood
computer program developed by Harvey (1990). To find out
any significant difference among least squares means for age
within breed, pair wise comparison was carried out by
Duncan’s multiple range test (DMRT) modified by Kramer
(1957). By using standard method, correlation coefficient
(r) was carried out in pooled manner (Snedecor and Cochran
1994).
[Indian Journal of Animal Sciences 80 (4)
transfer reactions its utility in growth has been established.
The plasma alkaline phosphatase activity in healthy goats
was reported as 432.78 ± 20.00 IU/L (Sandhu et al. 2001). A
wide range of alkaline phosphatase values in lower age group
of goats (2.80 to 16.73 BU/100 ml) as compared to in higher
age group (1.15 to 7.85 BU/100ml) were reported by Adaval
et al. (1969). In Barbari and Jamunapari goats, activity of
alkaline phosphatase was the highest (72.95 ± 4.25 and 60.61
± 4.98 KA units, respectively) at birth. Higher alkaline
phosphatase found in early age might be due to higher
osteoblastic activity for bone formation and to higher
metabolic rate (Freeland and Szepesi 1971). Contrary to these
findings, Daramola et al. (2005) reported that in West Arfican
Dwarf goats, serum alkaline phosphatase levels were
however higher in adult animals compared to young animals
(P<0.05).
In young animals, alkaline phosphatase comes from
osteoblasts and chondroblasts because bone development is
active. In older animals, alkaline phosphatase comes from
hepatobiliary system (Brar et al. 2000). Higher level of
alkaline phosphatase was observed in first 2 months of age
in male and female kids of Marwari and Surti breeds (Patel
et al. 1992). Similarly, in local Israeli goats (Bogin et al.
1981) and in Black Bengal goats (Kalita and Mahapatra
1998), alkaline phosphatase decreased with increase in age.
Alkaline phosphatase plays an important role in certain
events of reproductive physiology. In Barbari goats, at prepubertal age, the activity of alkaline phosphatase increased
up to the level of 52.36 ± 4.52 KA units. It decreased to the
level of 39.82 ± 3.55 KA units, at pubertal age. The alkaline
phosphatase activity was maximum during luteal phase of
oestrous cycle than in the follicular phase of oestrous cycle
in cows and goats (Rama Chandran et al. 1980,Singh and
Rajya 1982). Similarly, in Alpine Malabari crossbred goats,
serum alkaline phosphatase activity was however high,
though not significant on 14th day of the cycle, when the
luteal function was more (Mathai and Nirmalan 1992).
However, in Jamunapari goats, at pre-pubertal age, the
activity of alkaline phosphatase was lowest (12.68 ± 4.84
KA Units). Low level of alkaline phosphatase activity may
be the cause of delayed maturity in Jamunapari goats.
RESULTS AND DISCUSSION
Alkaline phosphatases
Phosphatase enzymes: The overall means of alkaline
phosphatase in Barbari and Jamunapari goats irrespective of
age and season of birth were 44.62±1.30 and 35.49±1.53 KA
units respectively (Table 1). In Barbari breed, the activity of
alkaline phosphatase was significantly higher (72.95±4.25
KA units) at birth. After that it decreased up to 1 year of age.
At pre-pubertal age, the activity of alkaline phosphatase again
increased significantly up to the level of 52.64±4.60 KA units.
Then it decreased significantly at pubertal and post-pubertal
age than that of pre-pubertal age.
In Jamunapari goats, the activity of alkaline phosphatase
was significantly higher (60.61±4.98 KA units) at birth. After
that it decreased up to pre-pubertal age. At pre-pubertal age,
the activity of alkaline phosphatase decreased significantly
up to the level of 12.38±4.92 KA units. It increased
significantly at pubertal and post-pubertal age than that of
pre-pubertal age.
In Barbari goats, the alkaline phosphatase activity during
February–March and September–October season of birth
were 42.97±1.90 and 46.27±2.14 KA units, respectively. In
Jamunapari goats, the alkaline phosphatase means during two
seasons of birth were 39.32±2.23 and 31.66±2.60 KA units,
respectively.
Alkaline phosphatase enzyme is involved in energy
Acid phosphatase (KA units)
The least square means ±SE of acid phosphatase in Barbari
and Jamunapari breeds from birth to post-pubertal age are
given in Table 1. Least square analysis of variance indicated
that enzyme activity was significantly different between
season (P<0.05) and between breeds and in various ages
(P<0.01). The interaction between breed × season and breed
× age was also significantly different (P<0.01). A
nonsignificant association of acid phosphatase was observed
with estrogen (–0.04). A significant positive correlation of
acid phosphatase with progesterone (+0.19*) was observed.
In Barbari breed, the activity of acid phosphatase was
50
April 2010]
PHOSPHATASE ENZYMES AND STEROID HORMONES IN GOATS
323
Table 1. Least square mean ± SE of alkaline phosphatase (KA units) and acid phosphatase (KA units) at various ages for
Barbari and Jamunapari goats
Age (Days)
Birth
30
90
180
270–300
330–360
Pre-pubertal
Pubertal
Post-pubertal
Season of birth
Feb–March
Sep–Oct
Overall
n
Alkaline phosphatase (KA units)
Acid phosphatase (KA units)
Barbari
Jamunapari
Barbari
Jamunapari
12
16
15
21
21
14
14
16
16
72.95a ± 4.25
63.74ab ± 3.85
32.11d ± 4.38
37.38d ± 3.53
34.03d ± 3.53
34.77d ± 4.67
52.36bc ± 4.52
39.82cd ± 3.55
34.41d ± 3.55
60.61a ± 4.98
51.19ab ± 4.62
35.84bcd ± 4.84
43.87bc ± 3.85
30.63d ± 3.85
21.76de ± 4.98
12.68e ± 4.84
33.09cd ± 4.98
29.84d ± 4.98
2.85a ± 0.29
2.66a ± 0.25
1.16cd ± 0.28
2.04ab ± 0.23
1.60bcd ± 0.23
1.93abc ± 0.29
0.83d ± 0.29
2.05ab ± 0.25
2.60a ± 0.25
2.82abc ± 0.28
2.60bc ± 0.24
3.63a ± 0.27
2.09c± 0.21
2.64bc ± 0.21
3.35ab ± 0.27
0.99d ± 0.27
2.56b ± 0.24
3.16ab ± 0.24
79
66
145
42.97 ± 1.90
46.27 ± 2.14
44.62 ± 1.30
39.32α ± 2.23
31.66ß ± 2.60
35.49 ± 1.53
1.64α ± 0.13
2.30ß ± 0.15
1.97 ± 0.09
2.69 ± 0.12
2.61± 0.14
2.65 ± 0.08
n= no. of observations for each breed;means marked with different a, b, c, d, e (superscript) in a column between ages indicates DMRT
significance (P<0.05).
Means marked with different α, ß (superscript) in a column between season of birth indicates DMRT significance (P<0.05).
significantly higher (2.85±0.29 KA units) at birth and
remained high up to 1 month of age. At 3 month of age, it
decreased significantly and showed fluctuating trend up to
one year of age. At pre-pubertal age, it attained significant
low value (0.83±0.30 KA units). At pubertal and at postpubertal age, it again increased significantly and attained
value of 2.05±0.25 and 2.60±0.25 KA units respectively. In
Jamunapari goats, activity of acid phosphatase was
significantly higher (3.63±0.27KA units) at 3 months of age.
The activity decreased and remained lower from 6 months
to 1 year of age. The activity further decreased significantly
and attained the lowest level (0.99±0.27 KA units) at prepubertal age. At pubertal and post pubertal ages, it again
increased significantly and attained values of 2.56±0.24 and
3.16±0.24 KA units respectively.
The activity of acid phosphatase during February–March
and September–October seasons of birth in Barbari goats
were 1.64±0.13 and 2.30±0.15 KA units, respectively, which
were significantly different. In Jamunapari goats, the means
during 2 seasons of birth were 2.69±0.12 and 2.61±0.14 KA
units; respectively, which were not significantly different
from each other.
In Black Bengal kids, the acid phosphatase showed change
with increase in age (Kalita and Mahapatra 1998).
Both the phosphatases are intracellular enzymes
associated with energy transformation during cellular activity.
However, in plasma they represent the enzyme leaked out
from the cells. The higher levels of these enzymes in new
born kids appear to be due to the higher metabolic rate in
cells of the new-born due to higher enzymatic activity
required for energy supply thus resulting in greater leakage.
The higher levels recorded during sexually active period can
be due to higher metabolic activity resulting in passage of
enzyme through cell membrane.
Steroid hormones
Estrogen (pg/ml):Least square analysis of variance
(Table 2) indicated that the estrogen level was significantly
different (P<0.01) at different ages of goats. Estrogen showed
a significant positive association with alkaline phosphatase
(+0.13*). There was a low association of estrogen with acid
phosphatase.
In Barbari breed, the estrogen level at birth was
significantly higher (61.05±3.06 pg/ml). Thereafter, it
decreased and remained significantly low up to pre-pubertal
age. At puberty, estrogen level increased significantly and
attained the highest level of 103.83±3.25 pg/ml at puberty.
Again, it attained significantly low level after one week of
estrus.
In Jamunapari goats, the estrogen level at birth was
significantly higher (58.77±2.29 pg/ml). Thereafter, it
decreased and remained significantly low up to pre-pubertal
age. At puberty, estrogen level increased significantly and
attained highest level of 102.41±2.43 pg/ml. Again it attained
significantly low level after 1 week of estrus.
Estrogen stimulates bone growth in young ruminants and
exhibits other anabolic effects. In Barbari and Jamunapari
goats, estrogen level was higher at birth. Thereafter, it
decreased abruptly and remained low up to 3 months of age.
There is a small increase in estrogen level from 6 months of
age to pre-pubertal age. Hormonal levels begin to rise at the
age of 4–5 months. A small rise up to 2 pg/ml was measured
51
324
BHOOSHAN ET AL.
[Indian Journal of Animal Sciences 80 (4)
Table 2. Least square mean ± SE of estrogen (ng/ml) and progesterone (pg/ml) at various ages for Barbari and Jamunapari goats
Age (Days)
Birth
30
90
180
270–300
330–360
Pre-pubertal
Pubertal
Post-pubertal
Overall
n
9
12
9
8
8
8
8
8
8
78
Estrogen (pg/ml)
Progesterone (ng/ml)
Barbari
Jamunapari
Barbari
Jamunapari
61.05b ± 3.06
22.72c ± 2.65
22.65c ± 3.06
27.93c ± 3.25
29.02c ± 3.25
30.79c ± 3.25
32.05c ± 3.25
103.83a ± 3.25
31.00c ± 3.25
40.12 ± 1.05
58.77b ± 2.29
24.89cd ±1.99
22.25d ± 2.29
29.89c ± 2.43
25.92cd ± 2.43
28.99cd ± 2.43
30.50c ± 2.43
102.41a ± 2.43
29.74cd ± 2.43
39.46 ± 0.78
12.43a ± 0.43
0.74c ± 0.38
0.88c ± 0.43
0.70c ± 0.45
0.68c ± 0.45
0.76c ± 0.45
0.81c ± 0.45
0.91c ± 0.45
9.28b ± 0.45
3.02± 0.15
13.36a ± 0.54
0.74b ± 0.47
0.73b ± 0.54
0.79b ± 0.58
0.80b ± 0.58
0.81b ± 0.58
0.81 b ± 0.58
1.40 b± 0.58
11.90a ± 0.58
3.48 ± 0.19
n= no. of observations for each breed; means marked with different a, b, c, d (superscript) in a column between ages indicate DMRT
significance (P<0.05).
in oestradiol at the transition from the pre-pubertal to the
pubertal period (Khanum et al. 2000).
Estrogen hormones also control development of all female
secondary sex characteristics and play a major role in
mammary gland development. At puberty, the estrogen level
was maximum (103.83±3.25 and 102.41±2.43 pg/ml,
respectively) in Barbari and Jamunapari breeds. In goats of
mixed breed also, there was change in the plasma estradiol17α during estrous cycle. The concentration did not fluctuate
much during the day of estrus (Leyva- Ocariz et al. 1995).
On the day of fertile heat the estradiol concentration was
22.25±9.07 and 7.56±1.04 pg/ml for Surti and Marwari goats,
respectively (Patel et al. 1992). The average concentration
of estradiol-17â on the day of oestrus (Surti, 15.54 pg/ml,
Marwari, 15.39 pg/ml) was significantly higher for both the
breeds of goat, as compared to other stages of oestrous cycle
(Pathak et al. 1990 and Pathak et al. 1992). One week after
puberty, the estrogen level decreased. Similarly in Surti and
Marwari goats the level decreased gradually as the luteal
phase advanced, i.e. up to day 13 of the oestrous cycle (Pathak
et al. 1992).
Progesterone (ng/ml): The means of progesterone in
Barbari and Jamunapari goats from birth to post-pubertal
ages have been given in Table 2. Least square analysis of
variance indicated that there was significant difference
(P<0.01) at different ages. A significant positive trend of
association of progesterone was noted with acid phosphatase
(+0.19*) and alkaline phosphatase (+0.30**).
The overall means of progesterone (ng/ml) for Barbari
and Jamunapari goats irrespective of age were 3.02±0.15 and
3.48±0.19 ng/ml respectively. In Barbari breed, the
progesterone level at birth was significantly higher.
Thereafter, it decreased and remained significantly low up
to the pubertal age. It attained the highest level at post
pubertal age.
In Jamunapari goats, the progesterone level was
significantly higher at birth. It decreased significantly up to
pubertal age. Thereafter it increased and attained significantly
high level of 11.90±0.58 ng/ml at post pubertal age.
In Toggenburg and Alpine goats, neither serum estradiol
and progesterone nor faeces estrogen and progesterone
concentrations were affected by breed (Capezzuto et al.
2008). At puberty, the estrogen level was maximum in both
the breeds. Similarly in Damascus does, plasma estradiol
levels increased significantly (P< 0.01) during the estrous
cycle (Gaafar et al. 2005).
In Ethiopian Menz ewe lambs, a progesterone
concentration was basal (<1.0 ng/ml) before puberty (Mukasa
–Mugerwa and Mutiga 1993). It increased slightly at prepubertal age. In temperate and tropical ewe lambs also, there
was transient increase in progesterone before puberty (Quirke
et al. 1985 and Oyedipe et al. 1986). In Hebsi and Zomri
goats, plasma progesterone concentration was <0.5 ng/ml
during the pre-pubertal period and >2 ng/ml at first oestrus
(Al-Hozab and Basiquni 1999). During the pre-pubertal
period, progesterone remained at basal level of 0.1 to 0.5 ng/
ml (Khanum et al.2000).
In the present study, the progesterone level was 0.91 ±
0.45 and 1.40 ± 0.58 ng/ml, respectively on the day of oestus
in Barbari and Jamunapari goats. Similarly, the progesterone
level was low on the day of oestrus in Surti (0.5 ng/ml) and
Marwari (0.76 ng/ml) (Pathak et al. 1990), in German Dairy
× Boer goat does (0.10 ng/ml) (Bauernfield and Holtz 1991)
and in Damascus does (0.69 ± 0.85 nmol/l) (Zarkawi and
Soukouti 2001). In the present study, the progesterone level
reached the highest level at post-pubertal age or 1 week after
oestrus. Similarly, it increased and reached to a peak by day
9 in Surti and by day 13 in Marwari goats (Pathak et al.
1992), by day 12 to 15 in Alpine × Nubian crossbred goats
(10–12 ng/ml) (Leyva–Ocariz et al. 1995) and by day 12 in
Damascus does (4.2 ± 0.1 ng/ml) (Gaafar et al. 2005) of
oestrous cycle. These transient elevations may be useful for
normal corpus luteum function (Mcleod and Haresign
1984).
52
April 2010]
PHOSPHATASE ENZYMES AND STEROID HORMONES IN GOATS
ACKNOWLEDGEMENT
325
Mathai E and Nirmalan G. 1992. Enzyme profile during growth
and oestrous cycle in goats. Recent Advances in Goat
Production. Proceedings of 5th International Conference on
Goat. New Delhi. pp. 1341–47.
McLeod B J and Haresign W. 1984. Evidence that progesterone
may influence subsequent luteal function in the ewe by
modulating preovulatory follicle development. Journal of
Reproduction and Fertility 71: 381–86.
Mukasa-Mugerwa E. and Mutiga ER. 1993. Prepubertal plasma
progesterone patterns in Ethiopian Menz ewe lambs. Journal
of Applied Animal Research 3: 31–38.
National Research Council (NRC). 1981. Nutrient Requirement of
Domestic Animal. No. 15. Nutrient requirement of goats.
Angora, Dairy and meat goats in temperate and tropical
countries. National Academy of Sciences, National Research
Council, Washington, D.C.
Bhooshan N and Kumar P. 2007. Profile of ovarian and thyroid
hormones, alkaline phosphatase and cholesterol at oestrous
cycle, gestation and early lactation in blood plasma of Marwari
goats. Indian Journal of Animal Sciences 77(12): 1233–37.
Oyedipe E O, Pathiraja N, Edqvist L E and Bewanendran V. 1986.
Onset of puberty and oestrous cycle phenomenon in Yankasa
ewes as monitored by plasma progesterone concentration.
Animal Reproduction Science 12: 195–99.
Patel A V, Pathak M M, Mehta V M and Janakiraman K. 1992.
Circulating levels of hormones in pregnant goats. Recent
Advances in Goats Production. Proceedings of 5th International
Conference on Goats. pp. 1371–772. 8th March, New Delhi.
Pathak M M, Patel A V, Jaiswal R S and Mehta V M. 1990.
Circulating levels of progesterone and oestrogen in cyclic goats.
Indian Journal of Animal Sciences 60(7): 836–37.
Pathak M M, Patel A V, Jaiswal R S, Mehta V M and Janakiraman
K. 1992. Circulating hormone levels in cyclic goats. Proceedings
of 5th International Conference on Goats, pp. 1383–872.
8th March, New Delhi.
Quirke J F, Stabenfeldt G H and Bradford G E. 1985. Onset of
puberty and duration of the breeding season in Suffolk,
Rambouillet, Finish Landrace, Dorset and Finn-Dorset ewe
lambs. Journal of Animal Sciences 60: 1463–71.
Ramachandran S V, Rao P N, Rao P R and Rao A R. 1980.
Histological, histometrical and histochemical changes in the
uterine and oviductal epithelium of ewes during oestrous cycle.
Indian Journal of Animal Sciences 50: 41–45.
Sandhu A K, Saini A and Randhawa R S. 2001. Haematological
studies in healthy goats. Indian Veterinary Journal 78(7): 590–
93.
Singh N and Rajya B S. 1982. Histochemical studies on the ovary
uterus and vagina of goats. Indian Journal of Animal Health
21: 1–3.
Snedecor G W and Cochran W G. 1994. Statistical Methods. 8th
edn. The Iowa State Univ. Press, USA.
Zarkawi M and Soukouti A. 2001. Serum progesterone levels using
radio immunoassay during oestrous cycle of indigenous
Damascus does. New Zealand Journal of Agricultural Research
44(2/3): 165–69.
Sincere thanks are due to Director, CIRG, for
providing all necessary facilities to carry out the present
investigation.
REFERENCES
Adaval S G, Morris I D and Khare S G. 1969. Serum alkaline and
acid phosphatase activity and inorganic phosphorus in goats.
Indian Veterinary Journal 46: 485–90.
Al-Hozab A and Basiquni G. 1999. Onset of puberty in Hebsi and
Zomri goats as monitored by plasma progesterone
concentrations. Journal of Applied Animal Research 15(1): 69–
74.
Bauernfield M and Holtz W. 1991. Progesterone and estrogen levels
in serum of cycling goats measured by enzyme immunoassay.
Small Ruminant Research 6: 95–102.
Bogin E, Shimshony A, Avidar Y and Israli B. 1981. Enzymes,
metabolites and electrolytes levels in the blood of local Israeli
goats. Zentralblatt-fur-Veterinarmedizin-A 28(2): 135–40.
Brar R S, Sandhu H S and Singh A. 2000. Veterinary Clinical
Diagnosis by Laboratory Methods. Kalyani Publishers, New
Delhi.
Capezzuto A, Chelini M O M, Flippe E C G and Oveira C A. 2008.
Correlation between serum and fecal concentrations of
reproductive steroids throughout gestation in goats. Animal
Reproduction Science 103: 78–86.
Daramola J O, Adeloye A A, Fatoba T A and Soladoye A O. 2005.
Haematological and biochemical parameters of West African
Dwarf goats. Livestock Research and Rural Development 17(8):
90–95.
Freeland R A and Szepesi A. 1971. Control of enzyme activity
nutrition factors. Enzyme Synthesis and Degradation in
Mammalian System. (Ed.) Recheigi M. Univ., Parl Press,
Baltimore.
Gaafar K M, Gabr M K and Teleb D F. 2005. The hormonal profile
during the estrous cycle and gestation in Damascus goat. Small
Ruminant Research 57: 85–93.
Harvey W R. 1990. User’s Guide for MIXMDL PC-2 version Mixed
Model Least –Squares and Maximum Likelihood Computer
Program (Mimeo). Ohio State University, Columbus, OH.
Kalita D J and Mahapatra M. 1998. Serum constituents and serum
enzyme activities of Black Bengal kids. Indian Journal of
Animal Research 32: 38–40.
Khanum S A, Hussain M, Ali M, Kausar R and Cheema A M. 2000.
Age at puberty in female dwarf goat kids and estrous cycle length
on the basis of hormones. Pakistan Veterinary Journal 20: 71–
74.
Kramer C Y. 1957. Extension of multiple range tests to group
correlated adjusted means. Biometrics 13: 13–18.
Leyva-Ocariz H, Munro C and Stabenfeldt G H. 1995. Serum LH,
FSH, estradiol-17 β and progesterone profiles of native and
crossbred goats in a tropical semiarid zone of Venezuela during
the estrous cycle. Animal Reproduction Science 39: 49–58.
53
Short Communications
Indian Journal of Animal Sciences 80 (4): 326–328, April 2010
Comparison of PCR with conventional techniques for the diagnosis of
brucellosis in cattle
P KAUSHIK1, D K SINGH 2 and A K TIWARI 3
Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh 243 122 India
Received: 10 April 2009; Accepted: 28 November 2009
Key words: Brucella, Cattle, Polymerase chain reaction (PCR)
Brucellosis is a major zoonotic disease endemic in many
parts of the world. It is characterized by chronic infection in
animals leading to abortion and infertility. The disease is
caused by Brucella which is gram negative, nonsporeforming, facultative intracellular organism (Cardoso et al.
2006). It consist of 7 species (Ko and Splitter 2003) based
on antigen variation and primary host: B. melitensis (sheep
and goat), B. abortus (cattle), B. suis (swine), B. ovis (rams),
B. canis (dogs), B. neotomae (wooden rats) and recently
recognized B. maris (marine mammals). Besides, restriction
in the international trade of animal and animal products, the
disease can be transmitted to humans following contact with
infected animals or through consumption of contaminated
milk and milk products (Young et al. 1985). Serological
assays used for the diagnosis of Brucella infection include
Rose Bengal plate agglutination test (RBPT), serum tube
agglutination test (SAT), compliment fixation test (CFT) and
enzyme linked immunosorbant assay (ELISA); however,
bacteriological isolation remains the definitive method
(Chand et al. 2005). But the tedious isolation process and
risk to the laboratory personnel to infection limits regular
use of bacteriological isolation in diagnosis. Apart from this,
brucellae could not be isolated many a times even from
known positive cases (Probert et al. 2004). Therefore, a rapid,
sensitive and specific tool like polymerase chain reaction
(PCR) for precise detection and identification of such a
fastidious organism(s) from a variety of samples (Amin et
al. 2001, Leyla et al. 2003 and Probert et al. 2004) is being
exploited. Several PCR based methods have been described
for the detection of Brucella species using bacterial isolates
and field samples (Leal-Klevezas et al. 2000). The present
study compares PCR with isolation of Brucella from different
samples vis a vis conventional test, viz. RBPT and SAT.
A total of 45 samples including blood (15), vaginal swabs
(15) and milk (15) were collected simultaneously from cattle
population from the dairy farm of the Indian Veterinary
Research Institute, Izatnagar. The samples were collected
aseptically and immediately transported to laboratory under
cold condition. The milk samples were processed for
bacteriological isolation as described by Alton et al. (1995)
and incubated at 37°C under 5% CO2 for several days and
inspected regularly for the development of Brucella, like
colonies. The blood containing sodium citrate was inoculated
onto Ruiz Castaneda biphasic medium (Leal-Klevezas et al.
2000). The vaginal swabs were washed properly in 2 ml of
sterilized phosphate buffer saline (PBS; pH 7.4) and were
inoculated onto Ruiz Castaneda biphasic medium as for the
blood.
The serum were tested by RBPT and SAT as per the
standard method (Alton et al. 1975). Serum samples,
exhibiting any degree of clumping of coloured antigen in
RBPT and 50% agglutination reaction at a dilution of 1: 40
or above in SAT were considered positive. The DNA was
extracted from whole blood as described by Leal- Klevezas
et al. (2000) whereas DNA extraction kit (Biogene) was used
for extracting DNA from fatty top layer of raw milk and
vaginal swab washing (each 400 μl) as per the manufacturers
guidelines. PCR was performed in 50 μl containing 5 μl of
10X PCR buffer (500 mM KCl, 100 mM Tris- HCl, pH 9.0),
200 μM each of the 4 deoxynucleotide triphosphates, 1U
Taq DNA polymerase, 8 pmol each of the primers derived
from the BCSP–31 sequence (Serpe et al. 1999) of B. abortus
(Forward 5’ GGG CAA GGT GGA AGA TTT 3’ and Reverse
5’ CGG CAA GGG TCG GTG TTT 3’) and 5 μl of template
DNA. The amplification was carried out in mastercycler
gradient thermocycler with a preheated lid at a denaturation
temperature of 94°C for 3 min followed by 35 cycles at 94°C
for 45s, 53°C for 45s and 72°C for 5 min. Electrophoresis of
PCR product was carried out on 1.5% (w/v) agarose gel in
tris-borate EDTA (TBE; 0.5X) to visualize 443bp product in
positive samples after staining with ethidium bromide.
Out of 15 blood samples, 13 were positive in RBPT and
Present address: 1Assistant Professor, Department of Veterinary
Public Health, Bihar Veterinary College, Patna, Bihar, India.
2, 3Division of Veterinary Biotechnology.
54
April 2010]
COMPARISON OF DIAGNOSTIC TECHNIQUES FOR BRUCELLOSIS
of these positive samples, 6 were also positive in SAT with a
cut off titre of 80. The PCR was positive in 2 blood samples
of animals positive in SAT and RBPT. The result of RBPT
and SAT, where 7 samples positive by RBPT turned out as
negative in SAT, corroborates the findings of Morgan (1974).
Moreover, the RBPT recommended by WHO/FAO Expert
committee as a screening test (Anonymous 1986), has been
reported to be an oversensitive test (Alton et al. 1975a). The
other 6 animals were positive to both RBPT and SAT. No
isolation of Brucella could be made from any of the blood,
milk and vaginal swabs taken from these animals. But the
blood and vaginal swabs from 2 of these 6 animals, which
tested positive by both serological tests, were also positive
by PCR. Although cultural isolation is the gold standard in
the microbial diagnosis, it may sometimes be abolished by
factors inherent to the microbes besides it is tedious and not
possible to isolate Brucella every time even from the known
positive cases (Ray 1979). The observation in the present
study that two culture negative but seropositive animals tested
positive by PCR supports this contention. In case of vaginal
swab, this could even be due to massive contamination of
the samples or viability loss of the organism before culturing
(Ray 1979) and in all these circumstances DNA can still be
detected by PCR. However, the intracellular nature of bacteria
may affect the proper release of Brucella from leukocyte
and results in the negative isolation of Brucella from blood
samples. Brucellae are excreted in milk intermittently which
may explain the negative PCR result on milk samples from
these animals. Alternatively, this could be because of the
presence of the PCR inhibitors or number of organisms below
the detection limit, in the milk.
The sensitivity of PCR to detect brucellae from milk was
also determined by serially diluting B. abortus S19 in
uncontaminated milk, followed by DNA isolation as above,
which detected as low as 40 cells/ml of milk, which is higher
than the previous report (Romero et al. 1995). This detection
limit can be further increased by reducing sampling error,
since random distribution of the cells in a sample may not
have the exact number of cells or gene copy as has been
calculated to contain (Wilson 1997). The sensitivity of the
test in spiked blood was not performed due to the intracellular
nature of the organism in leukocytes. The specificity of the
PCR was confirmed by amplification of DNA extracted from
different strains of Brucella and the lack of amplification of
DNA extracted from closely related organisms, viz.
Escherichia coli, Vibrio cholerae, Campylobacter coli,
Listeria monocytogenes, L. ivanovi and Salmonella
Typhimurium. The failure to detect amplified fragments in
the DNA template of the related bacteria supported the
specificity of this PCR as a genus specific assay in the
detection of brucellae. The results indicated the superiority
of the PCR for detecting small amount of the pathogen in
various samples over isolation proving the PCR as a highly
sensitive, reliable and specific method for detection of
327
Brucella species from various clinical samples and can be
used as an adjunct to serological tests in diagnosis of
brucellosis. However, there is a need to improve the
sensitivity of the PCR.
SUMMARY
Brucellosis is still a wide-spread zoonosis of international
importance. In the present study, a PCR has been compared
with conventional methods for detection of brucellosis, viz.
RBPT, SAT and bacteriological isolation of the agent. The
PCR was found highly specific for identification of Brucella.
No isolations could be made even from the animals which
were positive to RBPT, STAT and PCR. The study indicated
that the PCR could be used as an adjunct in the diagnosis of
brucellosis.
ACKNOWLEDGEMENT
The authors are thankful to the Head, Division of
Veterinary Public Health and the Director, Indian Veterinary
Research Institute, Izatnagar, for providing necessary
facilities to carry out the present work. Financial grant
received by the first author in the form of fellowship is also
acknowledged.
REFERENCES
Alton G G, Johnes L M and Pietz D E. 1975. Laboratory Techniques
in Brucellosis. TRS No.55. WHO, Geneva, Switzerland.
Alton G G, Maw J, Rogerson B A, Mc Pherson G G. 1975a. The
serological diagnosis of ovine brucellosis: an evaluation of the
complement fixation, serum agglutination and rose Bengal test.
Australian Veterinary Journal 51: 57–63.
Amin A S, Hamdy M E R and Ibrahim A K. 2001. Detection of
Brucella meletensis in semen using the polymerase chain
reaction assay. Veterinary Microbiology 83: 37–44.
Anonymus. 1986. Joint FAO/WHO Expert Committee on
Brucellosis. TRS No. 740. WHO, Geneva.
Cardoso P G, Macedo G C, Azevedo V and Oliveira S C. 2006.
Brucella spp noncanonical LPS: structure, biosynthesis, and
interaction with host immune system. Microbial Cell Factories
5: 1–11.
Chand P, Rajpurohit B S, Malhotra A K and Poonia J S. 2005.
Comparison of milk- ELISA and serum- ELISA for the diagnosis
of Brucella melitensis infection in sheep. Veterinary
Microbiology 108: 305–11.
Ko J and Splitter G A. 2003. Molecular host pathogen interaction
in brucellosis: current understanding and future approaches to
vaccine development for mice and humans. Clinical
Microbiology Review 108: 65–78.
Leal-Klevezas D S, Martinez-Vazque I O, Garciacantu J, LopezMerino A and Martinez-Soriano J P. 2000. Use of polymerase
chain reaction to detect Brucella abortus biovar 1 in infected
goats. Veterinary Microbiology 75: 91–97.
Leyla G, Kadri G and Umran O K. 2003. Comparison of polymerase
chain reaction and bacteriological culture for the diagnosis of
sheep brucellosis using aborted fetus sample. Veterinary
Microbiology 93: 53–61.
55
328
KAUSHIK ET AL.
Morgan W J B. 1974. the diagnosis, control and eradication of
bovine brucellosis in Great Britain. Veterinary Record 94: 510–
17.
Probert W S, Schrader K N, Khuong N Y, Bystrom S L and Graves
M H. 2004. Real-time multiplex PCR assay for detection of
Brucella spp., B. abortus and B. melitensis. Journal of Clinical
Microbiology 42: 1290–93.
Ray W C. 1979. Brucellosis due to Brucella abortus and B. suis,
Hand Book Series in Zoonosis. Vol. 1, CRC Press Inc., Boca
Raton, Florida. pp. 99–185.
Romero C, Pardo M, Grillo M J, Diaz R, Blasco J M and LopezGoni I. 1995. Evaluation of PCR and indirect enzyme-linked
immunosorbent assay on milk samples for diagnosis of
[Indian Journal of Animal Sciences 80 (4)
brucellosis in dairy cattle. Journal of Clinical Microbiology 33:
3198–3200.
Serpe L, Gallo P, Fidenza N, Scaramuzzo A and Fenizia D. 1999.
Single-step method for rapid detection of Brucella spp. in soft
cheese by gene specific polymerase chain reaction. Journal of
Dairy Research 66: 313–17.
Wilson I G. 1997. Inhibition and facilitation of nucleic acid
amplification. Applied Environmental Microbiology 63: 3741–
51.
Young E J, Borchert M M, Kretzer F L and Musher D M. 1985.
Phagocytosis and killing of Brucella by human
polymorphonuclear leukocytes. Journal of Infectious Diseases
151: 682–90.
56
Indian Journal of Animal Sciences 80 (4): 329–330, April 2010
Therapeutic and residual efficacy analysis of some anti-tick compounds against
natural Boophilus microplus infestation in crossbred cattle
HIRA RAM1 and A K SHARMA2
Indian Veterinary Research Institute, Campus Mukteswar, Uttarakhand, 263138 India
Received : 15 March 2009;Accepted: 4 October 2009
Key words: Boophilus microplus, Cattle, Residual efficacy, Therapeutic efficacy
Effective control of tick infestation on animal is mainly
carried out by the use of acaricides. Reports on therapeutic
and residual drug efficacies of the dips or spray formulations
of generally used acaricides are also available (Srivastava et
al. 2001, Vatsya et al. 2007). However, such information is
missing for recently available anti-tick compounds having
different modes of application (injectable and pour on
preparations). Present study was performed with the objective
to record efficacy and duration of protection of avermectins
(ivermectin and doramectin injections) and flumethrin (pour
on) preparations against natural B. microplus infestation in
crossbred cattle.
Study was conducted at the experimental cattle herd of
Indian Veterinary Research Institute, Mukteswar, located 29°
25N, 79° 35E, and 7500′ above the mean sea level (msl)
during the monsoon period in 2004. In the study area total
annual rainfall recorded was 1067.1 mm (maximum 318 mm
in August) whereas annual average humidity was 51.5%
(maximum 94% in August and minimum 40% in December).
Mean maximum temperature in area ranges between 25.7°C
in May (highest) and 11.7°C in January (lowest). Animals
(crossbred cattle) of this farm graze daily (partial grazing)
in the surrounding forest in addition to the standard
concentrate, hay, silage or oak leaves supplementation and
ad lib. water supply in the shed under scientific supervision.
Previous tick management practices at this farm indicate 6
to 8 applications of cypermethrin compounds (body spray)
in all animals in one calendar year because of severe tick
infestation. For this study naturally infested 18 crossbred
cattle, having more than 500 visible adult ticks on body
surface (male, female both) were selected and divided into 3
groups of 6 animal each (group A, B and C). Representative
tick samples for identification were collected from other
animals of the farm and they were also treated along with
this trial using either avermectins (injectable) or with
flumethrin (pour on) to minimize over all tick load at the
farm.
Three drugs having different mode of application
(ivermectin, doramectin, and flumethrin) rather than dip or
body spray (cypermethrin) were selected as a part of strategy
to break resistance power of ticks, gained if any in the past.
Pre-treatment tick counts of individual animals were
performed by counting the number of ticks on one side of
animal and than by multiplying with a factor of 2 to get the
total number. All animals of group-A received ivermectin
injection (1% w/v) @ 0.2-mg/kg body weight (b.wt.) by
subcutaneous route whereas; animals of group-B were treated
with doramectin injection (1% w/v) at dose and route as
mentioned above for ivermectin. Further, group C animals
were treated with flumethrin (1% w/v, pour on) @ 1 ml/10
kg b.wt by applying the drug on the dorsum of animals. Tick
survival on the animal body was recorded at weekly interval
till the appearance of re-infestation of ticks and comparative
efficacy was calculated by indirect assessment of per cent
tick survival (group average) on seventh day post treatment
(DPT), with reference to the average zero day tick count in a
group.
Existing severe tick infestation on animals at this farm
seems to be due to previous continuous applications of
cypermethrin (body spray) alone, leading to resistance
progenies of B. microplus in the area of study. Zero day
observation on tick counts revealed an average 650, 716 and
742 ticks on the body of groups A, B and C animals,
respectively. Therapeutic efficacy calculated on seventh DPT
revealed 95, 96 and 97% tick reduction from the animal’s
body in ivermectin, doramectin and flumethrin treatment
groups respectively (Table 1). Male and fully engorged
female ticks were not found over the animal’s body, but
partially engorged females were found to survive in all
treatment groups on seventh DPT. The number of ticks
survived on fourteenth DPT remains almost constant as like
seventh DPT. Persistent efficacy or residual effect of
ivermectin and doramectin was recorded less than 21 days
Present address: 1,2 Senior Scientist,Temperate Animal
Husbandry Division (e–mail address: hiraivri@email2me.net).
57
330
RAM AND SHARMA
[Indian Journal of Animal Sciences 80 (4)
Table 1. Observations on therapeutic and residual efficacies of anti-tick compounds against B. microplus infestation in cattle
Group
Pre and post treatment tick survival (group average)
0 DPT
A (IVM)
B (DOM)
C (FLM)
650
716
742
7th DPT
14th DPT
21st DPT
32(95% reduction)
28(96% reduction)
22(97% reduction)
Constant
Constant
Constant
re-infestation
re-infestation
Constant
Protection period
(days)
<21 days
<21 days
<28 days*
* re-infestation observed at 28 DPT in flumethrin treated group.
IVM, Ivermectin, DOM,Doramectin; FLM, Flumethrin.
in the study but the same was one week higher in flumethrin
treatment group (<28 days). Further, in spite of high level of
drug efficacy in all the treatment groups (Table 1), 100%
tick mortality was not observed in any treatment group at
prescribed dose rate. However, hundred per cent reported
efficacies of ivermectin (Kumar et al. 2005) and doramectin
(Gonzales et al. 1993) against B. microplus and flumethrin
pour on against B. decoloratus infestation in cattle
(Meconnen 2000) supports observation of this study to a great
extent. Emergence of tick re-infestation before 21 days of
treatment in ivermectin and doramectin groups indicated that
a second follow up treatment at or after third week is required
for proper tick control. However, in flumethrin treated
animal’s repetition needed at or about fourth week of first
treatment in case of heavy tick infestations especially in
crossbred cattle in similar kind of climatic and managemental
conditions.
Use of acaricides is considered backbone of tick control
programme now a days (Fuente and Kocan 2006), but their
use in animals needs to be done with great precautions. For
an effective control of B. microplus infestation on an
organized farm in Uttarakhand state of India, 5 applications
of different groups of acaricides (once in summer, thrice in
rainy season and once in winter) on animals as well as in
premises were suggested (Vatsya et al. 2007). In this context
it is also to mention that time to time monitoring of anti-tick
efficacy of drugs to be used against common tick genera and
discontinuation of low efficacious agents are also required
for effective tick control in a geographical area.
efficacy of ivermectin, doramectin and flumethrin,
respectively. However, residual drug effect (duration of
protection) for ivermectin and doramectin injections was
recorded less than 21 days in comparison to flumethrin pour
on (<28 days). Further, it is concluded from the study that a
second follow up treatment on or after third week in case of
ivermectin and doramectin (S/C injections) and on or after
fourth week in flumethrin (pour on) medication is required
for proper control of ticks in endemic areas.
ACKNOWLEDGEMENTS
Authors are thankful to the Director, Indian Veterinary
Research Institute, for providing necessary research facility.
REFERENCES
Fuente J D L and Kocan K M. 2006. Strategies for development of
vaccines for control of ixodid tick species. Parasite Immunology
28: 275–83.
Gonzales J C, Muniz R A, Farias A, Goncalves L C and Rew R S.
1993.Therapeutic and persistent efficacy of doramectin against
Boophilus microplus in cattle. Veterinary Parasitology 49: 107–
19.
Kumar S, Prasad K D, Dev A R and Kumar A. 2005. Efficacy of
ivermectin and neem with karanj oil against natural Boophilus
microplus infestation in cattle. Journal of Veterinary
Parasitology 19: 59–60.
Mekonnen S. 2000. Efficacy of flumethrin 1% pour-on against ticks
on cattle under field conditions in Ethiopia. Onderstepoort
Journal of Veterinary Research 67: 235–37.
Srivastava P K, Raizda A and Agrawal P. 2001. A comparative trial
on the efficacy of deltamethrin, cypermethrin and fenvalerate
as acaricides in livestock animals. Indian Veterinary Medical
Journal 25: 293–94.
Vatsya S, Yaday C L, Kumar R R and Garg R. 2007. Seasonal
activity of Boophilus microplus on large ruminants at an
organized livestock farm. Journal of Veterinary Parasitology
21: 125–28.
SUMMARY
Therapeutic efficacy of ivermectin and doramectin (S/C
injections) and flumethrin (pour on preparation) was
evaluated against natural Boophilus microplus infestation in
crossbred cattle. Tick mortality observed on seventh day post
treatment in different groups indicated 95, 96 and 97%
58
Indian Journal of Animal Sciences 80 (4): 331–332, April 2010
Differentiation of the tubular components and collecting duct system of nephron in
buffalo kidney during prenatal life
MONIKA SUMAN1, NEELAM BANSAL2 and VARINDER UPPAL3
Guru Angad Dev Veterinary and Animal Science University, Ludhiana, Punjab 141 004 India
Received: 20 April 2009; Accepted: 30 September 2009
Key words: Buffalo, Foetus, Histogenesis, Nephron
In literature differentiation of the duct system was reported
in goat (Gopinath 1985, Chaudhary et al. 2002)) but no work
has been reported in buffaloes so the present study was
conducted. The present study was made on kidneys of 17
Indian buffalo foetii, collected from pregnant buffaloes
slaughtered at abattoir, Saharanpur and from Veterinary
Clinics, GADVASU, Ludhiana. The curved crown rump
length (CVRL) of the foetal body was measured in
centimeters and age of the foetus was calculated by using
the formulae given by Soliman (1975). On the basis of CVRL,
the foetii were divided into 3 groups i.e. group 1 (3.0 cm to
20.0 cm), group 2 (20.1 cm to 40.0 cm) and group 3 (above
40.1 cm). The tissue of kidneys were fixed in Bouin’s and
10% neutral buffered formalin (NBF) fixatives.
After fixation the tissues were processed for paraffin
blocks preparation by acetone - benzene schedule and
sections of 5–7 μm were cut with rotary microtome. The
paraffin sections were stained with hematoxylin and eosin
and Masson’s trichrome (Luna 1968). The formation of S shaped vesicles along with metanephric tubules was seen at
3.0 cm CVRL. The tubular segments of nephron were
differentiated into proximal convoluted tubules, loop of
Henle, distal convoluted tubules and collecting ducts from
buffalo foetii of 4.1 cm CVRL onwards.
Proximal convoluted tubules (PCT): The PCT was first
observed in the 4.1 cm CVRL foetii. These were first formed
in to the juxtamedullary area and then appeared in the
intermediate and sub capsular areas of the metanephros in
the buffalo foetii at the age of 10.3 cm CVRL onwards. These
tubules were lined by simple columnar epithelium in the foetii
of 4.1 cm and 5.7 cm. The formation of microvilli (future
brush border) at the luminal end of the epithelial cells was
first formed at the age of 11.2 cm CVRL. The coiling of
PCT also appeared at this age. In the foetii of 23.0 cm CVRL
these tubules were lined by simple cuboidal to pyramidal
type of cells along with microvilli, which indicated its
reabsorptive and secretory activities as reported in goat
embryos by Gopinath (1985) and Chaudhary et al. (2002).
Loop of Henle: The PCT continue into the medullary ray
to become the proximal straight tubule (PST) also referred
as the descending thick limb of loop of Henle. This proximal
straight part of the tubule differentiated in the kidneys of
buffalo foetii at 15.0 cm CVRL in the medullary rays (Figs
1, 2). It was lined by simple columnar epithelium. The
epithelium of PST abruptly changed from simple columnar
to simple squamous. The thick ascending limb of loop of
Henle was demonstrated at the age of 23.0 cm CVRL. Similar
findings were reported by Gopinath (1985) and Chaudhary
et al. (2002) in goat embryos. In present study, loop of Henle
was observed to be having thin and thick segment in the
medulla and medullary rays of metanephos but occasionally
it was also recorded in cortical area. This might be due to the
location of subcapsular glomeruli in which the loop did not
reach up to the medulla (Banks 1993). The thin segment of
the loop was lined by simple squamous epithelium (Fig.4).
It is similar to the earlier reports of Gopinath (1985) in goat
embryos.
Distal convoluted tubules: The distal convoluted tubules
appeared in the buffalo foetii of 4.1 cm CVRL. Some of these
tubules were observed nearer to the vascular pole of
juxtamedullary glomeruli, which may be responsible for the
formation of future macula densa cells. From 23.0 cm CVRL,
these tubules were lined by simple cuboidal epithelium with
relatively less eosinophilic cytoplasm and had darkly stained
nuclei.
In group 3, the DCT had nuclear condensation, which is
referred to be as the future macula densa forming the
juxtaglomemlar apparatus as reported earlier in goat embryos
at 50 days of gestation (Chaudhary et al. 2002). Leeson
(1957) and Gopinath (1985) also reported the similar type
of epithelium of distal convoluted tubules in the embryos of
rabbit and goat, respectively. Some of the tubules had more
than one layers of epithelium at 21.5 cm CVRL, which
Present address: 1Formerly PG student, 2Associate Professor,
Professor cum Head, Department of Veterinary
Anatomy.
3 Associate
59
332
SUMAN ET AL.
[Indian Journal of Animal Sciences 80 (4)
Figs 1–4. 1. The formation of loop of Henle and collecting ducts (CD) in the medulla of 15.0 cm CRL buffalo foetus. Masson’s
Trichrome stain×87.5. 2. The continuation of medulla as medullary rays in between cortex to form renal pyramid in 18.0 cm CRL buffalo
foetus. Two adjoining juxtamedullary (JG) glomeruli could also be observed. Masson’ s Trichrome stain × 87.5. 3. The flattened epithelial
cells lining the loop of Henle (LH), light (L) and dark (D) epithelial cells of collecting tubules (CT) in 44.0 cm CRL buffalo feotus. Masson’
s Trichrome stain×175. 4. Formation of a bend with bulging epithelial cells into the lumen of loop of Henle (LH) in 75.0 cm CRL buffalo
feotus. Hematoxylin and Eosin stain×350.
indicated the process of canalization at this stage that
completed afterwards. Similar type of canalization of DCT
was also reported in metanephros of goat embryos by
Chaudhary et al. (2002).
Collecting ducts: After the formation of cortex and
medulla, the intra-renal collecting duct from its dorso-lateral
surface continued into juxtamedullary areas in the form of
medullary rays. The lining epithelium of these collecting
ducts was simple cuboidal to simple columnar type with the
chromatic nuclei in the apical region. The relative occurrence
of these tubules was more in the juxtamedullary area of the
cortex and in the medulla. The shape of collecting ducts
varied from round to ovoid. The collecting ducts were lined
by two types of cells, viz. light cells and dark cells (Fig. 3 as
reported earlier by Dellmann (1993). The light cells were
more in number as compared to the dark cells. The light cells
showed pale cytoplasm which might be due to the lack of
many organelles in these cells as reported by Dellmann
(1993). These ducts ultimately formed the large papillary
ducts which terminated at the renal papilla.
of 17 Indian buffaloes foetii were used. The tubular segments
of nephron were differentiated into proximal convoluted
tubules, loop of Henle, distal convoulted tubules and
collecting ducts from buffaloes foetii of 4.1 cm CVRL
onwards.
REFERENCES
Banks W J. 1993. Applied Veterinary Histology. 4th edn, pp 374–
89. Mosby Year book, St. Louis, USA.
Chaudhary A R, Farooqui M M and Chandra P. 2002. Histological
and certain histochemical studies on the metanephros of goat
(Capra hircus) in prenatal period-secretory part. Indian Journal
of Veterinary Anatomy 14: 8–15.
Dellmann H D. 1993. Textbook of Veterinary Histology. pp 213–
21. Lea and Febiger, Philadelphia, USA.
Gopinath S. 1985. ‘Morphogenesis of the kidney in goat.’ Ph. D.
dissertation. Haryana Agricultural University, Hisar. India.
Leeson T S. 1957. The fine structure of the mesonephros of
the 17–day rabbit embryo. Experimental Cell Research 2:
670–72.
Luna L G. 1968. Manual of histologic staining: Methods of Armed
forces Institute of Pathology. 3rd edn, pp 38–196. McGraw Hill
Book Co, New York, USA.
Soliman M K. 1975. Studies on the physiological chemistry of the
allantoic and amniotic fluid of buffaloes at various periods of
pregnancy. Indian Veterinary Journal 52: 111–17.
SUMMARY
Differentiation of the tubular components and collecting
system of nephron in buffalo kidney during prenatal, was
observed and reported in this study. For this study kidneys
60
Indian Journal of Animal Sciences 80 (4): 333–335, April 2010
Histogenesis of lingual epithelium during prenatal life in buffalo
DEEPANJALI VERMA1, VARINDER UPPAL2 and NEELAM BANSAL3
Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab 141 004 India
Received: 20 April 2009; Accepted: 30 September 2009
Key words: Buffalo foetii, Lingual epithelium
In literature the histogenesis of the tongue has been reported
in rat (Farbman 1965), mouse (Cameron 1966), goat (Parmar
et al. 1999) and crossbred pig (Sarma et al. 2003) but very
scanty literature is available on buffaloes so the present study
was conducted. The present study was conducted on tongues
of 36 buffalo foetii (age ranging from 34 to 298 days). Curved
crown rump length (CVR length) of the foetii was measured
along the vertebral column between the most anterior part of
frontal bone to the rump at ischiatic tuberosity and age of the
foetii was estimated by using the formula given by Soliman
(1975) in buffalo. Based on the CVR length the foetii were
divided into 3 groups, foetii between 0–20 cm CVR; 2: foetii
between 20–40 cm CVR, and group 3: foetii above 40 cm CVR.
The tissues were taken from different parts of the tongue and
fixed in Neutral buffered formalin and Bouin’s fixatives
immediately after collection.
After the fixation, the tissues were processed for paraffin
blocks preparation by acetone benzene schedule (Luna 1968).
The blocks were prepared and the sections of 5–6 μm were
cut with the help of rotary microtome. These paraffin sections
were stained with hematoxylin and eosin and Masson’s
trichrome stains. The micrometrical observations of the
epithelium thickness were recorded on the hematoxylin and
eosin stained sections.
In group 1 at 1.2 cm CVR length (34 days), the tongue
was lined by a single layer of cells. Further at 2.5 cm CVR
length (40 days), the tongue was lined by 2 layers of
epithelium; a deep layer of cuboidal cells and a superficial
thin sheet of cells. This thin sheet of cells was observed from
2.5 cm CVR length (40 days) to 6.0 cm CVR length (55
days) and had been described as periderm cell layer (Jung et
al 2004). At 3.4 cm CVR length (44 days), the dorsal surface
of the tongue was usually lined by 3-layered epithelium; a
basal layer of cuboidal cells, an intermediate layer and a
superficial layer of squamous cells (Figs a, b) as observed in
rabbit at 15th day of prenatal life (Kulawik 2005) and in
goat foetuses at 10.0 cm CRL (Parmar et al. 1999). With
further advancement of age the basal layer of the epithelium
comprised high cylindrical cells along with well defined
basement membrane. Cells in the stages of mitosis were
frequently observed in epithelium. As compared to dorsal
surface the ventral surface was lined by a single layer of
cuboidal or low columnar type of cells.
At 10.7 cm CVR length (77 days), the lamina epithelialis
was distinctly stratified and was divided into dark basal and
light superficial zones (Fig. c) as reported earlier in buffalo
at 79th day (Uppal et al. 2006) and at 30–35 cm CVR length
foetii (Scala et al. 2005) but no signs of keratinization were
observed. The basal layer was made up of cuboidal or
columnar type of cells with rounded nuclei as observed by
Kulawik (2006) at 22nd day of prenatal life in rabbit whereas
the other layers were having round or polygonal cells. Most
of the cells were having eccentric nucleus as reported in the
differentiation of ruminal epithelium (Singh 2002). The
nuclei of the surface layer were almost flattened as observed
by Kulawik (2005) in rabbit at 18th day of prenatal life. The
ventral surface was lined by basal layer of cuboidal cells
and 3–4 superficial layers of polygonal cells with a high
nucleus to cytoplasm ratio (Fig. d) while Farbman (1971)
observed 5–8 layer thick epithelium in rat foetus by E14.
Further, this stage of development was characterized by the
appearance of regularly spaced dermal papillae formed by
evagination and invagination of epithelium on the dorsal
surface however such type of papillae were not observed on
the ventral surface as reported in rat (Farbman 1971). During
this period the interpapillary epithelium increased in
thickness and dermal papillae increased in length, which was
due to the arrested mitosis in the basal epithelial layer at the
base of the dermal papillae and absent in overlying apex but
interpapillary epithelium continues to grow by mitosis
(Baratz and Farbman 1975, Farbman 1971).
In group 2 at 21.4 cm CVR length (122 days), the stratified
squamous epithelium was better differentiated at both the
dorsal (Fig. e) and ventral surfaces. All the layers of
epithelium could be well recognized at 29.0 cm CVR length
(139 days). The first indication of presence of keratohyaline
granules was observed at 29.0 cm CVR length (139 days) on
Present address: 1Ph.D student, 2Associate Professor, 3Associate
Professor-cum-Head, Department of Anatomy.
61
334
VERMA ET AL.
[Indian Journal of Animal Sciences 80 (4)
of keratinization between different species may be different
due to difference in the duration of the gestation period
(Iwasaki et al. 1999).
In the present study the first evidence of keratinization
was observed in group 3. The epithelium covering the dorsal
surface was thicker while that of the ventral surface was
thinner as reported by Dellmann (1993).
The mean epithelium thickness on the dorsal surface of
apex was 81.49±2.88 μm in group 1, 106.36±7.44 μm in
group 2 and 437.24±20.06 μm in group 3. Singh (2001)
reported epithelium thickness to be 468.00±45.20 μm in
neonate buffaloes. The mean epithelium thickness on the
ventral surface of apex was 59.85±4.03 μm in group 1,
74.21±4.12 μm in group 2 and 118.05±5.28 μm in group 3,
while Singh (2001) observed the 280.00±43.8 μm in neonatal
buffalo. The mean epithelium thickness at body in group 1,
2 and 3 was 72.97±1.91 μm, 97.89±7.21μm and
402.28±27.68 μm, respectively, whereas Singh (2001)
observed 416.30±56.20 μm in neonatal buffalo.Epithelium
thickness at the level of torus was 77.06±3.71 μm in group
1, 199.47±18.85 μm in group 2 and 417.16±23.93 μm in
group 3. Our values in group 3 collaborates well with the
values of Singh (2001) in buffalo neonates who reported
412.3±90.6 μm thickness at the levels of torus. Epithelium
thickness at the root of the tongue in group 1, 2 and 3 was
68.86±2.47 μm, 180.98±17.82 μm and 317.71±8.41 μm
respectively. A statistically significant difference (P<0.05)
was observed between epithelium thickness at all the parts
among group 1, 2 and 3.
Figs a–f. (a) 3.4 cm CVR length (44 days) foetus showing
superficial periderm layer (P), dark basal layer (Bl) of epithelium
and mesenchymal cell (Ms) in the anterior part of tongue.
Hematoxylin and Eosin × 200. (b) 3.4 cm CVR length (44 days)
foetus showing superficial periderm layer (P), dark basal layer (Bl)
and mesenchymal cells (Ms). Hematoxylin and Eosin × 1000.
(c) 10.7 cm CVR length (77 days) foetus showing dome shaped
primitive papillae (Pp), dark basal layer (Bl) and propria submucosa
(Ps). Hematoxylin and Eosin × 200. (d) 10.7 cm CVR length
(77 days) foetus showing basal layer of cuboidal cells (Bl) and
superficial layers of polygonal cells (Sf) in the ventral part of
tongue. Hematoxylin and Eosin × 200. (e) 21.4 cm CVR length
(122 days) foetus showing basal layer (Bl) and superficial layers
(Sf) in torus region. Hematoxylin and Eosin × 100. (f) 29.0 cm
CVR length (139 days) foetus showing keratohyaline granules (kg)
in the epithelium. Hematoxylin and Eosin × 200.
SUMMARY
Histogenesis of lingual epithelium during prenatal life in
buffalo was studied in tongues of 36 buffalo foetii.
REFERENCES
Baratz R S and Farbman A I. 1975. Morphogenesis of rat lingual
filiform papillae. American Journal of Anatomy 143: 283–302.
Cameron I L. 1966. Cell proliferation, migration and specialization
in the epithelium of the mouse tongue. Journal of Experimental
Zoology 163: 271–84.
Dellmann H D. 1993. Textbook of Veterinary Histology. 4th edn.
Lea and Febiger, Philadelphia
Farbman A I. 1965. Electron Microscope study of the developing
taste bud in rat fungiform papilla. Developmental Biology 11:
110–35.
Iwasaki S, Yoshizawa H and Kawahara I. 1999. Ultrastructural study
of the relationship between the morphogenesis of filiform
papillae and the keratinisation of the lingual epithelium in the
rat. Journal of Anatomy 195: 27–38.
Jung H S, Akita K and Kim J Y. 2004. Spacing pattern on tongue
surface gustatory papillae. International Journal of
Developmental Biology 48: 157–61.
Kulawik M. 2005. The development of the mucous membrane of
the tongue with special emphasis on the development of
fungiform papillae in the prenatal life of the rabbit. Electronic
Journal of Polish Agricultural Universities Veterinary Medicine
the posterior side or root of the tongue (Fig. f) as reported at
P0 (postnatal day 0) in rat (Iwasaki et al. 1999). These
keratohyalin granules were the characterstics of stratum
granulosum or granular layer (Dellmann 1993). The cells
became keratinized before it reaches the surface and usually
one or more layers of keratinized cells were formed beneath
the superficial non-keratinized cells. So the cells in the
intermediate layers released the keratohyaline granules and
undergo keratinization as it reached the surface. In the present
study it was observed that the lingual epithelium was better
differentiated on the posterior side as compared to anterior
side at any given stage of development.
The keratinization of lingual epithelium of rat occurs just
before birth (Farbman 1971). The discrepancy in the timing
62
April 2010]
HISTOGENESIS OF LINGUAL EPITHELIUM IN BUFFALOES
335
Pelagalli G V. 2005. The innervation of the fetal buffalo tongue.
Veterinary Research Communication 29: 203–06.
Singh K. 2001. ‘Age correlated histomorphological and
histochemical studies on the tongue of Indian Buffalo (Bubalus
bubalis).’ M.V.Sc. thesis, Punjab Agricultural University,
Ludhiana, India.
Singh O. 2002. ‘Anatomical and histomorphological changes in
buffalo stomach during prenatal life.’ Ph. D. dissertation. Punjab
Agricultural University, Ludhiana, India.
Soliman M K. 1975. Studies on the physiological chemistry of the
allantoic and amniotic fluid of buffaloes at various periods of
pregnancy. Indian Veterinary Journal 52: 111–17.
Uppal V, Roy K S, Bansal N, Bawa B S and Singh O. 2006.
Histogenesis of tongue during early prenatal life in
Murrah buffalo. Indian Journal of Animal Sciences 76: 894–
96.
8: 4.
Kulawik M. 2006. Development of the mucosa on lateral
surfaces of the lingual body in the period from day 15 of
prenatal life to 6th month of postnatal life in the rabbit
Electronic Journal of Polish Agricultural Universities Vet Med
9: 2.
Luna L G. 1968. Manual of Histologic Staining: Methods of Armed
forces Institute of Pathology. 3rd edn. pp 38–196. McGraw Hill
Book Co, New York, USA.
Parmar M L Malik M R and Taluja J S. 1999. Morphometry of
tongue in goat foetuses. Indian Journal of Animal Sciences 69:
79–81.
Sarma K, Goswami R N, Kalita S N, Baishya G and Devi J. 2003.
Morphogenesis of tongue in crossbred pig foetuses. Indian
Journal of Animal Sciences 73: 1029–30.
Scala G, Corona M, Persella A, Girolamo P, Vittoria A, Scala F and
63
Indian Journal of Animal Sciences 80 (4): 336–337, April 2010
Ultrastructure of gut associated lymphoid tissues in Kadaknath fowl
P C KALITA1, G K SINGH 2 and B S DHOTE 3
Govind Ballabh Pant University of Agriculture and Technology, Pantnagar, Uttarakhand 263 145 India
Received: 6 April 2009; Accepted:1 November 2009
Key words: Kadaknath fowl, GALT, Ultrastructure
Lymphoid organs constitute the main structural category
of the avian immune system. The secondary lymphoid organs,
characterized by aggregates of lymphocytes and antigen
presenting cells, are scattered throughout the body.
Concomitant with the development of digestive structures
and functions, a rapid development of the GALT occurs. The
development of the bursa and other GALT starts during late
embryogenesis (Kajiwara et al. 2003). Bar Shira et al. (2005)
showed that development of GALT in the foregut was only
slightly and temporarily impeded by feed withholding (for
the first 72 h after hatch) in newly hatched broiler chicks.
The present study was aimed to investigate the
ultrastructural observations on GALT in the Kadaknath fowl.
Birds were obtained from Instructional Poultry Farm (IPF)
of the University. The birds were sacrificed by decapitation
and tissue samples, viz. segments from duodenum, jejunum
and ileum, were collected for transmission electron
microscopy and fixed in 2.5% gluteraldehyde and processed
for TEM as per the manual of AIIMS, New Delhi. Ultrathin
(70-80 nm) sections were stained with uranyl acetate and
lead citrate, according to Reynolds (1963) and examined in
an electron microscope.
Lymphocytes were the main cell type seen aggregated
beneath the epithelium of GALT either as germinal centres
or as diffuse lymphoid tissue. The nuclear diameter profiles
of these cells ranged from 1.5 to 5.2 mm. The small
lymphocytes had a thin rim of relatively electron dense
cytoplasm and more densely clumped chromatin than the
large lymphocytes (Fig. 1). Chromatin was often seen along
the inner membrane of the nucleus. A nucleolus was
sometimes present. Few cytoplasmic organelles were seen
in the small lymphocytes whereas the large lymphocytes had
a few mitochondria, granular endoplasmic reticulum and
occasionally a moderately developed Golgi Complex.
Lymphoblasts were common and could be distinguished
by their large size, relatively large amount of cytoplasm, small
amount of nuclear chromatin and by the presence of more
cytoplasmic organelles than were seen in mature lymphocytes
(Fig. 2). Vacuoles were observed sometimes in the cytoplasm
of the lymphoblasts.
Plasma cells with dilated endoplasmic reticulum were seen
among the lymphocytes and lymphoblasts (Fig. 3). It had
the typical “clockface” arrangement of nuclear chromatin
and was larger than other lymphoid cells. The division of
the lymphoid tissue into germinal centres and diffuse
lymphoid tissue (Befus et al. 1980, Burns 1982) was not
always apparent at the ultrastructural level in fowl and nor
was the presence of a dome area of lymphoid tissue (Abe
and Ito 1978). However, the principle features of a well
developed secondary lymphoid organ–small and large
lymphocytes, plasma cells–macrophages and mast cells, were
all present in Peyer’s patches from fowls and turkeys (Burns
and Maxwell1986).
Macrophages in moderate numbers were present
throughout the lymphoid tissue. They often contained
phagocytosed material; dead and dying cells could be seen
within vacuoles in the cytoplasm. The nuclear membrane
was often indented by phagocytosed material. A similar
location for macrophages was reported in mammalian gutassociated lymphoid tissue (Crabb and Kelsall 1940, Abe
and Ito1978, Lause and Backman 1981). Cunningham (1978)
stated that macrophages are the main antigen-presenting cells
in immune responses. Macrophages are considered to be the
professional antigen presenting cells in generation of immune
response (Kindt et al. 2007).
Mast cells were located in the lamina propria just beneath
the epithelium, but never populated intestinal epithelium (Fig.
4). The granules were more varied in size and number than
the globules of the globule leucocytes. The granules were
moderately electron-dense and were bound by a single
membrane (Fig. 4). The nuclei were usually regular in shape
being either round or oval.
Globule leucocytes and lymphocytes were sandwiched
between the epithelial cells throughout the intestine. Almost
Present address: 1Associate Professor and Head, Department
of Veterinary Anatomy and Histology, College of Veterinary
Sciences and Animal Husbandry, Central Agricultural University,
Selesih, Aizawl, Mizoram.
2 Dean, 3 Associate Professor, Department of Veterinary
Anatomy, College of Veterinary and Animal Sciences.
64
April 2010]
ULTRASTRUCTURE OF GUT ASSOCIATED LYMPHOID TISSUES IN KADAKNATH FOWL
1
2
3
4
337
5
Figs 1–5. Transmission electron microgrpah of GALT of the Kadaknath fowl showing : 1. small (SL) and large lymphocyte (LL) ×
10600; 2. lymphoblast (LB) × 7960; 3. plasma cell with dilated endoplasmic reticulum (Pc) × 10800; 4. mast cell (MC), the granules of
which are moderately electron dense (Gn) and are bound by a single membrane × 19900; 5. globule leucocyte (GL). The granules (Gn) are
generally homogenous and densely stained × 10600.
all the globule leucocytes (GL) were spherical and possessed
thick cytoplasmic protrusions prolonged between the
epithelial cells. The pattern of the chromatin and the size of
the nucleus were similar to small or medium sized
lymphocytes in the same area, but the cytoplasm of GL had
a slightly lower electron density. Therefore, the cytoplasm
was easily distinguished from that of the neighbouring
epithelial cells. The globules varied in size and appearance
within different leucocytes. They were generally homogenous
and densely stained (Fig. 5) though sometimes vacuoles were
seen within them. Gregory and Nolan (1981) recorded a direct
association between globule leucocytes and lymphoid tissue
(in Peyer’s patches from lambs infected with coccidia) and
also reported mast cells and globule leucocytes in Peyer’s
patches from uninfected control lambs.
responses in broiler hatching hindgut following delayed access
to feed. Veterinary Immunology and Immunopathology 105: 33–
45.
Befus A D, Johnston N, Leslie G A and Bienestock L. 1980. Gut
associated lymphoid tissue in the chicken. I. Morphology,
ontogeny and some functional characteristics of Peyer’s patches.
Journal of Immunology 125: 2626–32.
Burns R B. 1982. Histology and immunology of Peyer’s patches
in the domestic fowl (Gallus domesticus). Research in Veterinary
Science 32: 359–67.
Burns R B and Maxwll M H. 1986. Ultrastructure of Peyer’s patches
in the domestic fowl and turkey. Journal of Anatomy 147: 235–
43.
Crabb E D and Kelsall M A. 1940. Organisation of the mucosa and
lymphatic structure in the rabbit appendix. Journal of
Morphology 67: 351–67.
Cunningham A J. 1978. Understanding Immunology. Academic
Press Ltd., London
Gregory M W and Nolan A. 1981. Globule leucocytes and Peyer’s
patches in lambs infected with coccidia. Research in Veterinary
Science 30: 385–87.
Kajiwara E, Shigeta A, Horiuchi H, Matsuda H and Furusawa S.
2003. Development of Peyer’s patch and cecal tonsil in gutassociated lymphoid tissues in the chicken embryo. Journal of
Veterinary Medicinal Science 65: 607–14.
Kindt T J, Goldsby R A and Osborne B A. 2007. Kuby Immunology.
6th edn, pp 209.W. H. Freeman and Company, New Work.
Lause D B and Bockman D E. 1981. Heterogeneity, position and
functional capability of macrophages in Peyer’s patches. Cell
and Tissue Research 218: 557–66.
Qureshi M A Husain I and Heggen C L. 1998. Understanding
immunology in disease development and control. Poultry
Science 77: 1126–29.
Reynolds E S. 1963. The use of lead citrate at high pH as an electron
opaque stain in electron microscopy. Journal of Cell Biology
17: 208–12.
SUMMARY
The present study conducted on 112 day-old Kadaknath
fowl of both sexes revealed that the GALT were similar in
many respects to those found in mammals. They were
overlaid by a lymphoepithelium containing undifferentiated
intestinal epithelial cells with a well developed microvillous
border, lymphocytes and plasma cells. The organ was fully
developed and the lymphoid aggregates of GALT comprised
of small and large lymphocytes, lymphoblasts and plasma
cells. Macrophages and globule leucocytes were seen among
the lymphoid cells.
REFERENCES
Abe K and Ito T. 1978. Fine structure of the dome in Peyer’s patches
of mice. Archivum histologium Japonicum 54: 195–204.
Bar Shira E D, Sklan D and Friedman A. 2005. Impaired immune
65
Indian Journal of Animal Sciences 80 (4): 338–339, April 2010
Biochemical and enzymatic changes in downer cow syndrome
SUBHASH KACHHAWAHA1 and R K TANWAR2
Animal Help Line, Veterinary Hospital, Panna Lal Goshala, Mandore, Jodhpur, Rajasthan 342 023 India
Received: 25 May 2009; Accepted: 23 November 2009
Key words: Biochemical, Downer cow, Enzymes
Downer cow syndrome is a complication of recumbency
associated with milk fever (Radostits et al. 2007). Downer
syndrome is characterized by inability of an animal to stand
from recumbency voluntarily. Occurrence of this syndrome,
has been reported in cows (Wadhwa and Prasad, 2002). The
present paper describes biochemical and enzymatic changes
in clinical cases of downer syndrome in cows.
Sixteen cows of 4–8 years of age with history of inability
to rise voluntarily for the varied period of time, were brought
to the veterinary hospital, Panna Lal Goshala, Jodhpur,
between March 2007 to February 2008. Twelve cows were
post parturient and four cows were in advance pregnancy.
Clinical manifestations were recorded. Six healthy cows were
included to serve as control. About ten millilitre of blood
was collected from each downer cow and healthy cows and
serum was separated and stored at –20°C.
The concentration of calcium, phosphorus, magnesium,
sodium, potassium, total protein AST, ALT and CPK were
measured in serum using kits. Data were analysed statistically
as per Snedecor and Cochran (1994).
Clinically the downer cows appeared bright and alert but
off-feed. The body temperature was within normal range.
Animals tried to stand-up repeatedly but could not rise to
their feet. They could raise their fore quarters, but failed to
put up weight on hind quarters. The mean ± SE value of
minerals, electrolytes, enzymes and total proteins are given
in Table 1.
The values of calcium, phosphorus, potassium were
significantly low (P< 0.05) in downer cows incomparison to
healthy control cows (Table 1). Low plasma calcium,
phosphorus and potassium concentration have been reported
by Wadhwa and Prasad (2007). Radostits et al. (2007) stated
that calcium, phosphorus and magnesium levels of blood
remained within normal range in downer cow. However, a
persistent hypocalcemia following treatment for milk fever
may exist in a downer cow. The exact explanation for low
calcium and phosphorus in downer cows in present study is
not known. Hypokalaemia has been reported in downer cows
by Allen and Davies (1981). The persistent hypocalcemia
and hypophosphatemia has been regarded as cause of downer
cow syndrome associated with milk fever (Radostits 2007).
Hypokalaemia in recumbent cows occurs due to the fact that
muscle ischaemia as a result of prolonged recumbency
increases the cell membrane permeability of muscle fibres
and allow loss of potassium from the cell causing myotonia
which appears to be the basis of downer cow syndrome
(Andrew et al. 1992). The magnesium concentration was
slightly high in present study. Hypomagnesemia
(Baumgartner and Gattinger 1982, as well as normal
magnesium level (Narayana et al. 1977) have been ) recorded
in downer cows. The sodium concentration in downer cows
was within normal range. Hypokalemia could also occurs
due to rapid urinary excretion and diminished alimentary
absorption of potassium associated with reduced feed intake.
Diminished excitability of nerve and muscle cells, weakness
and flaccid paralysis are the consequences of hypokalaemia
(Kowalezyk and Mayer 1972). The values of total protein
Table 1. Mean ± SE value of minerals, electrolytes, enzymes
and total protein in downer cows (n = 16) and healthy
control cows (n = 6)
Parameter
Ca (mg/dl)
Pi (mg/dl)
Mg (mg/dl)
Na (mEq/l)
K (mEq/l)
Total protein (g/dl)
AST (units/l)
ALT (units/l)
CPK (units/l)
Present address: 1SMS (Vety. Sc.), CAZRI, KVK, Pali-Marwar,
Rajasthan.
2 Head, Department of Epidemiology and Preventive Veterinary
Medicine, College of Veterinary and Animal Science, Bikaner,
Rajasthan.
*P≤0.05.
66
Downer cows (n = 16)
Control (n = 6)
7.62±0.21*
3.94±0.05*
3.33±0.11
119.56±2.83
1.90±0.05*
7.13±0.13
117.88±6.33*
84.75±3.42*
128.27±2.31*
10.90±0.25
5.23±0.24
2.30±0.11
122.17±2.80
4.37±0.20
7.58±0.52
118.00±7.23
54.83±3.67
28.44±0.54
April 2010]
BIOCHEMICAL AND ENZYMATIC CHANGES IN DOWNER COW SYNDROME
fluctuated within normal range in downer cows.
The mean values of AST, ALT and CPK in downer cows
were significantly high (P<0.05) in comparison to healthy
control cows (Table 1). Prolonged recumbency causes
ischaemic necrosis of muscles (Cox et al. 1982) resulting in
increased permeability of cell membrane allowing seepage
of AST, ALT and CPK enzymes into circulation. Increased
levels of AST, ALT and CPK enzymes had been observed in
cows by El-Sayed et al. (1994) and Wadhwa and Prasad
(2007) in buffaloes. Creatine phosphokinase is considered
as a specific marker of muscle damage (Kaneko 1989) and
increase in CPK testified ischemic damage to the muscle
causing its seepage into the circulation. The CPK levels need
to be interpreted in relation to the days of recumbency when
the sample is taken. Critical levels may be highest initially
up to 50 times and may reduce to 10 times normal range at 7
days of recumbency (Radostits 2007).
339
REFERENCES
Allen W M and Dames D C. 1981. Milk fever, hypomagnesemia
and the downer cow syndrome. British Veterinary Journal. 137:
435–41.
Andrews A H, Blowery R W and Eddy R S. 1992. Bovine Medicine.
Diseases and Husbandry of Cattle. A Blackwell Scientific
Publications, London.
Baumgartner W and Gattinger G. 1982. Parturient paresis in dairy
cow due to hypophosphataemia. Wiener Tierarztliche
Monatsschrift 69: 315–18.
Cox V S, McGrawth C J and Jorgensen S E. 1982. The role of
pressure damage in pathogenesis of downer cow syndrome.
American Journal of Veterinary Research 43: 26–31
El-Sa ed R E, Asma O A and Fetaih H. 1994. Downer cow syndrome
in cows and buffaloes. Assiut Veterinary Medicine Journal 31:
155–63
Kaneko J J. 1989. Clinical Biochemistry of Domestic Animals. IV
edn., Academic Press, New York.
Kowalczyk D F and Mayer G R. 1972. Cation concentration in
skeletal muscles of paretic and non paretic cows. American
Journal of Veterinary Research 33: 751–56.
Narayana K, Sethy D R L, Sastry K N V and Thandavesh Kar M G.
1977. Downer cow syndrome. Indian Veterinary Journal 54:
148–51.
Radostits O M, Gay C C, Hinchcliff K W and Constable P D. 2007.
Veterinary Medicine. A Textbook of the Diseases of Cattle,
Horses, Sheep, Pigs and Goats. Saunders Elsevier.
Snedecor G W and Cochran W G. 1994. Statistical Methods. 8th
Edn., New Delhi, Oxford and IBH.
Wadhwa D R and Prasad B. 2002. Clinico-therapeutic observations
of downer cow syndrome. Indian Veterinary Journal 79:
484–86.
Wadhwa D R and Prasad B. 2007. Mineral proifle in downer cow
syndrome. Indian Journal of Veterinary Medicine 27(1):
22–24.
SUMMARY
The biochemical and enzymatic changes were observed in
sixteen downer cows. Significantly low concentration of
calcium, phosphorus and potassium and significantly higher
activities of serum enzymes of creatinine phosphokinase,
aspartate and alanine amino transferase were observed in
downer cows. Downer cows should be treated with potassium
in addition to calcium and phosphorus.
ACKNOWLEDGMENTS
The author is highly thankful to Head, Department of
Veterinary Medicine, College of Veterinary and Animal
Science, Bikaner, for providing facilities to carry out the
present research work.
67
Indian Journal of Animal Sciences 80 (4): 340–342, April 2010
Alteration in surface body temperature and physiological responses in Sirohi goats
during day time in summer season
S K PHULIA1, R C UPADHYAY2, S K JINDAL3 and R P MISRA4
Central Institute for Research on Goats, Makhdoom, Farah, Uttar Pradesh 281 122 India
Received: 2 June 2009; Accepted: 20 November 2009
Key words: Goats, Kids, Physiological responses, Surface body temperature
temperature (37.0, 38.0, 41.0, 39.0 ºC) and the soil
temperature (41.8, 46.0, 48.9, 38.0 ºC) in the experimental
pen fluctuated at different hours of observations (9.00 AM,
12.00 Noon, 3.00 PM and 6.00 PM). Data were analysed by
one way analysis of variance and the differences were tested
using Duncan’s multiple range test (SPSS 11.5 Version,
2002).
Surface body temperature at different sites differed
significantly (P<0.01) between adults and kids during day
time. The skin surface temperature in adult goats increased
significantly (P<0.01) with increase in the intensity of solar
radiation at noon (Table 1). Changes in body surface
temperature at different sites were low (P<0.01) in the
morning (9.00 AM) and about 5–10 ºC higher in the afternoon
(3.00 PM). Fore head, back and rump showed significantly
(P<0.01) higher temperature than other sites, but these
differences were more pronounced in the adults as compared
to kids (Table 1). The kids have higher body surface area per
unit of body weight and therefore heat dissipation is faster.
As a consequence, small animals require a greater heat
production per unit of weight than large animals, if the same
body temperature is to be maintained. With declining body
size, the increase in metabolic rate will eventually reach a
limit because the requirements for ‘Fuel’ became
prohibitively high (Bianca 1968). The mean rectal
temperature of kids (Table 1) was similar as reported by Singh
et al. (2004). The changes in rectal temperature were
minimum, but it differed significantly (P<0.05) between day
time and again significantly (P<0.05) declined in the evening
at 6.00 PM in both kids and adult goats.
Surface body temperature of forehead, back and rump
increased significantly (P<0.01) with increase in the intensity
of solar radiation in both the groups. However, it was more
pronounced (P<0.01) in adults, probably due to larger body
surface area exposed to solar radiation. The surface
temperature of extremities was significantly (P<0.01) lower
than other body parts; the extremities were cooler by 4–10ºC
as compared to body trunk. The ear and legs have more
Goats are well adapted to tropical and subtropical
conditions (Finch et al. 1980, Goyal and Ghosh 1987), due
to their ability to withstand high ambient temperatures (Finch
et al. 1980). Goats maintain homoeothermy through a balance
in heat loss and heat production through behavioural
mechanisms and physiological changes (Ogebe et al. 1996,
Al-Tamimi 2007). Singh et al. (2004) reported on adaptability
of goats mainly based on rectal temperature, respiration rate
and pulse rate, without considering surface body temperature.
Particularly, there is lack of information on summer surface
body temperature in Indian breed of Sirohi goats, which could
be helpful in improving production through proper
management during hot period. The present study was carried
out to investigate physiological responses and surface body
temperature during day time in semi-arid conditions.
Six adults (24–30 months weighing 25–30 kg) and 6 kids
(5–6 months weighing 8–12 kg) were selected from institute
herd. All these animals were maintained under standard
management practice followed at the animal farm. The
experiment was conducted during summer and all the animals
were exposed to the solar radiations in open goat pen during
day time. Ten points (forehead, ear, neck, back, rump,
abdomen, shoulder, hip, fore leg and hind leg) were
earmarked on the body of animal to record surface body
temperature using an Infra-red tela-temp thermometer at 3 h
interval during day time (9.00AM to 6.00 PM) in summer.
The temperature recorded from ear, fore legs and hind legs
was grouped under extremities and rest was grouped under
body proper. Rectal temperature was recorded using a clinical
thermometer. Respiration rate was recorded on the basis of
the flank movement. The average relative humidity, wind
speed and minimum temperature were 62±8.3%, 69.3±26.8
m/min and 27.5ºC, respectively. The environmental
Present address: 1Senior Scientist, Central Institute for Research
on Buffaloes, Hisar 125 001 (e mail: phulia@scientist.com),
2Principal Scientist, Dairy Cattle Physiology, National Dairy
Research Institute, Karnal 132 001.
3,4Principal Scientist
68
April 2010]
ALTERATION IN PHYSIOLOGICAL RESPONSES IN GOATS IN SUMMER
341
Table 1. Surface body temperature (°C) and physiological responses (rectal temperature and respiration rate) of Sirohi adult goats and
kids during summer condition (mean±SE)
Hours Sites
Adults
9.00 AM
Surface body temperature
42.4±0.94b
Forehead**
**
Ear
37.30±0.45a
Neck**
38.45±0.47a
Back**
48.06±1.10b
Rump**
42.35±0.71b
Abdomen**
38.08±0.27a
Shoulder**
38.11±0.38a
**
Hip
39.1±0.97ab
**
Fore leg
37.86±0.60a
Hindleg**
37.08±0.53a
Physiological responses
Rectal temp.* (ºC) 38.97±0.15ab
Resp. rate/min.
43.66±5.0a
Kids
12.00 Noon
3.00 PM
6.00 PM
9.00 AM
12.00 Noon
3.00 PM
6.00 PM
46.80±0.83c
40.25±0.30b
42.2±0.73b
51.5±1.10b
46.28±0.66c
40.75±0.40b
40.28±0.24b
41.60±0.31bc
39.50±3.80b
39.78±0.39b
46.36±1.30c
46.00±1.60b
42.55±0.55b
48.26±2.10b
46.30±1.30c
40.35±0.98b
41.80±1.10b
42.36±1.60bc
40.20±0.71b
39.96±0.84b
35.93±0.22a
36.63±0.85a
36.10±0.56a
36.10±0.33a
36.25±0.12a
36.70±0.08a
36.80±0.15a
36.43±0.11a
36.31±0.13a
36.00±0.19a
40.15±0.84b
37.53±0.14c
38.65±0.44a
46.23±1.63c
44.36±1.20c
37.70±0.37b
37.26±0.37
37.05±0.63bc
36.48±0.48bc
36.20±043bc
35.33±0.12a
36.55±0.11b
36.0±0.11b
35.5±0.26a
35.32±0.32a
35.8±0.18a
35.04±.26
34.83±0.15a
34.51±0.20a
34.26±0.35a
36.45±1.10a
35.2± 0.49a
36.50±1.00b
40.45±1.00b
40.30±0.42b
35.85±0.95a
35.65±1.17
38.60±0.28c
37.50±0.92c
37.55±0.3c
35.85±0.15a
36.93±0.49bc
36.08±0.95b
35.85±0.33a
35.73±0.26a
36.33±0.28a
36.41±0.67
35.41±0.59ab
34.98±0.39ab
34.86±0.43ab
38.90±0.17ab 39.35±0.08b 38.76±0.14a
57.00±5.80a 77.33±8.10b 45.60±02.33a
39.4±0.04b 38.95±0.09a 39.70±0.06c 39.15±0.09ab
51.00±4.10a 48.00±1.60a 56.00±1.84b 41.30±3.12a
**
Significant difference (P<0.001) between adults and kids; * Significant difference (P<0.005) between adults and kids;abc Values with
a different superscript in the row under adults and kids column differ significantly (P<0.005).
result from both central stimuli such as blood temperature
supplied to hypothalamus or from peripheral stimuli to the
skin (Terill 1968). This was due to commissioning of
physiological and behavioral process for maintaining
homeothermy in both adults and kids. In adult animals,
evaporation through respiratory passage is more than the kids.
Rise in surface body temperature, rectal temperature and
respiration rate was observed in relation to rise in solar
intensity and orientation. At higher environmental
temperature and increase solar radiations intensity, goats start
panting. Hence under extreme environmental conditions
goats must be protected from direct solar radiations.
surface area to weight and the volume ratio, hence ear and
legs permit greater evaporative cooling. The extremities like
ears and legs being highly vascularised result in circulation
of larger volume of blood per unit area. In fact long and thin
legs and long ears are an adaptation character in the hot
environment breeds of the tropics, which facilitate their
survival in hot environment.
The respiration rate of both adults and kids at 3.00 PM was
significantly (P<0.01) higher as compared to those
in morning and evening. Present study also showed as increase
in respiration rate with increase in environmental/soil
temperature (Phulia et al. 2000, Ogebe et al. 1996). The rise
in respiration rate probably demonstrated that goats used heat
regulating mechanisms by increasing respiratory exchange.
Rectal temperature is an important indicator of thermal
balance and might be used to evaluate the impact of heat
stress (Spiers et al. 2004). Rectal temperature was
significantly (P<0.05) different between kids and adults
(Table 1). The rectal temperature was highest at 3.00 PM,
that declined significantly (P<0.05) during evening (6.00 PM)
in both groups. Avendano-Rayes et al. (2006) reported that
increased body temperature is a normal mechanism by which
animals diffuse heat from their bodies to maintain
thermoregulation in hot ambient conditions. In the present
experiment, the rectal temperatures of both groups exceed
over 39°C. However, Devendra (1987) reported that goats
maintain their rectal temperatures below 38.5°C, which is
considered normal. Darcan et al. (2008) also reported that
there was a diurnal fluctuation in body temperature, that was
lowest in early morning and highest in late afternoon. In the
present study, with the rise in surface body temperature goats
started panting. Thermoregulatory responses of panting may
SUMMARY
The study was undertaken to evaluate physiological
responses and surface body temperature during summer.
Adult goats and kids of Sirohi breed were exposed to solar
radiations. Body sites, viz fore head, back/middle and rump,
which were facing sun radiation directly, showed significantly
higher skin surface temperature than the other parts of body.
Extremities showed significantly lower surface temperatures
than the other parts. In adults, respiration rate was
significantly higher at 3.00 PM when ambient temperature
was high. Body temperature of adults and kids differed
significantly among different hours of the observations. The
finding suggests that under extreme environmental conditions
goat must be protected from direct solar radiations.
ACKNOWLEDGEMENT
The authors are highly thankful to the director CIRG,
Makhdoom, for providing necessary funds and facilities for
this study.
69
342
PHULIA ET AL.
[Indian Journal of Animal Sciences 80 (4)
heat exchange by radio-telemetry in black desert goats during
winter. Journal of Agriculture Science 108: 509–10.
Ogebe P O, Ogunmodede B K, Mc Dowell L R. 1996. Behavioral
and physiological responses of Nigerian dwarf goats to seasonal
changes of the humid tropics. Small Ruminant Research 22:
213–17.
Phulia S K, Upadhyay R C, Jindal S K and Misra R P. 2000. Changes
in skin surface temperature and physiological reactions in
Marwari goats. Proceedings of 7th International Conference
on Goats. pp 779–0.France, 15–21 May, 2000.
Prasetyo S. 1983. ‘Heat stress on birth weight and vigour of kids.’
Ph.D. Thesis, Animal Production, University of Melbourne.
Singh G, Phulia S K, Misra R P, Puneet Kumar and Upadhyay R.
C. 2004. Seasonal variation in physiological reactions of
Jamunapari Kids. Indian Journal of Small Ruminant 10 (1): 21–
24.
Spiers D E, Spain J N, Sampson R P, Rhoads R P. 2004. Use of
physiological parameters to predict milk yield and feed intake
in heat stressed dairy cows. Journal of Thermal Biology 29:
759–764.
Terril C E. 1968. Adaptation of Sheep and Goats. Adaptation of
Domestic Animals. (Ed.) Hafez E S E. Lea & Febiger.
Washington.
REFERENCES
Al-Tamimi H. 2007. Thermoregulatory response of goat kids
subjected to heat stress. Small Ruminant Research 71 (1–3):
280–85.
Avendano-Reyes, Alvarez-Valenzuela L, Correa-Clederon F D,
Saucedo-Quintero A, Robinson S and Fadel J G. 2006. Effect
of cooling Holstein cows during the dry period on postpartum
performance under heat stress conditions. Livestock Science 105:
198–206.
Bianca W. 1968. Thermoregulation. Adaptation of Domestic
Animals. (Ed.) Hafez E S E. Lea & Febiger. Philadelphia.
Darcan Nazan, Cedden Fatin, Cankaya Soner 2008. Spraying effects
on some physiological and behavioural traits of goats in a
subtropical climate. Italian Journal of Animal Sciences 7: 77–
85.
Devendra C. 1987. Goats. Bioclimatology and the Adaptation of
Livestock. pp 157–167. (Ed.) Johnson H D. Elsevier, Amsterdam,
Netherlands.
Finch V A, Dmi’el R, Boxman R, Shkolnic A and Taylor C R.
1980. Why black goat in hot desrets? Effects of coat colour on
heat exchanges of wild and domestic goats. Physiology Zoology
53: 19–25.
Goyal S P and Ghosh P K. 1987. A note on the measurement of
70
Indian Journal of Animal Sciences 80 (4): 343–345, April 2010
Inventorization of Gaushala resources and their use in breed improvement and
conservation programmes
DINESH KUMAR YADAV1 and PRADEEP KUMAR VIJ2
National Bureau of Animal Genetic Resources, Karnal, Haryana 132 001 India
Received: 4 May 2009; Accepted: 5 November 2009
ABSTARCT
A comprehensive digitized inventory on Gaushalas of Haryana State with specific focus on their cattle genetic
resources, and material resources was developed to integrate the data on Gaushalas on different aspects at one place. A
uniform approach was followed to standardize the data using database normalization techniques. This system is menu
driven and is designed using MS-Access at the back end and Visual Basic 6.0 at the front end. A user friendly graphical
user interface has been developed for storage and retrieval of information from the database. A model for the use of the
database information in cattle breed improvement and conservation programmes has been suggested.
Key words: Breed, Cattle, Database, Gaushala, Improvement and Conservation, Relational Database Management System
central agencies like Animal Welfare Board of India. In view
of this, a computerized inventory is a necessity which could
help the Gaushala Managers and other potential users for
better management of Gaushala resources. Gupta and Yadav
(2005) delineated ten goals for ‘Gaushala Development’ visà-vis role of district administration and research and
development agencies. They emphasized on inventorization
of Gaushala resources for the purpose of Gaushala
development. To fulfill this vital need, we have developed a
database with the purpose of establishing an information
system to support the day-to-day program and management
needs of the Gaushalas.
Gaushalas (around 4500 in India) constitute a strong
network of indigenous cattle maintained throughout the
country and are playing a yeoman service to the welfare of
the cow. Most of these are primarily looking after nonlactating, weak, unproductive, and stray cattle. But existing
infrastructure, committed private management and leadership
of devoted persons coupled with flow of resources are some
of the important factors which render Gaushalas as ideal
centres for cattle improvement and conservation. Added
advantages of Gaushalas are their locations in the nook and
corner of the country; a very close association and influence
with local livestock keepers/people, and local administration
of the area. Nevertheless, Gaushala management in the
present context is a challenging task. Lack of appropriate
financial aid from governments and constant dependency
upon the donations for running day-to-day affairs is one of
the chronic problems faced by them. Besides this, lack of
authentic database of Gaushala inventory adds much to the
vowes of the Gaushala Managers, policy planners,
researchers, development agencies and farmers/livestock
keepers as they need data on Gaushala resources for evolving
realistic strategies for improvement and rearing of cattle.
Frequent reports about the population status and other
resources are required by developmental agencies like state
animal husbandry departments for the purpose of giving
maintenance grants as well as planning annual resource
requirements for veterinary services to Gaushalas and other
MATERIALS AND METHODS
Primary data were collected from 105 Gaushalas of
Haryana using a pre-tested structured questionnaire. Visits
were undertaken to every Gaushala and data were collected
from Gaushala records, interviews of management personnel
and actual observations. Data included information on
various aspects of Gaushalas, viz. its history including name
and contact numbers of president, secretary and manager;
breed-wise and age-wise cattle population; assets inventory;
annual income, budget and expenditure; and miscellaneous
information (like entrepreneurial efforts, breed improvement
programmes, linkages with other agencies, performance
recording, common diseases, flow of animals, problems faced
by Gaushala management, manpower employed in the
Gaushala and suggestions for making Gaushala selfsufficient etc.).
System design and development: A uniform approach was
Present address: 1 Senior Scientist (email: dkyadav66
@gmail.cm), 2 Principal Scientist.
71
344
YADAV AND VIJ
Identification of Gaushalas
with adequate infrastructure,
resources and herd size
[Indian Journal of Animal Sciences 80 (4)
Associated herd progeny
testing programme
Inventorization of
Gaushala resources
Elite animals
Proven bulls
Test bulls
Progeny of proven bulls
General herd
Selection
Future test bulls
Progeny of initially selected
test bulls
Proven bulls
Overall genetic improvement
Improvement in organized
herds, Gaushalas and
Farmers’ herds
CATTLE BREED IMPROVEMENT AND CONSERVATION
Fig. 1. Cattle breed improvement and conservation model based on the use of inventorization of Gaushala resources.
followed to standardize the data using database normalization
techniques (Date 2001) and the same was converted into
database format using back-end tool MS-Access relational
database management system (RDBMS). A user friendly
graphical user interface (GUI) was developed for storage
and retrieval of information from the database by using front
end programming tool Visual Basic 6.0 (Jennings 2000) and
Seagate Crystal Reports Professional Version 7.0.
Income sources: This module holds information on data
on different income sources of a Gaushala for the financial
years 2001–02, 2002–03, 2003–04, 2004–05 and 2005–06.
Information on other financial years can also be added.
Total budget and expenditure: Budget and expenditure
statements of the Gaushalas were compiled for the financial
years 2001–02, 2002–03, 2003–04, 2004–05 and 2005–06
under this module of the database.
Miscellaneous information: Information provided under
this module can prove very handy in judging the
farsightedness and forward-looking approach of the
management committee of the Gaushala. It provides
information-like whether entrepreneurial efforts were made
by Gaushala management; breed improvement programmes
initiated; linkages with other agencies established; records
related to milk recording and pedigree of animals maintained;
common diseases prevalent in the Gaushala; flow of animals
from the Gaushala; problems faced by Gaushala
management; manpower employed in the Gaushala; and
suggestions of the management for making Gaushala selfsufficient etc.
Various electronic forms for data entry, editing, updating
of data (equipped with automatic validation checks to
safeguard the database against duplicate and/or unnecessary
data entry) were incorporated in the software to facilitate
easy data storage. Online querying and report generation
modules are available in the system for information retrieval.
The whole database system was recorded on the CD-ROM
medium in auto installation form.
The cattle population in the country is declining and some
of the cattle breeds like, Krishna Valley, Vechur and Punganur
RESULTS AND DISCUSSION
A complete database integrating data of Gaushalas on
different aspects at one place was designed and tested. The
system is menu driven, designed using MS-Access at the
back end and Visual Basic 6.0 at the front end. The salient
features of the database system are briefly described here.
General details: This module holds information about the
year of establishment; registration number and code number
allotted by Animal Welfare Board of India; address and
telephone numbers of Gaushala, its president and secretary.
History, objectives and future plans: Brief information
on the history of Gaushala, its current objectives and future
plans are provided under this module.
Breed-wise cattle population: Breed- wise and sex-wise
cattle population of each Gaushala in different age groups
(<1 year, 1–3 years and >3 years) are provided under this
module.
Assets: Details of assets inventory like total land under
Gaushala (cultivable, uncultivable, constructed area and
grazing area); water sources; transport facilities; gobar gas
plants, panchgavya medicines production unit; vermicompost production unit etc. are given under this module
72
April 2010]
INVENTORIZATION OF GAUSHALA RESOURCES AND THEIR USE IN BREED IMPROVEMENT
345
their infrastructure for breed improvement and conservation
programmes. This database can be utilized by the potential
users including Gaushala managers, planners, administrators,
policy makers, farmers, dairy industry and the scientific
community at large to use these resources in breed
improvement and conservation programmes in a sustainable
and affordable manner. The database would be helpful in
performing roles like- functional support, decision support,
communication decision support system and performance
monitoring etc.
are endangered breeds. Time has come to see the writing on
the wall and check this suicidal drift to which the nation is
heading. The Gaushalas can prove effective cattle
improvement and conservation centres. The digitized
inventory of the Gaushalas can play as a catalytic role in
redefining their utility as improvement and conservation
centres. The model (Fig.1) suggested for achieving this
objective.
Lack of scientific record keeping and exchange of
information among Gaushalas, and between Gaushalas and
development/research agencies has limited their utility in the
past in the breed improvement programmes of the State and
Central Governments. There is a great possibility of
improving the livestock wealth of Gaushalas if suitable
interventions are assessed and provided at appropriate time.
If planned properly, these Gaushalas can become important
sources for in-situ conservation of indigenous breeds and
for progeny testing of large number of bulls. The database
developed for the Gaushalas will help in realizing the
objectives of—better utilization of Gaushala resources,
making them self reliant, ideal, and most importantly utilizing
REFERENCES
Date C J. 2001. An Introduction to Database System. 7th edn.
Addition Wesley Longman Pvt. Ltd. Indian Branch, Delhi.
Gupta R and Yadav D K. 2005. District Administration and
Gaushala Development. National Conference on Utility of
Gaushalas for Improvement and Conservation of Indigenous
Cattle. December 27–28, 2005, National Bureau of Animal
Genetic Resources, Karnal, India: 53–57.
Jennings. 2000. Database Developer Guide with Visual Basic 6.0
BPB Publications, New Delhi.
73
Indian Journal of Animal Sciences 80 (4): 346–349, April 2010
Environmental and genetic effects on growth traits of Chokla sheep
B P KUSHWAHA1, AJOY MANDAL2, RAVINDRA KUMAR3 and SUSHIL KUMAR4
Central Sheep and Wool Research Institute, Avikanagar, Rajasthan 304 501 India
Received: 3 April 2009;Accepted: 12 November 2009
ABSTRACT
Data on 1810 Chokla sheep, maintained at the Central Sheep and Wool Research Institute (CSWRI), Avikanagar,
Rajasthan, collected for a period of 21 years (1980 through 2000) were used to study growth traits and genetic control.
The average weights at birth, 3, 6, 9 and 12 months of age were 2.73±0.04, 12.74±0.22, 16.71±0.26, 18.20±0.26 and
21.81±0.35 kg, respectively. Significant effects associated with the period of birth, parity of dam, season of birth and
sex of lambs were observed on body weight at different stages of growth. Sire of the lamb contributed significantly on
all body weights under study. There were marked periodic differences in the different growth traits of lambs. The lambs
born in the dam’s third and later parities were significantly heavier to those born in first or second parities. Season of
birth had significant effect on body weights at 3, 9 and 12 months of age. Males were heavier than females at almost all
stages of growth and the sex differences tended to increase with age. The heritabilities of body weights at birth and at 3,
6, 9 and 12 months of age were high in magnitude, ranging from 0.32 to 0.48, which indicate the ample scope of
improvement of these traits by selection. The medium (0.17±0.16) to high (0.89±0.05) genetic correlation among the
body weights at different stages in this study suggest that selection for increased early growth traits will lead to genetic
improvement in the subsequent development of body weights.
Key words: Genetic analysis, Growth traits, Genetic parameters, Sheep
Several non-genetic factors affect growth traits and
directly obscure recognition of the genetic potential of
animals. The effect of various factors like year of birth, season
of birth, type of management and sex of animal on lamb
growth of various wool breeds of sheep, has been studied
(Mandal et al. 2003, Reddy et al. 2009). The present study
was undertaken to identify various factors (viz. period of
birth, parity of dam, season of birth and sex of lamb)
influencing growth traits and to estimate the genetic and
phenotypic parameters of these traits in Chokla sheep.
for the region where migration is common practice. The wool
of this breed is heterogeneous in quality and is finer than the
wool of any other carpet wool producing sheep breeds in the
country. Generally the animals were maintained under semiintensive system of feeding management where they are
allowed to graze for 10–12 h on natural pasture with
supplementation of some amount of concentrate depending
upon the status and age category of the animals. Normally,
rotational grazing system was followed. Controlled mating
was practised in the flock. Majority of the ewes (more than
80%) were bred during autumn (August-September), the
main breeding season and some ewes were bred in spring
breeding season (March-April), off breeding season. Heat
detection of ewes was done with teaser ram in the morning
and evening during the breeding season. The ewes in heat
were mated in the morning with selected sires. Generally,
one breeding ram was allowed to mate 25 to 30 ewes and
used for 2 years. At birth, each lamb was weighed and
identified by metal ear tag. Weaning of lambs was generally
done at 90 days. Shearing of animal was done twice in a
year, i.e. in March–April and September–October. Animals
were vaccinated against PPR, enterotoxaemia, FMD etc. The
detailed descriptions of this breed along with distribution
and production performance were described by Kushwaha
et al. (1997).
MATERIALS AND METHODS
Breeding flock and its management: The Chokla sheep,
comparatively fine carpet wool producing type sheep among
the Indian sheep breeds, is hardy and well adapted to the
arid and semi-arid regions of Rajasthan and also best suited
Present address: 1Senior Scientist, Animal Breeding, Network
project on Bhadawari Buffaloes, Indian Grassland and Fodder
Research Institute, Jhansi 284 003 (e-mail: bp_kush@yahoo.com).
2Senior Scientist, Genetics and Breeding Division, Central
Institute for Research on Goats, Makhdoom, Mathura 281 122.
3Senior Scientist, Animal Breeding, National Bureau of Fish
Genetic Resources, Dilkusha, Lucknow 226 002.
4Senior Scientist, Animal Breeding, Central Sheep and Wool
Research Institute, Avikanagar 304 501.
74
April 2010]
FACTORS AFFECTING GROWTH OF CHOKLA SHEEP
Data: Data on 1810 lambs of Chokla sheep, maintained
at the Central Sheep and Wool Research Institute (CSWRI),
Avikanagar, Rajasthan, India, under the All India Coordinated
Research Project (AICRP) on Sheep Improvement (later on,
AICRP was renamed as Network Project on sheep
improvement since 1990) for a period of 21 years (1980 to
2000) were used for the present study. The body weights at
different ages (i.e. at birth, 3, 6, 9 and 12 month) were
recorded and classified according to period of birth, season
of birth, parity of dam and sex of lamb. The years of lambing
were divided into 11 periods, each comprising 2 years except
last period, based on the use of a different ram for breeding
during each period. Each year of lambing was also divided
into 2 seasons, i.e. S–1 (January-February) and S–2 (AugustSept.).
Statistical analyses: Data were analyzed using a mixed
model least-squares analysis for fitting constants (Harvey
1990) including all main effects and interactions. In the final
model, all non-significant interactions were ignored, which
is as follows:
Yijklmn = μ + Si + Pj + Ak + Sl + Em + eijklmn,
where, Yijklmn is the record for the nth lamb, Si is the effect
of the ith sire, Pj is the effect of the jth period of birth, Ak is
the effect of the kth parity of dam, Sl is the effect of the lth
347
season of birth, Em is the effect of the m th sex of lamb and
eijklmn is the residual error element.
The genetic parameters of various growth traits were
estimated by the paternal half-sib method. The comparison
of different sub-groups mean was made by Duncan’s Multiple
Range Test (DMRT) as described by Kramer (1957).
RESULTS AND DISCUSSION
Body weights at different ages: The average weight of
Chokla lamb at birth, 3, 6, 9 and 12 month of age were
2.73±0.04, 12.74±0.22, 16.71±0.26, 18.20±0.26 and
21.81±0.35 kg, respectively (Table 1). The overall leastsquares means for lamb weights observed at the different
ages in this breed were similar with the findings of Nehra
and Singh (2006) but lower than the results of Reddy et al.
(2009). The sires of lambs had significant (P<0.01) influence
on all the body weights in the present study. Similar
significant sire effects on body weights were observed by
Mandal et al. (2003) in various sheep breeds. The significant
effect of sire on all these traits studied indicated that superior
rams could be used effectively for improvement of these
traits. Period of birth was also highly significant (P<0.01) in
respect of lamb weights at all developmental stages in this
study. The present findings corroborated with the results of
Table 1. Least- squares means along with standard errors of different body weights in Chokla sheep
Effects
No. of
obs.
Birth
weight (kg)
No. of
obs.
3 m weight
(kg)
No. of
obs.
6 m weight
(kg)
No. of
obs.
9 m weight
(kg)
No. of
obs.
12 m weight
(kg)
Overall
Period of birth
P–1
P–2
P–3
P–4
P–5
P–6
P–7
P–8
P–9
P–10
P–11
Parity of dam
1
2
3
4
5
6 or > 6
Sex of lamb
Male
Female
Season of birth
Jan-Feb
Aug-Sep
1810
2.73±0.04
1501
12.74±0.22
1304
16.71±0.26
1132
18.20±0.26
920
21.81±0.35
69
48
84
95
149
188
175
207
323
336
136
2.10±0.28a
2.32±0.24a
2.79±0.16bc
2.59±0.14ab
2.87±0.13cd
2.96±0.12cd
3.20±0.12d
2.79±0.14bcd
2.84±0.15bcd
2.91±0.15cd
2.63±0.17ab
64
43
74
84
113
171
147
158
235
303
109
14.54±1.53de
13.99±1.33cde
13.36±0.93cde
12.77±0.82bcd
14.54±0.76de
15.53±0.66e
12.41±0.69bc
10.65±0.82ab
10.17±0.86a
11.48±0.89abc
10.74±0.97ab
55
36
62
68
76
148
117
141
206
294
101
15.00±1.79 a
14.99±1.49 a
14.71±1.23 a
16.84±1.10 ab
21.82±1.01 d
20.88±0.85 cd
19.02±0.88 bc
16.76±1.02 ab
16.17±1.07 a
16.57±1.11 ab
17.11±1.21 ab
47
33
50
60
64
122
100
110
187
263
96
565
465
334
225
140
81
2.38±0.04a
2.65±0.04b
2.79±0.04c
2.87±0.05c
2.86±0.05c
2.81±0.06c
420
387
297
196
128
73
11.75±0.24a
12.62±0.24b
12.88±0.25bc
12.94±0.28bc
13.58±0.31c
12.71±0.37bc
334
347
261
178
116
68
15.86±0.29a
16.80±0.28b
16.83±0.31b
16.75±0.33b
17.19±0.37b
16.86±0.45b
279
292
232
163
104
62
17.49±0.29a
18.07±0.29ab
18.58±0.30b
18.15±0.33ab
18.25±0.37ab
17.97±0.44c
219
235
187
135
88
56
21.39±0.39 a
21.83±0.38 a
22.01±0.40 a
21.64±0.43 a
21.90±0.47 a
22.10±0.54 a
897
913
2.78±0.04 a
2.67±0.04 b
736
765
13.17±0.23 a
12.32±0.23 b
637
667
17.74±0.27 a
15.69±0.27 b
545
587
19.65±0.27 a
16.75±0.27 b
410
510
23.92±0.37 a
19.70±0.36 b
562
248
2.72±0.03 a
2.74±0.04 a
1317
184
11.97±0.21 a
13.52±0.28 b
1149
155
16.48±0.24 a
16.94±0.36 a
1020
112
18.69±0.23 a
17.70±0.35 b
1835
85
22.31±0.32 a
21.31±0.46 b
Means with different superscripts differed significantly (P<0.05) from each other.
75
17.96±2.02 abcd 37
16.92±1.80 abc 31
17.08±1.26 abc 43
18.15±1.13 bcd 56
21.53±1.04 d
60
20.93±0.87 d
63
19.92±0.91 cd
83
16.26±1.04 ab
92
14.91±1.10 a
157
17.07±1.14 abc 207
19.44±1.23 cd
91
20.41±2.50 ab
21.58±2.27 abc
18.71±1.61 a
21.63±1.49 abc
26.24±1.39 d
26.21±1.66 cd
25.05±1.21 bcd
19.68±1.42 a
17.77±1.47 a
19.57±1.51 a
21.07±1.60 ab
348
KUSHWAHA ET AL.
[Indian Journal of Animal Sciences 80 (4)
Table 2. Estimates of heritability (diagonal), genetic correlations (below diagonal) and phenotypic correlations (above diagonal) of
growth traits of Chokla sheep
Traits/parameter
Birth wt.
3 M BW
6 M BW
9 M BW
12 M BW
Birth wt.
3 M BW
6 M BW
9 M BW
12 M BW
0.36±0.07(1810)
0.66±0.12
0.26±0.18
0.28±0.18
0.17±0.16
0.44
0.43±0.09(1501)
0.68±0.10
0.37±0.16
0.23±0.17
0.28
0.69
0.37±0.09(1304)
0.51±0.15
0.46±0.15
0.32
0.55
0.68
0.32±0.09(1132)
0.89±0.05
0.30
0.51
0.61
0.80
0.48±0.11(920)
Figures in parentheses indicate number of observations.
Sivakumar et al. (2006) and Reddy et al. (2009) who obtained
significant effect of period/year of birth on body weights of
sheep. The body weight differences among lambs born in
different periods in our study may be attributed to differences
in management, selection of rams and environmental
conditions etc. The parity of dam contributed significantly
(P<0.01) for all growth traits of lamb except weight at 12
months of age (Table 1). The lambs born in third or later
parities were heavier except at birth than the lambs of younger
ewes. Similarly, Mandal et al. (2003) found significant effect
of parity of dam on different body weights of Muzaffarnagari
lamb. The low birth weight of lambs in younger ewes may
be due to the existence of relative competition between the
still growing ewes and the developing foetus for nutrients/
food. Season of birth had significant effect on weights of
lambs at 3, 9 and 12 months of age. The significant effect of
season of birth on body weights was also reported in different
breeds of sheep (Kumar et al. 2007, Reddy et al. 2009). The
significant effect of the season of birth on 9 and 12 months
body weight may be due to those lambs born in AugustSeptember passing through a period with a favorable climate
during January to April when the grazing of good quality
was available. Male lambs achieved significantly (P<0.01)
higher body weights at all stages of growth than their female
counterparts (Table 1). The increase in the ratio of male to
female body weight as the lambs became older and their body
weights increased, probably arises from the increasing
differences in the endocrine system between males and
females (Swenson and Reece 1993). These sex differences
are consistent with results from other investigations
(Waghmode et al. 2008, Reddy et al. 2009).
selection. Both the phenotypic (0.44) and genetic (0.67)
correlation (0.67) of birth weight with weaning weight was
moderately high in magnitude, but the correlation of birth
weight with body weights at subsequent ages ranged from
low to medium and positive (0.17 to 0.32). The phenotypic
correlations of weaning weight with 6, 9 and 12 months body
weight were also significant and high (0.51 to 0.69) but
declined steadily at later stages. The genetic correlations of
weaning weight with the body weights at subsequent ages
showed a similar trend. The 6-and 9-month body weights
had significant, high positive phenotypic and genetic
correlations with their subsequent body weights and these
correlations were statistically significant (P<0.01). The
moderately medium to high genetic correlations between
birth weight and weaning weight, and of weaning weight
with 6, 9 and 12 months body weight in this study indicates
that selection for increased birth weight in the sheep will
also result in genetic improvement in the subsequent
development of body weights.
The present study revealed that different environments
affect significantly the growth traits of Chokla sheep. The
high heritabilities of body weights and high genetic
correlation among the body weights at different stages
suggest that selection for increased early growth traits will
lead to genetic improvement in the subsequent development
of body weights.
ACKNOWLEDGEMENTS
The author is grateful to the Director, Central Sheep and
Wool Research Institute (CSWRI), Avikanagar, Rajasthan,
for providing all facilities to conduct this study. Help rendered
from the staffs of Chokla sheep unit for data management
for this flock is also duly acknowledged.
Genetic and phenotypic parameters
The genetic and phenotypic correlations and heritability
estimates for growth traits are presented in Table 2. The
heritability of body weights tended to increase with
increasing age from birth to weaning and subsequent weights
except for that at 9 months of age. The heritabilities of body
weights at birth and at 3, 6, 9 and 12 months of age observed
in this study were high (0.32–0.48) in magnitude, as
compared to the estimates of Nehra and Singh (2006), which
indicate ample scope of improvement of these traits by
REFERENCES
Harvey W R. 1990. User’s guide for LSMLMW PC–2 Version mixed
model least-squares maximum likelihood computer program.
Minneograph Columbus, Ohio, U.S.A.
Kushwaha B P, Kumar S, Kumar R and Mehta B S. 1997. The
Chokla sheep in India. Animal Genetic Resources Information,
Rome, Food and Agricultural Organization 22: 19–27.
Kramer C Y. 1957. Extension of multiple range tests to group
76
April 2010]
FACTORS AFFECTING GROWTH OF CHOKLA SHEEP
correlated adjusted means. Biometrics 13: 13.
Kumar V Ramesh Saravana, Sivakumar K, Singh D, Anandha
Prakash, Ramesh V, Muralidharan J and Devendran P. 2007.
Non genetic factors affecting birth weight of Mecheri lambs.
Indian Journal of Small Ruminants 13(2): 228–30.
Mandal A, Pant K P, Nandy D K, Rout P K and Roy R. 2003.
Genetic analysis of growth traits in Muzaffarnagari sheep.
Tropical Animal Health and Production 35: 271–84.
Nehra K S and Singh V K. 2006. Genetic evaluation of Marwari
sheep in arid zone: growth. Indian Journal of Small Ruminants
12(1): 91–94.
Reddy Y Ravindra, Naidu P Thyagaraja and Rao S T Viroji. 2009.
349
Growth performance of Nellore breed of sheep in India. Indian
Journal of Small Ruminants 15(1): 118–20.
Sivakumar T, Soundararajan C, Palanidorai R, Ganeshkumar G,
Mahendrans M and Malathi G. 2006. Factors affecting birth
weight in Madras Red lambs. Indian Journal of Small Ruminants
12(1): 115–16.
Swenson M J and Reece W O. 1995. Dukes’ Physiology of Domestic
Animals. 11th edn. Cornell University Press, Ithaca, NY, 962
pp.
Waghmode P S, Sawane M P, Pawar V D and Ingawale M V. 2008.
Effect of non-genetic factors on growth performance of Madgyal
sheep. Indian Journal of Small Ruminants 14(1): 127–30.
77
Indian Journal of Animal Sciences 80 (4): 350–353, April 2010
Growth rate and wool production of Marwari lambs under arid region of Rajasthan
H K NARULA1, AJAY KUMAR2, M AYUB3 and VIMAL MEHROTRA4
Central Sheep and Wool Research Institute, Arid Region Campus, Bikaner, Rajasthan 334 006 India
Received: 23 April 2009;Accepted: 20 November 2009
ABSTRACT
Marwari breed, an important carpet wool producing sheep breed of India, is well adapted to harsh and erratic climatic
conditions of hot arid region, and has capacity to cover large area during migration. The present study was conducted to
evaluate growth and wool production of Marwari lambs in an organized farm under hot arid climate of Rajasthan. The
data on 981 lambs born during 2004–07 were utilized for assessing production potential of Marwari sheep maintained
at the Central Sheep and Wool Research Institute, Arid Region Campus, Bikaner. The overall least squares means for
birth, 3, 6, 9 and 12 months weight of lambs were 2.93±0.01, 15.88±0.09, 22.59±0.12, 28.22±0.11 and 30.44± 0.12 kg,
respectively. The effects of sex, type of birth and year of lambing were highly significant on all the body weights. The
improvement in the body weights at all stages was observed during the period under study. The overall least squares
means for first and second six monthly greasy fleece weights were 596.93±5.48 and 675.43±7.46 g, respectively. The
greasy fleece yield was significantly affected by year, type of birth and sex of lamb. The overall least squares means of
fibre diameter, hetro fibres, hairy fibres, medullation, staple length and crimps were 33.56±0.26 μ, 36.00±0.70%,
17.66±0.43%, 53.66±0.85%, 5.15±0.05 cm and 0.66±0.01 per cm, respectively. It was concluded that there was an
improvement in growth and wool production in the Marwari sheep due to selection programme being applied in the
Network Project on sheep.
Key words: Average daily gain, Growth, Marwari sheep, Sheep, Wool yield, Wool quality
Marwari sheep at an organized farm under arid conditions
of Rajasthan.
Marwari, an important carpet wool producing sheep breed
having medium and coarse carpet wool, is widely distributed
in Jodhpur, Jalore, Nagaur, Pali and Barmer districts of
Rajasthan. This breed is well adapted to harsh and erratic
climatic conditions of hot arid regions and has capacity to
cover large areas during migration. Early expressed growth
traits are very important economic traits and could be used
for genetic improvement of traits. Better growth is essential
for appropriate reproduction, production and survivability
in sheep. Better growth rate and wool yield has direct
relevance to sheep farmers because heavier lambs with high
growth rate and high wool yield will lead to more economic
returns to sheep farmers. Besides genetic merit, these traits
are largely determined by non-genetic factors. Before
planning and implementing a sheep breeding plan through
selective breeding, it is necessary to evaluate factors affecting
body weights and greasy fleece yields. Therefore, in the
present study an attempt was made to evaluate the growth,
wool yield, wool quality and factors affecting these traits in
MATERIALS AND METHODS
The data collected on 972 Marwari lambs born during
2004 to 2007 at the Central Sheep and Wool Research
Institute, Arid Region Campus, Bikaner,Rajasthan, under the
project entitled “Improvement of Marwari sheep for carpet
wool production through selection (Network Project on
Sheep Improvement)” were utilized for the present study.
The climate of Bikaner is hot arid with normal rainfall of
200–240 mm. The lambs were maintained in groups under
semi-intensive system of management with 8 h grazing per
day. The lambs were allowed to suckle their dams up to 3
months of age. The suckling lambs were also fed concentrate
mixture up to weaning and allowed to graze separately from
their dams. The lambs were supplemented with 250– 300 g
concentrate ration after weaning during various growth
stages. These were offered green as well as dry fodder during
lean period. The data were recorded for sex of lamb, date of
lambing, dams’ weight at lambing and live body weights at
birth, 3, 6, 9 and 12 months of age along with greasy fleece
weights in first and second 6 monthly clips. Average daily
weight gains of individual lamb during 0–3, 3-6 and 6–12
Present address: 1 Senior Scientist, (E mail hknarula
@yahoo.co.in), 2 Scientist.
3,4 Technical Officers, Central Sheep and Wool Research
Institute, Arid Region Campus, Bikaner.
78
April 2010]
GROWTH RATE AND WOOL PRODUCTION OF MARWARI LAMBS
months were calculated. The animals were washed properly
48 h before shearing to remove dirt and dust from wool and
for smoothening shearing of animals. All the animals were
shorn twice a year, i.e. spring and autumn and shearing was
carried out using scissors in March and August, respectively.
The wool samples (588) were collected from the mid side
region of the body of animals and analyzed for various fibre
quality traits, viz. fibre diameter, hetro fibre, hairy fire,
medullation, staple length and crimps. The breeding rams
were selected on the basis of an index incorporating 6 months
live body weight and first six monthly greasy fleece yields.
The ewes were mated at random to the selected males. The
data on growth traits and greasy fleece yields were classified
according to year of lambing, sex of lambs and type of birth.
The statistical analysis was carried out (Harvey 1990) to
assess the impact of sex of lamb and year of lambing on
body weights and average daily weight gains by taking year
of lambing, sex of lamb and type of birth as fixed effect.
351
predominant across different months of year, growth of
pasture, incidence of certain diseases etc. In addition to this,
continuous selection and culling process also created
differences in performance. On account of genetic/other
factors such as selection of rams for breeding, culling of old
and inferior stock and flock strength across different months
of year and age composition of flock at different intervals
due to overlapping generations, there could be variations in
growth and other performance traits. The weight gain/day
from birth to 3 months, 3 to 6 months, 6 to 12 months was
observed to be 143, 75.14 and 40.77 g, respectively.
Comparatively, lower body weights at birth, 3, 6, 9 and 12
months were reported by Nehra and Singh (2006). The
significant influence of year of birth on all the body weights
at different stages was reported by Narula et al. (2007) and
Dass et al. (2008). The average daily gains during 0–3, 3-6
and 6–12 months ranged from 128.67 to 156.13 g, 66.94 to
89.90 gm and 28.71 to 50.67 g, respectively. The growth
performance showed an increasing trend with slight
fluctuations. The 6 and 12 months body weights improved
from 21.07 kg 24.84 kg and 28.2 kg to 30.63 kg, respectively.
Sex of lambs had significant effect on all the body weights
at different ages and various average daily gains (Table 2).
Males were significantly heavier than females at all the stages
of growth and it may be due to differences in physiology of
two sexes. The findings are in agreement with those reported
by Nehra and Singh (2006), Narula et al. (2007), Dass et al.
(2008) and Narula et al. (2009).The birth, weaning, 6, 9 and
12 months weights in males were 4.18, 12.44, 19.10, 17.53
and 20.02%, respectively, higher than females. Besides the
effects of sex hormones and other physiological factors,
differences in body weights of male and female lambs/
hoggets could be due to differential culling rates as more
number of males was culled after the hogget stage while
RESULTS AND DISCUSSION
Growth performance: The overall least squares means for
live body weights at birth, 3, 6, 9 and 12 months of age are
given in Table 1. The birth weight ranged between 2.98 and
3.07 kg. The 6 and 12 months body weights ranged between
20.58 to 24.84 and 28.20 to 33.08 kg, respectively. All the
body weights were influenced significantly (P<0.01) by year
of lambing. The year differences could be due to varying
availability of feeds/fodders, physical environment and other
management factors prevailing in different years. Though,
efforts were made to ensure uniform feeding and management
of the flock over the years, there were many such factors
which were beyond the control of farm managers. To list a
few such factors are wind velocity, rainfall, sunshine hours,
minimum and maximum temperatures, types of grasses
Table1. Least squares means for live body weights (kg) at different ages in Marwari sheep
Trait/Effect
Birth wt
Overall mean
2.93±0.01 (981)
Sex
**
Male
2.99±0.02 (511)
Female
2.87±0.02 (470)
Year
**
2004
2.98±0.03 (271)
2005
2.75±0.04 (102)
2006
2.92±0.02 (307)
2007
3.07±0.02 (301)
Type of birth
**
Single
3.28±0.02 (765)
Twin
2.59±0.023(216)
Regression
coefficient of **0.041±.003
DWts at
32.24±3.97
lambing average
3 M wt
6 M wt
9 M wt
12 M wt
15.88±0.09 (972)
**
16.81±0.11 (504)
14.95±0.11 (468)
**
15.38±0.15 (271)
17.18±0.23 (99)
14.36±0.13 (303)
16.61±0.13 (299)
**
17.05±0.09 (761)
14.71±0.16 (211)
22.59±0.12 (946)
**
24.56±0.15 (486)
20.62±0.15 (460)
**
21.07±0.20 (269)
23.87±0.29 (97)
20.58±0.16 (295)
24.84±0.18 (285)
**
23.68±0.11 (740)
21.51±0.21 (206)
28.22±0.11 (743)
**
30.50±0.14 (375)
25.95±0.15 (368)
**
26.43±0.18 (222)
31.74±0.31 (77)
25.70±0.18 (217)
29.02±0.18 (227)
**
28.53±0.12 (591)
27.05±0.23 (152)
30.44±0.12 (643)
**
33.21±0.17 (298)
27.67±0.16 (345)
**
28.20±0.21 (192)
33.08±0.33 (77)
29.83±0.20 (214)
30.63±0.23 (160)
**
30.73±0.13 (509)
29.27±0.26 (134)
**0.281±0.020
32.25±3.96
DWt,Dams’ weight at lambing, ** significant (P<0.01),figures in parentheses are number of observations.
79
352
NARULA ET AL.
[Indian Journal of Animal Sciences 80 (4)
Table 2. Least squares means for average daily gains (g) in different periods
Particulars
Overall mean
Sex
Male
Female
Year
2004
2005
2006
2007
Type of birth
Single
Twin
ADG 1 (0–3 M)
ADG 2 (3-6 M)
ADG 3 (6–12 M)
Number
Mean
Number
Mean
Number
Mean
972
143.41±1.01
**
153.06±1.26
133.68±1.27
**
130.82±2.06
156.13±2.44
128.67±1.39
150.29±1.46
**
152.14±2.06
134.69±1.73
940
75.14±1.04
**
86.36±1.30
63.93±1.31
**
64.06±1.73
79.68±2.51
66.94±1.43
89.90±1.51
NS
74.17±0.97
76.12±1.79
637
40.77±0.64
**
44.01±0.83
37.53±0.77
**
35.80±1.06
48.52±1.44
50.67±0.85
28.71±1.03
**
38.63±0.58
42.91±1.12
504
468
271
99
303
299
761
211
484
456
263
97
295
285
735
205
females were retained to replenish the fertility of stock
through replacement of older ewes with younger and
genetically superior ones. Selection intensity in males is much
higher than females. Type of birth had significant effect
(P<0.01) on all the body weights. Single born animals were
heavier than twin born animals at all the stages of growth.
The single born animals were heavier by 26.66, 15.90, 10
and 4.98% at birth, 3, 6 and 12 months, respectively. The
differences in the body weights were higher at initial stage
than later stages.
Regression of dam’s weight at lambing was found highly
significant on birth and 3 months weight. The results
indicated that if dam is heavier at lambing then its lamb will
also be heavier at birth and subsequent ages. The higher birth
weight of heavier lambs may be due to body conditions of
dam during pregnancy and lactation, which in turn resulted
into healthy and heavier lambs. Sharma et al. (2003), Narula
et al. (2007) and Dass et al. (2008) also found similar trend
of regression of dams weight at lambing on birth and weaning
weights of lambs.
Wool yield: The overall least squares means for first greasy
fleece yield and second 6 monthly greasy fleece yields were
596.93 and 675.43 g, respectively (Table 3). In contrast to
body weights, the female lambs produced more fleece than
males. This may be due to higher primary and secondary
follicles in females and also because of higher staple length
and crimps in females. The lower values of clips yields were
reported by Dass et al. (2008) in Marwari sheep. The
influence of year and type of birth was significant (P<0.01)
on first and second 6 monthly greasy fleece yield (GFY).
The significant influence of year and sex was also reported
by Dass and Singh (2002) and Dass et al. (2008). As far as
type of birth is concerned, the single born lambs produced
more clip yield than twin born lambs which was upto 4.7%.
The wool yield of both clips improved over the years with
slight fluctuations. The first clip and second six monthly
greasy fleece yield improved by 20.17 and 18.14%,
293
344
186
77
214
160
503
134
Table 3. Least squares for different wool (g)
Particulars
First clip
Number
Overall mean
Sex
Male
Female
Year
2004
2005
2006
2007
Type of birth
Single
Twin
951
493
458
271
96
295
289
744
207
Second clip
Mean
Number
Mean
596.93±5.48
**
597.47±6.98
596.39±7.32
**
521.89±9.24
622.68±13.3
615.96±7.93
627.19±8.15
**
603.50±5.16
590.36±9.51
590
675.43±7.46
**
635.59±10.58
715.27±8.90
**
569.85±12.20
699.87±16.53
758.77±10.83
673.25±11.69
**
690.94±6.79
659.92±13.17
241
349
184
76
172
158
472
118
First clip, first six monthly greasy fleece yield;second clip,
second six monthly greasy fleece yield.
respectively, in 2007 (as compared to 2004). Still, there is
scope of improvement in greasy fleece yield by introducing
more genetic variability and introducing new sire lines in
the flock.
Wool quality: The overall least squares means for fibre
diameter, hetro fibres, hairy fibres, medullation, staple length
and crimp were 33.56±0.26 μ, 36.00±0.70%, 17.66±0.43%,
53.66±0.85%, 5.15±0.05 cm and 0.66±0.01 per cm,
respectively (Table 4). Comparatively lower fibre diameter
and medullation% were reported by Dass et al. (2008) in
Marwari breed. All the wool quality traits were significantly
affected by year of lambing except medullation%. The
significant effect of year on these traits was also reported by
Dass and Singh (2002) and Dass et al. (2008). The staple
length varied between 4.92 and 5.42 cm and this fulfills the
requirement of carpet industry for making good quality
carpets. The difference in wool quality parameters in different
years may be due to availability of varying levels of feeds
80
April 2010]
GROWTH RATE AND WOOL PRODUCTION OF MARWARI LAMBS
353
Table 4. Least squares means for wool quality attributes of Marwari sheep
Effect/trait
Fibre diameter (μ)
Hetro fibre(%)
Hairy fibre(%)
Medullation (%)
Staple length (cm)
Crimp(/cm)
Overall Mean
Sex
Male
Female
Year
2004
2005
2006
2007
33.56±0.26 (588)
**
34.67±0.28 (385)
32.44±0.43 (203)
**
34.56±.49 (141)
34.86±0.46 (121)
31.80±0.37 (183)
34.01±0.44 (143)
36.00±0.70 (588)
NS
37.29±0.77 (385)
34.70±1.16 (203)
**
37.56±1.30(141)
31.24±1.25(121)
37.79±1.01(183)
38.95±1.19(143)
17.66±0.43 (588)
NS
18.24±0.48 (385)
17.08±0.72 (203)
**
18.31±.79 (141)
22.89±0.77 (121)
14.72±0.62 (183)
15.37±0.74 (143)
53.66±0.85 (588)
*
55.54±0.94 (385)
51.79±1.40 (203)
NS
55.87±1.64 (141)
54.14±1.52 (121)
52.52±1.22 (183)
54.33±1.44 (143)
5.15±0.05 (558)
**
4.85±0.05 (385)
5.46±0.08 (203)
**
5.19±.07 (141)
5.42±0.08 (121)
5.12±0.07 (183)
4.92±0.09 (143)
0.66±0.01 (558)
**
0.59±0.02 (385)
0.73±0.03 (203)
*
0.39±.02 (141)
0.62±0.03(121)
0.72±0.02(183)
0.65±0.03(143)
and fodders in terms of quality and quantity during different
years. The influence of sex was significant on fibre diameter,
medullation%, staple length and crimp per cm. The males
were coarser in wool quality as compared to females as
indicated by higher fibre diameter. The wool quality
parameters indicated suitability of fibres produced by
Marwari sheep for use in carpet industry. The percentage of
hairy fibres should be between 10 and 15% for quality and
life of carpets. So, there is need to further reduce medullation
percentage and hairy fibres to establish this breed as best
carpet wool breed of arid region.
It is concluded from the present study that despite high
temperature, poor humidity and low rainfall resulting in
reduction of vegetation in pasture land and causing
physiological stress to the animals this breed performs well.
At present Marwari breed is superior to majority of the
indigenous carpet wool producing breeds in body weights
and wool quantity. The quality of wool is also suitable for
medium quality carpets. Hence it can be used for genetic
improvement programmes in the farmers flocks located in
the breeding tract of Marwari sheep.
REFERENCES
Dass G and Singh V K. 2002. Improvement of Marwari sheep in
hot arid climate. Indian Journal of Animal Sciences 72: 253–
56.
Dass G, Sharma P R and Mehrotra V. 2008. Production performance
of Marwari lambs under hot arid region of Rajasthan. Indian
Journal of Animal Sciences 78: 117–20.
Harvey W R. 1990. Mixed Model Least Squares’ and Maximum
Likelihood Computer Programme PC–2 version. Ohio State
University, USA.
Narula H K, Dass G, Sharma, P R, and Mehrotra, V. 2007. Impact
of selection on growth and reproductive performance of Marwari
sheep in arid region of Rajasthan. Abstracts. National
Symposium on Recent trends in technological interventions for
rural prosperity in small holder livestock production
systems.College of Veterinary Science, Tirupati from 20–22
June, 2007, pp 49.
Narula H K, Dass G, Sharma P R and Mehrotra, V. 2009.Growth
performance and survivability of Marwari lambs in an organized
farm. National Symposium on Livestock Biodiversity
Conservation and Utilization: Lessons from Past and Future
Perspectives.NBAGR, Karnal from 12–13, February, 2009, pp
167.
Nehra K S and Singh V K. 2006. Genetic evaluation of Marwari
sheep in arid zone: Growth. Indian Journal of Small Ruminants
12: 91–94.
Sharma M K, Sharma N K, Singh V K and Beniwal B K. 2003.
Genetic evaluation of Nali and Marwari sheep in arid zone of
Rajasthan. Indian Journal of Small ruminants 9: 65–68.
ACKNOWLEDGEMENTS
Thanks are due to the Director of CSWRI and Head, ARC
Bikaner, for providing necessary facilities and cooperation
during the course of this study.
81
Indian Journal of Animal Sciences 80 (4): 354–357, April 2010
Effect of supplementing bypass fat prepared from soybean acid oil on milk yield and
nutrient utilization in Murrah buffaloes
S S THAKUR1 and S K SHELKE2
National Dairy Research Institute, Karnal, Haryana 132 001 India
Received: 6 April 2009;Accepted: 20 November 2009
ABSTRACT
This experiment was conducted to study the effect of supplementing Ca salts of soya acid oil fatty acids on milk
production, its composition and nutrient utilization in lactating buffaloes. Lactating Murrah buffaloes (16) were divided
in 2 groups (milk yield 7.08, 6.92 kg/d; 30 and 25 days in milk, 2–4 lactation) of 6 animals in each group, and the
animals in control group were fed with wheat straw, green maize fodder and concentrate mixture as per requirements
and the animals in experimental group were fed with the same ration as that of control group along with 4% Ca salts of
soya acid oil fatty acids of total DMI for 90 days. The average milk yield in experimental group was higher by 12.43%
over that of control group. Similarly, the 4% FCM yield was higher by 13.40% in experimental group over that of
control group. There was no difference in milk protein, total solids and solid not fat in both groups except milk fat
content which was higher in experimental group than that of control group. The total LCFA and MUFA content in milk
fat was higher in experimental group compared to control group. The DMI and CPI were similar in both groups,
whereas TDNI was higher in experimental group than that of control group. The digestibility coefficient of DM, CP, CF,
NDF and ADF were similar in both groups except EE which was higher in experimental group than that of control
group. It could be concluded that supplementation of Ca salts of soya acid oil fatty acids at 4% of DMI improved milk
yield and proportion of unsaturated FA and LCFA in milk fat in Murrah buffaloes.
Key words: Buffalo, Bypass fat, Ca salts of soya fatty acids, Milk yield, Nutrient utilization
(milk yield 7.08, 6.92 kg/d; 30 and 25 days in milk, 2–4
lactation) of 6 animals in each group. The animals in control
group were fed with wheat straw, green maize fodder and
concentrate mixture as per requirements (Kearl 1982) and
the animals in experimental group were fed with the same
ration as that of control group along with 4% Ca salts of
soya acid oil fatty acids of total DMI for 90 days. The
concentrate mixture contained maize 33, groundnut cake 21,
mustard cake 12, wheat bran 20, deoiled rice bran 11, mineral
mixture 2 and common salt 1 part. The lactating buffaloes
were housed in a well ventilated paddock having individual
feeding mangers and space for separate tying of individual
animal and provided with fresh and clean tap water three
times daily at 8.00 h, 12.00 h and 18.30 h. These buffaloes
were hand milked twice a day, in the morning and in the
evening. Digestibility trial was conducted under the same
housing management conditions at the end of trial.
Calcium salts of soya acid oil fatty acids were prepared
using double decomposition method (Deuel 1951). Soybean
acid oil was heated in a metal container; an aqueous solution
of sodium hydroxide was added and again heated to cause
saponification, sodium salts so formed were dissolved in
Feeding Ca soaps of fatty acids, which are inert in rumen,
to high producing lactating cows, can enhance dietary energy
density and therefore, energy intake in early lactation without
compromising the activity of rumen microflora (Jenkins and
Palmquist1984). Thus, the deleterious effect of acute negative
energy balance on lactation performance in animals can be
alleviated. Rumen inert fat provides partial resistance from
ruminal biohydrogenation and hence enhances beneficial
fatty acid profile of milk and body tissues from human health
point of view (Mishra et al. 2004, Tyagi et al. 2009). Such
quality milk can be used as a nutraceutical for prevention of
various life style diseases.
Considering the above points, a feeding trial was
conducted to investigate the effect of bypass fat supplementation on milk production, fatty acid profile of milk and
nutrient utilization in Murrah buffaloes.
MATERIALS AND METHODS
Lactating Murrah buffaloes (12) were divided in 2 groups
Present address: 1 Principal Scientist (email: sst_ndri
@yahoo.co.in), 2Ph. D. Scholar, Dairy Cattle Nutrition Division.
82
April 2010]
BYPASS FAT FEEDING TO LACTATING MURRAH BUFFALOES
excess boiling water. Calcium chloride dissolved in water
was then added slowly to the water soluble sodium soaps
with stirring causing immediate precipitation of calcium salts.
Excess water was removed by squeezing soaps through
cheese cloth. The soap was allowed to air dry and then lumps
were broken before being mixed with other concentrate
ingredients (Jenkins and Palmquist 1984). The level of
protection of the rumen inert fat was judged by estimating
the degree of saponification of the Ca soaps (Garg and Mehta
1998). From the pooled milk samples of individual animal,
the fatty acid analysis of milk and feed samples, viz. green
fodder, concentrate and rumen protected fat was done using
saponification method (Gulati and Ashes 2000). The analysis
was carried out on GLC fitted with flame ionization detector
and 50 m length of capillary column. Initial temperature of
the column was 140ºC. The RAMP rate was 2 ºC/min.
Identification of peaks was made through retention time of
the reference standards.
DM, CP, EE, CF and total ash of feed and faecal samples
were analyzed (AOAC 2005), and NDF and ADF were
estimated (Goering and Van Soest 1970). Milk samples were
analyzed for total solids, protein and SNF as per AOAC
(2005), whereas, milk fat by REIL, electronic milk fat tester.
Statistical analyses of the data were carried out using
Students‘t’ test as per Snedecor and Cochran (1980).
experimental group. Average 4% FCM yield was 11.86 kg/d
in control group, and it was enhanced (P<0.05) by 13.40%
in experimental group (13.45 kg) over that of experimental
group. Control group reached the peak yield in second
fortnight and experimental group at third fortnight but the
average peak production was also better (P<0.05) in
experimental group. Higher peak yield and milk production
observed in experimental group may be attributed to
enrichment of ration with Ca salts of soya acid oil fatty acids
that increased the energy density of the ration. The present
results are in line with the findings of Fahey et al. (2002);
McNamara et al. (2003); Mishra et al. (2004) and Tyagi et
al. (2009) who observed improvement in milk yield on
supplementation of bypass fat to cows.
Milk fat ranged from 5.29 to 6.00% in control group and
5.15 to 6.20% in experimental group during different
fortnights. The overall average milk fat% was higher (P<0.05)
in experimental group (6.16) than that of control (5.94). There
was no effect on protein, total solids and SNF contents of
milk in the 2 groups (Table 3). Our results are in agreement
with those of previous researchers who reported improvement
in milk fat but no effect on protein, Total solids and SNF
contents on addition of bypass fat (Sklan et al. 1994,
McNamara et al. 2003).
The contents of myristoleic acid (C14: 1), palmitoleic acid
(C16: 1), elaidic acid (C18: 1t9), oleic acid (C18: 1c9),
linoleic acid (C18: 2), linolenic acid (C18: 3) and arachidic
acid (C20: 0) in the milk fat of experimental group were
higher as compared to that of control group (Table 2). Total
unsaturated fatty acids increased by 21.76% in experimental
group over control group, saturated fatty acid content showed
a decrease of 14.14 whereas, that of monounsaturated fatty
acids (MUFA) also elevated in experimental group by 9.39%
than control group, respectively. The total long chain fatty
acids (LCFA) content was also higher in experimental group.
Dietary bypass fat alters fatty acid profile of the milk towards
the fatty acid content of the supplemental fat. The results
obtained with polyunsaturated fatty acids (PUFA) rich
protected fat feeding (Sampelayo et al. 2004), with Ca salts
of FA (Fahey et al. 2002) and with dietary supplementation
of progressively more unsaturated fatty acids of Canola,
Soybean, and Linseed oil (Chouinard et al. 1998) to cows
are substantiated by the present findings, wherein the PUFA
and unsaturated fatty acid contents were elevated on feeding
of bypass fat made from soya acid oil. Tyagi et al. (2009)
also reported increased MUFA and unsaturated fatty acids
content in milk fat in crossbred cows on supplementing
dietary bypass fat
The DMI ranged from 10.59 to 11.95 kg/d in control group
and 11.28 to 12.72 kg/d in experimental group during six
fortnights. The overall DMI recorded was 11.38 kg and 12.05
kg/d (Table 4) in control and experimental groups,
respectively. The overall DMI/100 kg BW was 2.34 and 2.29
kg/d in control and experimental group, respectively. The
RESULTS AND DISCUSSION
The total fat content (Table 1) in the supplemented rumen
protected fat was 85.35% and the protection level from rumen
hydrolysis (saponifiable portion) was 58.5%. The
predominant fatty acids in protected fat supplement (Table 2)
were palmitic, stearic, elaidic, oleic, linoleic and linolenic
acids.
Average daily milk production (Table 3) ranged from 7.08
to 10.43 kg/d in control group and 6.92 to 11.17 kg/d in
experimental group in different fortnights. Average milk was
9.49 kg/d in control group and it was 12.43% higher (P<0.05)
in experimental group (10.67 kg/d) than that of control group.
Fortnightly average 4% FCM yield (Table 3) ranged from
8.35 to 12.71 in control group and 8.08 to 14.24 kg/d in
Table 1. Chemical composition of feed ingredients
offered (% DM basis)
Particulars
Green
fodder
Wheat
straw
Concentrate
Ca salts of
soya acid oil
DM
OM
CP
EE
CF
NFE
NDF
ADF
Total Ash
22.00
89.00
7.77
1.72
35.75
43.97
70.72
30.72
10.79
92.00
89.82
3.05
1.26
38.87
46.64
77.81
35.55
10.18
92.00
90.99
20.18
3.38
7.99
59.46
38.12
25.14
9.01
96.64
355
85.35
14.58
83
356
THAKUR AND SHELKE
[Indian Journal of Animal Sciences 80 (4)
Table 2. Fatty acid profile (% of total fatty acids) of feed ingredients and milk
Fatty acids (% of total
fatty acids)
Caprylic acid (C8: 0)
Capric acid (C10: 0)
Lauric acid (C12: 0)
Myristic acid (C14: 0)
Myristoleic acid (C14: 1)
Palmitic acid (C16: 0)
Palmitoleic acid (C16: 1)
Margaric acid (C17: 0)
Stearic acid (C18: 0)
Elaidic acid (C18: 1t9)
Oleic acid (C18: 1c9)
Linoleic acid (C18: 2)
Linolenic acid (C18: 3)
Arachidic acid (C20: 0)
Total
Total unsaturated
Total saturated
Total LCFA
Total MUFA
Feeds
Milk
Green
fodder
Wheat
straw
Concentrate
feed
0.51
0.78
3.4
2
0.48
20.77
0.63
ND
3.32
2.45
4.31
16.25
40.59
0.69
95.67
ND
ND
7.03
1.01
ND
20.25
ND
4.32
42.00
ND
13.62
ND
ND
5.63
93.86
0.32
0.55
2.48
1.41
ND
12.83
1.48
ND
34.83
2.65
20.93
2.73
16.26
0.33
96.48
results of the present study indicated that there was no adverse
effect of bypass fat supplementation on DMI of lactating
buffaloes. Similar observations were made by Salfer et al.
(1995) and Elliot et al. (1995) on feeding Ca salts of rapeseed
fatty acids at the rate of 500 g/d in lactating cows, Garg et al.
(2002) on supplementing bypass nutrients (fats encapsulated
in a formaldehyde treated protein) @ 1000 g/d to lactating
cows and buffaloes.
There was no difference in the CP intake between two
groups (Table 4). Average TDNI was 9.13 kg/d in control
group and it was higher (P<0.05) by 8.43% in experimental
group (9.90 kg/d) over that of control group (Table 4).
Average TDN intake/100 kg BW was 2.01 kg/d in
experimental group which was higher (P<0.05) by 5.78%
over that of control group (1.90 kg/d). In the present
Milk yield (kg/d)
FCM yield (kg/d)
Milk composition (%)
Fat
Total solid (TS)
Solids not fat (SNF)
Protein
Control group
Treatment group
9.49a±0.27
11.86a±0.79
10.68b±0.16
13.45b±0.63
5.94a±0.07
15.26±0.04
9.32±0.061
5.59±0.048
6.16b±0.21
15.40±0.07
9.35±0.175
3.72±0.075
0.51
0.42
0.78
0.27
0.54
8.96
0.78
ND
3.81
1.45
21.31
51.57
5.90
0.56
96.86
Control
group
Experimental
group
1.06
3.04
3.42
11.85
0.85
28.65
1.47
0.51
14.65
2.30
25.21
1.41
0.79
0.41
95.62
32.03
63.59
75.40
29.83
0.92
2.46
3.08
8.50
1.18
25.96
1.62
0.24
12.93
2.77
28.06
4.45
0.92
0.51
93.6
39.00
54.60
76.46
32.63
Table 4. Nutrient intake, digestibility coefficient (%) and
efficiency of utilization of nutrients in lactating buffaloes fed
experimental diets
Attributes
Control group
DMI (kg/day)
11.38±0.65
CPI (kg/day)
1.59±0.09
TDNI (kg/day d)
9.13a±0.16
DMI (kg/100 kg BW)
2.34±0.051
CPI (kg/100 kg BW)
0.32 ±.007
TDNI (kg/100 kg BW)
1.90a±0.29
Digestibility of nutrients
DM
65.83±1.34
CP
60.80±2.69
EE
70.68a±2.29
CF
52.87±1.79
NFE
59.07±3.45
NDF
50.07±1.65
ADF
42.40±2.97
Efficiency of utilization of nutrients
DMI (kg/kg) milk yield
1.22±0.019
DMI (kg/kg) FCM yield
0.97±0.017
CPI (g/kg) milk yield
170.09±3.59
CPI (g/kg) FCM yield
137.81± 4.35
TDNI (g/kg) milk yield
960.56±35.56
TDNI (g/kg) FCM yield
766.54±22.34
Table 3. Milk yield and its composition in lactating buffaloes fed
experimental diets
Particular
Bypass
fat
ab
Treatment group
12.05±0.69
1.54±0.08
9.90b±0.22
2.29±0.049
0.30 ±.005
2.01b ±0.21
66.59±1.80
61.56±1.96
82.05b±1.32
53.60±2.58
60.87±2.47
51.32±2.62
43.49±3.20
1.15±0.038
0.90±0.036
157.85±6.09
126.98±8.93
926.65± 15.87
737.86±19.55
- Means having different superscripts in the same row differ
significantly (P<0.05).
abMeans
having different superscripts in the same row differ
significantly (P<0.05).
84
April 2010]
BYPASS FAT FEEDING TO LACTATING MURRAH BUFFALOES
experiment, since the DMI was not adversely affected by
supplementing protected fat, it led to significantly higher
TDNI in experimental group.
There was no effect on the digestibility of DM, CP, CF,
NFE, ADF and NDF (Table 4). However, EE digestibility
was higher (P<0.05) in experimental group than the control
group. In the present study, higher EE digestibility in
experimental group supplemented with Ca salts of soya acid
oil fatty acids is in agreement with the findings of Chouinard
et al. (1998) and Tyagi et al. (2009). Calcium soaps of fatty
acids remain in intact form in the rumen and unlike direct
fat supplementation, do not lead to any toxic effect on rumen
microflora thus not altering the fibre digestion (Schauff and
Clark 1989, Harrison et al. 1995). In the present investigation,
digestibility of fibre fractions was not adversely affected on
supplementation of Ca salts of soya acid oil fatty acids.
There was no effect on the efficiency of conversion of
DMI, CPI and TDNI to milk and 4% FCM in the 2 groups
(Table 4).
Our results indicated that bypass fat prepared from
soybean acid oil supplemented at 4% of DMI, increased milk
production, FCM yield and proportion of unsaturated FA and
LCFA in milk fat of Murrah buffaloes.
357
2002. Effect of feeding rumen protected nutrients on milk
production in cows and buffaloes. Indian Journal of Dairy
Science 56 (4): 218–22.
Goering H K and Van Soest P J. 1970. Forage Fiber Analysis.
Agriculture Handbook No. 379, US Department of Agriculture,
Washington DC.
Gulati S K and Ashes J. 2000. Methods specifically developed or
modified for the feed technology project. Practical Manual.
NDDB, Anand.
Harrison J H, Kincaid R L, McNamara J P, Waltner S, Loney K A,
Riley R E and Cronrath J D. 1995. Effect of whole cottonseed
and calcium salts of long chain fatty acids on performance of
lactating dairy cows. Journal of Dairy Science 78: 181–93.
Jenkins T C and Palmquist D L. 1984. Effect of fatty acids of
calcium soaps on rumen and total nutrient digestibility of dairy
rations. Journal of Dairy Science 67: 978–86.
Kearl C Leonard. 1982. Nutrient requirement of ruminants in
developing countries. International Feedstuff. Utah Agriculture
Experiment Station, Utah State University, Logan USA.
McNamara S, Butler T, Ryan D P, Mee J F, Dillon P, O’mara F P,
Butler S T, Anglesey D, Rath M and Murphy J J. 2003. Effect
of offering rumen-protected fat supplements on fertility and
performance in spring-calving Holstein-Friesian cows. Animal
Reproduction Science 79: 45–46.
Mishra S, Thakur S S and Rakesh K. 2004. Milk production and
composition in crossbred cows fed calcium salts of mustard oil
fatty acids. Indian Journal of Animal Nutrition 21(1): 22–25.
Salfer J A, Linn J G, Otterby D E, Hansen W P and Johnson D G.
1995. Early lactation responses of Holstein cows fed a rumeninert fat prepartum, postpartum, or both. Journal of Dairy
Science 78: 368–77.
Sampelayo M R S, Martín Alonso J J, Pérez L, Gil Extremera F
and Boza J. 2004. Dietary supplements for lactating goats by
polyunsaturated fatty acid-rich protected fat. effects after
supplement withdrawal. Journal of Dairy Science 87: 1796–
1802.
Schauff D J and Clark J H. 1989. Effects of prilled fatty acids and
calcium salts of fatty acids on fermentation nutrient
digestibilities, milk production and milk composition. Journal
of Dairy Science 72: 917–27.
Sklan D, Kaim M, Moallem U and Folman Y. 1994. Effect of dietary
calcium soaps on milk yield, body weight, reproductive
hormones, and fertility in first parity and older cows. Journal
of Dairy Science 77: 1652–60.
Snedecor G W and Cochran W G. 1986. Statistical Methods. 7th
edn. Oxford and IBH publishing Co. Pvt. Ltd., New Delhi.
Tyagi N, Thakur S S and Shelke S K. 2009. Effect of feeding bypass
fat supplement on milk yield, composition and nutrient
utilization in crossbred cows. Indian Journal of Animal Nutrition
26: 1–8.
REFERENCES
AOAC. 2005. Official Methods of Analysis. Association of Official
Analytical Chemists. Washington D C.
Chouinard P Y, Girad V and Brisson G J. 1998. Fatty acids profile
and physical properties of milk fat from cows fed calcium salts
of fatty acids with varying unsaturation. Journal of Dairy
Science 81: 471–481.
Deuel Jr H J. 1951. The Lipids.Vol.1. Chemistry. Interscience
Publication Inc, New York.
Elliot J P, Drackley J K, Fahey Jr G C and Shanks R D. 1995.
Utilization of supplemental fat by dairy cows fed diets varying
in content of non-structural carbohydrates. Journal of Dairy
Science 78: 1512–25.
Fahey J, Mee J F, Murphy J J and Callaghan D O. 2002. Effects of
calcium salts of fatty acids and calcium salt of methionine
hydroxyl analogue on plasma prostaglandin F2 metabolite and
milk fatty acid profile in late lactation Holstein-Friesian cows.
Theriogenology 58: 1471–82.
Garg M R and Mehta A K. 1998. Effect of feeding bypass fat on
feed intake, milk production and body condition of Holstein
Friesian cows. Indian Journal of Animal Nutrition 15: 242–45.
Garg M R, Sheresia P L, Bhanderi B M, Gulati S K and Scott T W.
85
Indian Journal of Animal Sciences 80 (4): 358–361, April 2010
On-farm evaluation of urea molasses multinutrient blocks enriched
with minerals in goats
R SINGH1, S KUMAR2 and R BHARDWAJ3
Sher-e-Kashmir University of Agricultural Sciences and Technology, R S Pura,
Jammu, Jammu and Kashmir 181 102 India
Received: 6 May 2009; Accepted: 25 November 2009
ABSTRACT
To assess the effects of supplementary feeding of urea-molasses multinutrient block (UMMB) enriched with minerals
on productive traits of goats, a study was undertaken in the Kandi belt of Shivalik Hills of North West Himalayas in
Jammu region. Beetal cross goats (25), 1–6 year-old were selected from a private farm of which 20 goats were allowed
to lick a UMMB @ 200 g daily for 30 days during June-July and 5 goats were kept as control. Blood samples were
analyzed for hemato-biochemical parameters, macro and trace elements and hormonal status (T3 and T4) at the beginning
and after completion of trial. Glucose, phosphorus, copper and manganese level increased significantly from 44.62 mg/
dl, 4.16 mg/dl, 18.09 μmol/l and 0.56 μmol/l to 68.50 mg/dl, 5.92 mg/dl, 31.31 μmol/l and 1.40 μmol/l, respectively. No
significant effect of UMMB feeding on Hb, PCV, TPP, albumin, globulin, ALP, Ca, Mg, iron, Zn, plasma inorganic
iodine (PII) and T3 and T4 was observed. An average increase of 15.30% in body weight, 30% in milk yield and 11.50%
in milk fat following UMMB supplementation was observed. It was concluded that UMMB being a good source of
energy, protein and minerals enhanced body weight and milk yield in goats.
Key words: Goats, Hemato-biochemical, Hormones, Milk yield, Mineral, Urea molasses multinutrient blocks
apparently improved the live weight gain in lambs. Thus,
the successful treatment and control of mineral deficiencies
lies in effective and practical methods of supplementation.
The present study was undertaken to evaluate the effect of
UMMB containing area specific mineral mixture as a
supplementary feeding on the general health condition, milk
yield and reproductive performance of goats.
Goats in the Kandi areas of subtropical and intermediate
zones of Shivalik hills are dependent mainly on grazing poor
quality feed resources like grasses, tree leaves, which are
characteristically low in fermentable nitrogen, mineral, and
readily available carbohydrate. These deficiencies result in
poor animal growth rate, poor reproduction and unthrifty
condition. Developing alternate feeding strategies for
ruminant production based on agro-industrial wastes is,
therefore, of prime importance. A UMMB prepared from
locally available agro-industrial by-products has been
adoptable feed supplement, which improves nutritional status
of animals (Kang et al. 2007). Baseline survey to identify
the commonly prevalent deficiencies in the goats was carried
earlier and on that basis plasma analysis area specific mineral
mixture was framed. Rodriguez et al. (1985) observed that
feeding of merely the deficient minerals does not improve
the general health status, production and reproduction of
animals in these areas. However, limited amounts of either a
good quality green forage or rumen undegradable protein
MATERIALS AND METHODS
Beetal cross goats (25), 1 to 6-year-old, reared through
grazing in the Parmandal block of Jammu district in Kandi
belt of Shivalik hills by a farmer were treated with
anthelminthic (fenbendazole) prior to trial. Fifteen goats were
in lactation. Trial was conducted from June-July. Goats were
divided into 2 groups—group 1: 20 goats supplemented with
UMMB, group 2: 5 animals were kept as control. The UMMB
were prepared by cold method by mixing molasses (35%),
urea (10%), deoiled rice bran (10%), oiled rice bran (10%),
groundnut meal (10%), cement (10%), area specific mineral
mixture 14% as per Singh (2009);it has DCP- 70%, MgSO4–
29%, CuSO4–0.5%, MnSO4 –0.5%, K. iodate–0.09%, and
common salt (1%). Close observations were made on selected
goats on changes, if any, in feed intake, milk yield and milk
fat production and body weight. The trial lasted for 30 days
Present address: 1 Associate Professor, 2 JRF, 3 Assistant
Professor, Division of Veterinary Clinical Medicine and
Jurisprudence, Faculty of Veterinary Sciences and Animal
Husbandry.
86
April 2010]
EVALUATION OF UREA MOLASSES MULTI NUTRIENT BLOCKS IN GOATS
and all animals were weighed at the beginning and at the
end of the trial.
Sample collection and analysis: Blood samples of goats
were collected on day 0 and 30th. Haemoglobin and PCV
were analysed by standard methods. Plasma concentration
of glucose, total proteins, albumin, alkaline phosphatase and
urea nitrogen were estimated using autopak kits. Levels of
triiodothyronine (T3) and thyroxine (T4) were assayed by
radioimmunoassay technique using RIA kits procured from
BARC, India. Plasma sample (3 ml) was analysed for mineral
analysis by digesting in distilled concentrated nitric acid AR
(15 ml) and perchloric acid, Merck (3 ml) followed by one
cycle of hydrogen peroxide AR (2.0 ml of 30%). Digestates
(approximately 1–2 ml) were diluted to 15 ml with double
glass distilled water. The concentrations of micro-elements,
viz. Cu, Fe, Zn, Mn and Co were measured by atomic
absorption spectrophotometer. Calcium was estimated by
cresolphthalein complex one method using autopak kit, and
Mg was also analyzed using kit. Inorganic fraction of plasma
phosphorus was determined by the method of Taussky and
Shorr (1953). Plasma inorganic iodine (PII) was determined
as per Aumont and Tressol (1987). Statistical comparison of
data was done as per Snedecor and Cochran (1989).
359
the improvement in productive performance of the animals
on treatment was encouraging. The animals offered UMMB
had better body condition and looked healthier than did
control group. Liu (1995) reported significantly higher live
weight gains (95 g/d) in goats with access to urea-mineral
lick block without molasses (ULB) than in those without
block (73 g/d). Hadjipanayiotou et al. (1993) observed that
effects of urea-containing blocks on live weight gains in cattle
and sheep were more pronounced than the effects on feed
intake.
Haematological parameters: The mean values of
hematological indices Hb and PCV in goats before the start
of trial were 6.37 g/dl and 22.95% which were below the
normal range of 8–12 g/dl and 22–38 per cent, respectively
(Kahn 2005). No significant (P<0.05) effect of UMMB
supplementation on the level of hemoglobin and packed cell
volume was observed in goats after 30 days (Table 1). At the
beginning of trial, 5% (1/20) goats had normal Hb (>8.0 g/
dl) and 35% goats had very low (<6.0 g/dl) Hb concentration.
After 30 days of UMMB supplementation all the animals
were anemic, of which 45% (9/20) had Hb very low (<6.0 g/
dl). On PCV basis also the prevalence of anemia (PCV ≤
22%) was 25% in goats at the beginning as well as at the end
of trial. Thus, present study indicates that supplementation
of nutrients through UMMB was either not adequate or the
duration of trial was short to improve haematological
parameters.
Biochemical changes in blood: The average values of total
plasma protein, albumin and globulin varied nonsignificantly
(P<0.05) from 6.60 g/dl, 2.87 g/dl and 3.80 g/dl) at the
beginning of trial to 6.76 g/dl, 2.69 g/dl and 4.18 g/dl,
respectively, after 30 days of supplementation (Table 1).
Moreover, the average values of total plasma protein, albumin
and globulin were within normal range of 6.1– 7.5 g/dl, 2.4–
4.6 g/dl and 2.7– 4.4 g/dl, respectively, quoted by Kahn
(2005). Considering the critical level of 6.1 g/dl and 2.4 g/dl
for plasma protein and albumin, hypoproteinemia and
hypoalbuminemia were observed in 15 and 5% goats,
respectively, at 0 day as well after 30 days of UMMB
supplementation. Findings of the present study corroborate
RESULTS AND DISCUSSION
The UMMB was palatable to goats and to avoid an
excessive intake, goats were offered UMMB @ 200 g/day
individually after grazing in the evening. Observations on
all closely monitored goats revealed an average increase of
15.30% (range 7–30%) in body weight, 30% in milk yield
and 11.50% in milk fat following UMMB supplementation.
The average body weight of goats of groups 1 and 2 at the
beginning of trial was 30.15 kg and 27.6 kg which increased
to 34.76 kg and 28.1 kg after 30 days of UMMB
supplementation, respectively. According to the owner of
flock marked improvement in the feed intake was observed
however, it could not be estimated as the animals were grazed
and trial was “on-farm”. The average milk yield was 0.50 kg
and milk fat percentage was 3.12%, which, increased to 0.65
kg and 3.48%, respectively, at the end of the trial. Overall,
Table 1. Effect of UMMB supplementation on haemato-biochemical parameters in goats
Animals
Sampling
day
Hb
(g/dl)
PCV
(%)
Glucose
(mg/dl)
TPP
(g/dl)
Albumin
(g/dl)
Globulin
(g/dl)
ALP
(I.U.l-l)
BUN
(mg/dl)
ALT
(I.U.l-l)
Group- 1
0
6.37
± 0.22
5.80
± 0.19
6.22
0.28
5.36
± 0.49
22.95
± 0.58
22.40
± 0.68
22.20
± 0.24
19.0
± 2.30
44.62a
± 2.81
68.50b
± 2.84
56.43ab
± 3.72
66.9ab
± 7.46
6.60
± 0.16
6.76
± 0.21
6.31
± 041
6.44
± 0.32
2.87abc
± 0.05
2.69ab
± 0.06
2.97
± ac 0.03
2.62
± abc0.27
3.80
± 0.15
4.18
± 0.25
3.58
± 0.07
3.82
± 0.48
98.43a
± 18.54
154.96a
± 23.97
72.60ab
± 23.92
40.71b
± 8.79
14.69a
± 0.57
11.20b
± 0.74
15.09ab
± 1.72
10.80b
± 1.26
11.34a
± 0.64
10.2ab
± 0.93
7.20b
± 1.35
7.66ab
± 1.66
30th
Group–2
0
30th
•Means marked with different superscripts a, b differ significantly (P<0.05) in a column.
87
360
SINGH ET AL.
magnesium, iron, zinc and plasma inorganic iodine showed
nonsignificant (P<0.05) variation (Table 3). The average
values of calcium and magnesium were within the normal
range of 9.0 – 11.6 mg/dl and 2.10 – 2.90 mg/dl quoted by
Kahn (2005). Considering the critical level of 9.0 mg/dl, 45%
goats were having hypocalcaemia whereas, after 30 days of
supplementation 65% goats were having hypocalcaemia.
The average value of inorganic phosphorus before the start
of trial was 4.16 mg/dl which was within the normal range,
i.e. 3.7 – 9.7 mg/dl (Kahn 2005). However, at the end of trial
Table 2. Effect of UMMB supplementation on hormonal
status in goats
Animals
Sampling day
T3
T4
Group 1
0
30th
0
30th
0.67±0.02a
0.61± 0.06a
0.63±0.04a
0.45± 0.01b
55.42±3.05
55.57± 4.58
56.30±4.16
55.0± 7.63
Group 2
[Indian Journal of Animal Sciences 80 (4)
•Means marked with different superscripts a, b differ
significantly (P<0.05) in a column.
Table 3. Effect of UMMB supplementation on mineral status in goats
Animals Sampling
day
Group 1
Group 2
0
30th
0
30th
Ca
(mg/dl)
Pi
(mg/dl)
8.46 ± 0.36 4.16 ± 0.37a
8.89 ± 0.40 5.92 ± 0.37b
8.66 ± 0.42 4.22 ± 0.37a
8.15 ± 0.76 4.73 ± 0.78
Mg
(mg/dl)
Cu
(μmol/l)
Fe
(μmol/l)
Zn
(μmol/l)
Mn
(μmol/l)
PII
(ng/ml)
2.96 ± 0.08
2.85 ± 0.13
2.82 ± 0.06
2.67 ± 0.09
18.09 ± 1.81a
31.31 ± 2.02b
21.12 ± 2.14ac
30.94 ± 4.29bc
38.99 ± 3.72a
34.64 ± 2.66a
44.27 ± 2.46a
22.08 ± 2.44b
30.0 ± 6.62abc
38.30 ± 5.33abc
26.43 ± 4.82abc
13.50 ± 2.43ac
0.56 ± 0.13a
1.40 ± 0.16b
0.68 ± 0.17a
1.07 ± 0.16ab
72.44 ± 10.42
92.39 ± 10.71
78. 64 ± 12.68
98. 10 ± 20.56
•Means marked with different superscript a, b, c differ significantly (P<0.05) in a column.
with Brar and Nanda (2008) who also reported nonsignificant
(P<0.05) effect of UMMB supplementation on total plasma
protein and albumin level in anoestrus buffaloes after 4
weeks. As the rumenally degradable fraction of protein
increases in diet, blood urea nitrogen level increases.
However, in present study average value of urea nitrogen
showed significant (P<0.05) decrease from 14.69 mg/dl at 0
day to 11.20 mg/dl at 30th day. Contrary to present finding
Qreshi et al. (2002) have reported that excessive levels of
crude protein in the diet elevated BUN levels.
The glucose level of goats increased significantly (P<0.05)
from 44.62 mg/dl to 68.50 after 30th day of supplementation
of UMMB. The average value at the beginning of trial was
below the normal range of 48–76 mg/dl quoted by Kahn
(2005). Considering the critical level of 48 mg/dl
hypoglycemia was observed in 61.53 and 5.88% goats at 0
and 30th day of trial, respectively. Nonsignificant effect on
alkaline phosphatase and alanine aminotransferase levels
showed that UMMB supplementation had no harmful effect
on the liver and bones.
Triiodothyronine (T3) and thyroxin (T4): The average
value of T3 in plasma samples of goats at the beginning of
trial was 0.67 ng/ml, which showed nonsignificant decrease
(Table 2). Likewise, the mean value of T4 in plasma samples
of goats at the beginning and on 30th day were 55.42 ng/ml
and 55.57ng/ml, respectively. Thus, it can be concluded as
per the suggestion of Underwood (1981) that serum thyroxine
and triiodo-thyronine were poorly related to thyroidal activity
as numerous factors (season, ambient temperature and
intestinal parasitism) modified the activity of thyroid gland
(Pritchard et al. 1974, Andrewartha et al. 1980).
Mineral changes in blood: The average values of calcium,
the goats showed significant (P<0.05) increase in inorganic
phosphorus level to 5.92 mg/dl (Table 3). Considering the
critical level of 3.7 mg/dl, 35% goats were having
hypophosphataemia whereas, after 30 days of supplementation 5% animals were having hypophosphataemia.
The average values of iron and zinc observed in present
study were higher than the normal range of 17.9–35.8 μmol/
l and 12.24–18.36μmol/l, respectively, quoted by Radostits
et al. (2000) in sheep. The average values of copper in postsupplementation group were above the normal range, i.e.
11.0–20.46μmol/l (Radostits et al. 2000) for sheep.
Manganese level of the plasma samples from group 1 goats
increased significantly (P<0.05) from 0.56 to 1.40μmol/l.
Compared with present finding, Underwood and Suttle
(1999) had cited considerably lower normal range of Mn as
0.03276 to 0.0364 μmol/l in sheep. Thus, present study
indicates that supplementation of minerals through UMMB
improved phosphorus and copper plasma levels; however
calcium and iodine levels did not showed much improvement
which could be due to increased demand for higher growth
rate and the milk production observed following UMMB
supplementation or it could be due to short duration of the
supplementation.
ACKNOWLEDGEMENT
Authors are thankful to Department of Science and
Technology, Government of Science and Technology, India,
for funding the research project under which the work was
carried out.
REFERENCES
Andrewartha K A, Caple I W, Davies W D and Mc Donald J W.
88
April 2010]
EVALUATION OF UREA MOLASSES MULTI NUTRIENT BLOCKS IN GOATS
361
responses of sheep to infection with Trichostrongylus
colubriformis. Research in Veterinary Science 17: 182–87.
Qreshi M S, Habib G, Samad H A, Siddiqui M M, Ahmad N, Syed
M. 2002. Reproduction-Nutrition relationship in dairy buffaloes,
1. Effect of intake of Protein, energy and blood metabolites
levels. Asian-Australasian Journal of Animal Sciences 15: 330–
39.
Radostits O M, Gay C C, Blood D C and Hinchcliff K W. 2000.
Veterinary Medicine.9th edn. W B Saunders Harcourt Publishers
Ltd.
Rodriguez A, Riley J and Thorpe W. 1985. Animal performance
and physiological disturbances in sheep fed diets based on
ensiled sisal pulp (Agave fourcroydes). 1. The effect of
supplementation with protein, forage and minerals. Tropical
Animal Production 10 (1): 23–31.
Singh, R. 2009. Project report Mineral Imbalances in Livestock
with reference to soil-plant-animal relationship. Department of
Science and Technology, Government of India, New Delhi.
Snedecor G W and Cochran W G. 1989. Statistical Methods. 8th
edn. Iowa State University Press, London.
Taussky H H and Shorr E. 1953. A micro-calorimetric method for
the determination of inorganic phosphorus. Journal of Biological
Chemistry 202: 675–85.
Underwood E J. 1981. The Mineral Nutrition of Livestock.
Commonwealth Agricultural Bureaux, Farnham Royal, Slough,
England.
Underwood E J and Suttle N F. 1999. The Mineral Nutrition of
Livestock. pp. 397–420. CAB International, Wallingford, Oxon
OX10 8DE UK.
1980. Observations on serum thyroxine concentrations in lambs
and ewes to assess iodine nutrition. Australian Veterinary
Journal 56: 18–21.
Aumont G and Tressol J C. 1987. Rapid method for the direct
determination of inorganic iodine in plasma using ion-exchange
chromatography and the Sandell and Kolthoff reaction. Analyst
112: 875–77.
Brar P S and Nanda A S. 2008. Improving performance of anoestrus
buffaloes through supplementary feeding of urea molasses
multi-nutrient block. Indian Journal of Animal Sciences 78: 606–
08.
Hadjipanayiotou M, Verhaeghe L, Kronfoleh A R, Labban L M,
Amin M, Al-Wadi M Badran A, Dawa K, Shurbaji A, Houssein
M, Malki G, Naigm T, Merawi A R and Harres A K. 1993. Urea
blocks. 2. Performance of cattle and sheep offered urea blocks
in Syria. Livestock Research for Rural Development 5 (3): 16–
23.
Kahn C M. 2005. The Merck Veterinary Manual. 9th edn. Merck
& Co., Inc. Whitehouse Station, N.J., USA.
Kang R S, Nanda, A S, Brar P S, Honparkhe M, Gandotra V K and
Jindal R. 2007. Plasma biochemical alterations in relation to
induction of oestrus through supplementary feeding and
hormonal treatment in summer anoestrus buffaloes. Indian
Journal of Animal Sciences 77: 359–62.
Liu, J X, Wu Y M, Dai X M, Jun Y, Zhou Y Y and Chen Y J. 1995.
The effects of urea-mineral lick blocks on the liveweight gain
of local yellow cattle and goats in grazing conditions. Livestock
Research and Rural Development 7(2): 9–13.
Pritchard R K, Hennessy D R and Griffiths D A. 1974. Endocrine
89
Indian Journal of Animal Sciences 80 (4): 362–365, April 2010
Carcass and meat quality characteristics of designated indigenous
sheep breeds of India
A R SEN1 and S A KARIM2
Central Sheep and Wool Research Institute, Avikanagar, Rajasthan 304501 India
Received: 20 May 2009; Accepted: 23 October 2009
ABSTRACT
Carcass and meat quality traits of 18 lambs of indigenous breeds, viz. Malpura, Garole and Malpura × Garole were
analyzed. The pre-slaughter weight was significantly lower in Garole as compared to Malpura and their crosses. The
small size Garole had significantly higher dressing yield as compared to large size Malpura. The muscular development
as indicated by loin eye area was higher in the Malpura and crossbred lambs as compared to Garole. Differences among
the breeds for the proportion of wholesale cuts as a percentage in half carcass tended to be small and mostly nonsignificant.
In all the breeds, the leg cut had highest lean content. In the neck region, a significant higher bone content was observed
in the large size Malpura as compared to smaller size Garole. Cooking loss percentage was significantly lower in Garole
sheep as compared to Malpura and their crosses. The water holding capacity (WHC) is significantly more in Garole
rams. Tenderness and juiciness was rated better in Garole and their crossbreds than Malpura. In organoleptic study
overall score was ranked in the order of Malpura × Garole>Garole>Malpura. The current study showed that carcass and
meat quality of Garole was similar to Malpura or their crossbreds. It was also evident that the overall meat quality was
better in Garole compared to Malpura rams.
Key words: Carcass, Lambs, Meat quality, mutton
(Prasad et al. 1981) while comparative study on carcass and
meat quality of different indigenous sheep breeds and their
crosses with variable adult weight was limited. This study
was designed mainly to investigate the efficiency of Garole
sheep as a meat producing breed and to characterize the effect
of breed on the carcass and chemical composition as well as
sensory characteristics of meat obtained from designated
indigenous sheep breed.
The evaluation of carcass traits of indigenous
sheep is essential both for developing appropriate breeding
strategy as well as for recommending breed of sheep for
meat production. Malpura is a large size dominant breed of
sheep in Rajasthan while Garole sheep is indigenous
to Sunderban area of West Bengal, India, and is known
for higher prolificacy. The two breeds differ markedly in
mature body size. Many studies have analyzed the effect of
breed and slaughter weight on the physicochemical
characteristics of lamb meat (Perez et al. 2002, Macit et al.
2002, Hoffman et al. 2003, Martinez-Cerezo et al. 2005,
Muthukumar et al. 2006).
Amount and site of fat in the carcass influences its quality
and such relationship between carcass weight and fat content
was recognized by Okeudo and Moss (2005). Meat tenderness
and flavour appear to be the most important sensory
characteristics that determine meat quality (Shahidi et al.
1986, Sanudo et al. 1996).
Some reports have appeared on carcass study of Indian
indigenous breed Malpura (Basuthakur et al. 1980), Avikalin
MATERIALS AND METHODS
The experiment was conducted at the Central Sheep and
Wool Research Institute, Avikanagar, Rajasthan, India,
located at 75°28/E latitude and 26°17/N longitude and 320
m above mean sea level. The climate of the location is
classified as hot and semi-arid.
Male lambs (6) from each breed (Malpura, Garole and
Malpura×Garole) were used in this study. Crossbreeding of
Malpura ewes with Garole rams was attempted with the view
to infuse the genes responsible for prolificacy into crossbreds.
The lambs were let out in the pasture at 0800 hours and grazed
for 8 h under supervision of a grazer followed by herding in
a side open animal shed till next day morning. The grazing
area was dominated by Cenchrus ciliaris (70%) with seasonal
shrubs and forbs constituting the other vegetation. Besides
Present address: 1 Principal Scientist, NRC on Meat,
Chengicherla, P.B.No.19, Uppal P.O. Hyderabad, Andhra Pradesh
500 039.(e mail: senarup@rediffmail.com).
2Director.
90
April 2010]
CARCASS AND MEAT QUALITY CHARACTERISTICS OF INDIGENOUS SHEEP
grazing, all the animals were offered 250 g concentrate/head/
day.
All the animals were slaughtered at 10 months of age.
The lambs were fasted over night with free access to water
and slaughtered in the experimental abattoir by Halal method.
After slaughter, the head was removed at the atlanto-occipital
joint and fore and hind feet removed at the carpal and tarsal
joints, respectively. The animals were partially skinned lying
on their back on the floor. Then the animals were suspended
by the hind legs for further skinning. Carcass and non-carcass
components were separated immediately after slaughter and
recorded and were chilled at 4°C. Lungs, trachea and heart
were weighed as one piece and designated as the pluck.
Non-carcass components included head, skin, feet,
digestive tract, liver, spleen, pancreas, lungs plus trachea.
Weight of digestive contents was computed as the difference
between full and empty digestive tracts. The empty live
weight (ELW) was computed as the difference between
slaughter weight and weight of digestive content. Carcass
was split along the middle and the left half was cut into leg,
loin, rack, neck and shoulder and breast and foreshank as
per ISI (1963) specifications. The cuts were dissected into
lean, bone and fat (subcutaneous and intermuscular) after
overnight chilling. The per cent composition of the cuts was
calculated on the basis of chilled carcass weight. Loin eye
area (cm2) was recorded on the cut surface of Longissimus
dorsi muscle at the interface of 12th and 13th rib on both
side of the carcass.
Longissimus dorsi was collected and analyzed for meat
quality evaluation. Cooking loss% was determined by weight
loss after cooking of meat for 1 h in water bath at 80°C
(Babiker et al. 1990). Shear force value of cooked meat
samples was determined using Warner Bratzler shear press
and Water holding capacity (WHC) was estimated by filter
paper pressing technique in screw plates (Trout 1988). The
sensory evaluation for color, odour, tenderness, juiciness and
overall palatability was performed by a semi-trained panel
using 6 point scale (6 = excellent, 1= very poor).
Statistical analysis of results were done using SPSS
statistical software 12.0 version (SPSS 2003). Data were
analysed using one way analysis of variance (ANOVA) to
test for the effect of breed. Significant group differences were
compared by Duncan’s Multiple Range Test (Duncan 1955).
363
Table 1. Carcass traits of Malpura, Garole and their crosses
Breed
Traits
Malpura
Garole
Pre-slaughter
21.18a±0.42 9.10b±0.90
weight** (kg)
Forequarter
4.38a±0.12
1.99b±0.21
weight** (kg)
Hindquarter
3.71a±0.14
1.62b±0.22
weight** (kg)
Dressing% (LW)
37.71b±0.60 39.59a±081
Dressing% (ELW) 47.44bc±0.59 46.31b±1.00
Blood%
4.47±0.24
4.19±0.69
Skin%
9.69±0.43
7.65±1.55
Alimentary canal% 30.07 a±1.00 25.31b±0.30
Ingesta%
20.49a±1.05 14.50c±0.10
Kidney fat%
0.25 b±0.02
0.29a±0.08
0.32a±0.08
Caul fat%
0.31a±0.04
Head & cannon%
9.39 b±0.14 12.00a±0.20
Pluck%
2.58±0.17
2.84±0.33
Liver%
1.90±0.08
2.37±0.37
Spleen%
0.32±0.03
0.45±0.04
Loin eye area (cm2) 7.90b±0.49
4.98c±0.47
Malpura ×
Garole
20.68a±0.53
4.62a±0.14
3.94a±0.09
41.41a±0.78
50.24a±0.65
3.98±0.15
8.55±0.45
26.70b±0.64
17.58b±0.68
010c±0.02
0.18b±0.04
9.52 b±0.31
2.55±0.09
1.80±0.08
0.35±0.01
9.22a±0.27
** P<0.01, means with different superscripts in a row differ
significantly (P<0.05); n=6 for each breed.
of non-carcass component mainly alimentary canal and
ingesta content in Garole rams contributed to the higher
dressing out percentage of the breed. The carcass studies
showed high empty body weight percentages and commercial
dressing percentages and these characteristics varied only
for slaughter weight (Perez et al. 2002). The skin yield of
Malpura is higher than that of Garole and their crosses. The
smaller sheep Garole had proportionally larger head and
cannons than Malpura.
In general non- carcass fat depot was higher in Garole
than Malpura and crossbred, which would indicate that
Garole breed can sustain larger period of feed deprivation
(Farid 1991). As more fat deposited in the kidney of Garole
rams, here we can infer one thing that it is the hardiest among
the breeds in the study and is able to survive the long periods
of feed shortage during summer. High body fat provides the
sheep with the ability to cope with long periods of energy
shortage, while low subcutaneous fat cover helps the animals
to easily regulate their body temperature in hot environments.
Further crossbred lambs (Malpura × Garole) had lower
visceral fat (kidney and caul). From the strictly applied
viewpoint, any attempt to reduce body fat through
crossbreeding or selection may have a negative effect on
adaptability of these native breeds to its natural habitat and
thus should be accompanied by corresponding improvements
in its nutrition and management. The muscular development
as indicated by loin eye area was higher in the Malpura and
crossbred lambs as compared to Garole.
RESULTS AND DISCUSSION
Carcass characteristics
The pre-slaughter weight was significantly (P<0.01) lower
in Garole as compared to Malpura and their crosses (Table
1). In Malpura male lambs the dressing yield was
approximately 38% of the live weight while Basuthakur et
al. (1980) reported higher dressing yield, which could be
ascribed to variations in fasting protocol. Interestingly, the
small sized Garole rams had significantly (P<0.05) higher
dressing yield as compared to Malpura. The lower proportion
91
364
SEN AND KARIM
fat diet and prefer lean meat.
Breed-wise composition of different cuts is presented in
Table 3. Loin ranked the highest among the cuts for
percentage of fat. The highest fat content in the loin region
was obtained in Malpura × Garole than Malupra and Garole
lambs. In all the breeds, the leg cut had highest lean content.
In the neck region, a significant (P<0.05) higher bone content
was observed in the large sized Malpura as compared to
smaller sized Garole rams, while the lean content followed
the reverse order. Hogg et al. (1992) explained that the
difference in fat content and consequently of bone and meat
of different joints is a reflection of the pattern of fat deposition
and stage of maturity of the animal.
Table 2. Primal and retail cut yields of Malpura, Garole and their
crosses
Breed
Traits
Leg%
Loin%
Rack%
Neck and shoulder%
Breast and fores
hank%
Total separable
Lean%
Fat%
Bone%
Malpura
Garole
Malpura ×
Garole
33.0±0.43
11.29±0.41
12.97±0.37
24.59±0.29
18.15±0.31
32.66±0.35
12.21±0.41
12.83±0.21
25.56±1.77
16.99±1.46
32.32±0.31
12.18±0.35
13.0±0.52
24.22±0.92
18.23±0.69
69.91±1.08
71.39±2.11
69.12±0.10
6.55b±0.90
23.37±1.81
5.73b±0.98
23.02±.1.26
8.95a±0.60
22.08±1.15
Meat quality attributes
Cooking loss% was significantly (P<0.05) lower in Garole
sheep as compared to Malpura and their crosses. The water
holding capacity (WHC) was significantly (P<0.05) more in
Garole rams. The lower cooking loss% in Garole may be
attributed to the higher water holding capacity. Meat with
lower WHC, water will be expelled in higher quantity and
higher cooking loss% (Vergara et al. 1999). It is interesting
to note that shear force value was higher in Malpura rams
compared to Garole and Malpura × Garole. Generally, shear
force values that exceed 5.5 kg would be considered as
objectionably tough both by a trained sensory panel and by
consumers (Shackelford et al. 1991). Hence, meat from
Malpura rams was mostly tougher. Warner et al. (1990)
reported that samples of meat from aged wether sheep with
Warner Bratzler shear force values of >6.6 are perceived by
taste panel to be tough.
Sensory characteristics of meat from different breeds are
presented in Table 4. Colour-wise meat from Malpura ×
Garole was more attractive than that from Malpura and
Garole. Tenderness and juiciness was rated better in Garole
and their crossbreds than Malpura. In organoleptic study
overall score was ranked in the order of Malpura ×
Garole>Garole>Malpura.
The current study showed that carcass and meat quality
Means with different superscripts in a row differ significantly
(P<0.05); n=6 for each breed.
The data on primal cuts and total separable lean, fat and
bone content of different breeds is presented in Table 2. The
proportions of various primal cuts observed in this study are
in close agreement with the observation of Sen et al. (2000).
Differences among the breed for the proportion of wholesale
cuts as a percentage in half carcass tended to be small and
mostly nonsignificant. Total separable carcass fat content was
lower in Garole as compared to Malpura and crossbred.
Accordingly the meat production from Garole sheep is
economical due to the higher feed conversion efficiency.
Further, modern consumers are more concerned with low
Table 3. Lean, fat, bone content in different primal cuts of
Malpura, Garole and their crosses
Traits
Leg
Lean
Fat
Bone
Loin
Lean
Fat
Bone
Rack
Lean
Fat
Bone
Neck and Lean
shoulder Fat
Bone
Breast and Lean
fores
Fat
hank
Bone
Breed
Malpura
Garole
Malpura ×
Garole
75.39±2.11
3.39±0.48
20.04±2.43
74.79a±3.70
10.54b±0.67
14.99±3.29
66.53±3.26
4.11±1.20
27.64±3.73
64.60b±14.79
6.84±1.17
28.05a±4.33
61.12±3.02
11.09±2.61
25.45±2.18
73.50±1.50
4.40±0.66
19.85±0.15
66.90b±1.10
13.90b±1.89
15.90±0.10
59.42±4.41
4.63±0.37
34.90±5.10
72.09a±0.83
4.39±0.21
21.91b±1.07
63.17±4.83
5.55±2.78
27.25±1.92
75.63±0.89
5.58±1.24
18.07±2.15
61.97b±4.07
19.85a±0.90
16.19±4.86
68.32±0.55
7.96±3.52
21.24±3.20
69.49b±1.16
7.15±0.63
21.98b±0.24
62.28±4.39
10.22±2.94
26.54±1.09
[Indian Journal of Animal Sciences 80 (4)
Table 4. Organoleptic characteristics of meat from Malpura,
Garole and their crosses.
Breed
Traits
Colour
Odour
Tenderness
Juiciness
Overall palatability
Means with different superscripts in a row differ significantly
(P<0.05); n=6 for each breed.
Malpura
Garole
Malpura ×
Garole
3.57b±0.20
3.28±0.18
3.42b±0.20
3.42b±0.20
3.14b±0.14
3.14b±0.34
3.57±0.29
4.14a±0.26
4.00a±0.31
3.57b±0.20
4.28a±0.18
4.42±0.20
4.42a±0.02
4.42a±0.20
4.43a±0.20
Means with different superscripts in a row differ significantly
(P<0.05); n=8 for each sensory traits.
92
April 2010]
CARCASS AND MEAT QUALITY CHARACTERISTICS OF INDIGENOUS SHEEP
of Garole was similar to Malpura or their crossbreds. It was
also evident that the overall meat quality was better in Garole
compared to Malpura rams. Therefore, Garole which is a
very prolific breed, can be crossbred with Malpura to get
better returns for the farmers and at the same time consumers
will get better quality meat.
365
weight and ageing time effects on physicochemical
characteristics of lamb meat. Meat Science 69: 325–33.
Muthukumar M, Naveena B M, Babji Y and Sen A R. 2006. Effect
of slaughter weight and sex on carcass composition and mutton
quality of Nellore sheep. Indian Journal of Animal Sciences
76: 413–15.
Okeudo N J and Moss B W. 2005. Interaction amongst carcass and
meat quality characteristics of sheep. Meat Science 69: 1–8.
Perez P, Maino M, Tomic G, Mardones E and Pokniak J. 2002.
Carcass characteristics and meat quality of Suffolk Down
suckling lambs. Small Ruminant Research 44: 233–40.
Prasad V S S, Bohra S D J and Kamal K. 1981. Note on mutton
production potentialities of the new cross-breed wool strains.
Indian Journal of Animal Sciences 51: 118–20.
Sanudo C, Santolaria M P, Maria G, Osorio M and Sierra I. 1996.
Influence of carcass weight on instrumental and sensory lamb
meat quality in intensive production systems. Meat Science 42:
195–02.
Sen A R, Karim S A and Santra A. 2000. Carcass characteristics of
finisher lambs maintained on grazing with concentrate
supplementation. Indian Journal of Animal Sciences 70: 988–
90.
Shackelford S D, Morgan J B, Cross H R and Savell J W.
1991. Identification of threshold levels for Warner-Bratzler shear
force in beef top loin Steaks. Journal of Muscle Foods 2: 289–
96.
Shahidi F, Rubin L J and D’Souza L A. 1986. Meat flavour volatiles:
a review of the composition, techniques of analysis and sensory
evaluation. Critical Reviews in Food Science and Nutrition 24:
141–43.
SPSS 12.0. 2003. SPSS Manual, Chicago, USA, SPSS Inc.
Trout G R. 1988. Techniques for measuring water binding capacity
in muscle foods- A review of methodology. Meat Science 23:
235–52.
Vergara H, Molina A and Gallego L. 1999. Influence of sex and
slaughter weight on carcass and meat quality in light and
medium weight lambs produced in intensive systems. Meat
Science 52: 221–26.
Warner R D, Butler K M, Bogdanovic B and Hodge R W. 1990.
Meat quality of aged wethers. Proceedings of the Australian
Society of Animal Production. 18 No. 4200.
ACKNOWLEDGEMENTS
Authors are grateful to the Director, CSWRI, Avikanagar,
for providing necessary research facilities. Thanks are also
due to Mr M. Nasimuddin for technical assistance.
REFERENCES
Babiker S A, Elkhider I A and Shafie S A. 1990. Chemical
composition and quality attributes of goat meat and lamb. Meat
Science 28: 273–77.
Basuthakur A K, Nivsarkar A E and Singh R N. 1980. Studies on
some pre and post slaughter parameters in Malpura lambs. 1.
Phenotypic biometry and dressing percentage. Indian Veterinary
Journal 57: 473–78.
Duncan D B. 1955. Multiple range and multiple F test. Biometrics
11: 1–42.
Farid A. 1991. Carcass physical and chemical composition of three
fat –tailed breeds of sheep. Meat Science 29: 109–20.
Hoffman L C, Muller M, Cloete S W P and Schmidt D. 2003.
Comparison of six crossbred lamb types: sensory, physical and
nutritional meat quality characteristics. Meat Science 65: 1265–
74.
Hogg B W, Mercer G T K, Kirton A H and Duganzich D M. 1992.
Carcass and meat quality attributes of commercial goats in New
Zealand. Small Ruminant Research 8: 243–56.
ISI. 1963. Indian standard specification for mutton and goat flesh.
Fresh, chilled and frozen. IS 2536. Bureau of Indian Standard
Institution, New Delhi.
Macit, M., Esenbuga, N., Karaoglu, M. 2002. Growth performance
and carcass characteristics of Awassi, Morkaraman and Tushin
lambs grazed on pasture and supported with concentrate. Small
Ruminant Research 44: 241–46.
Martinez-Cerezo S, Sanudo C, Panea B, Medel I, Delfa K, Sierra
I, Beltran J A, Cepero R and Olleta J L. 2005. Breed, slaughter
93
Indian Journal of Animal Sciences 80 (4): 366–369, April 2010
Carcass and meat characteristics of Soviet Chinchilla rabbits as influenced by age
A R SEN1 and S A KARIM2
Central Sheep and Wool Research Institute, Avikanagar, Rajasthan 304 501 India
Received: 20 March 2009; Accepted: 25 November 2010
ABSTRACT
Carcass and meat characteristics of Soviet Chinchilla rabbits at an average age of 12(G1), 16 (G2), 20 (G3) and
24(G4) weeks was evaluated in the slaughter study. The pre-slaughter weight (kg) was 1.71 in G1 whereas it was higher
in G2, G3 and G4. The dressing yield% ranged from 52.8 to 57.1 and was higher in G3 and G4 than G1 and G2. The
standard cuts, viz. hind quarter, loin and forequarter expressed as percentage of carcass weight ranged from 38.6 to
41.0, 19.3 to 20.6 and 39.7 to 41.0%, respectively, and were similar in the 4 groups. The abdominal fat content was
similar in G1 and G2 and higher in G3 and more so in G4. Percentage of meat in forequarter, loin and hind quarter, meat
to bone ratio and total meat yield of the carcass were more in high (G3 and G4) than low (G1 and G2) age group
animals. The shear force value increased with increase in slaughter age of the rabbits. It is concluded from the study that
dressing yield was more in 20 weeks old rabbits than other age groups. Further, lean content of the carcass increased
while its bone content decreased with the advancement of age.
Key words: Age, Carcass, Meat quality, Rabbit
greens harvested (after 24 h wilting) till slaughter. A total of
48 Soviet Chinchilla rabbits were used in this slaughter
investigation. The weaner kits were slaughtered at the age
of 12 (G1), 16 (G2), 20 (G3) and 24 (G4) weeks. The rabbits
were slaughtered without fasting by cervical dislocation.
Traits evaluated on animals and carcasses were pre slaughter
characteristics, carcass weight, abdominal fat, giblets (heart,
kidneys and liver), forequarter, loin and hindquarter
(Lukefahr et al. 1983). Separation of the forequarter from
the loin and separation of the loin from the hindquarter were
achieved by making transverse cuts at the last rib and at the
posterior lumbar-anterior pelvic region respectively. Dressing
percentage was calculated as hot carcass weight plus
abdominal fat weight plus giblet weight, divided by pre
slaughter weight.
Body and carcass loin width were measured as the lateral
distance from the right to the left transverse processes of the
lumbar vertebrae over the top of the mid loin. Lean yield
traits include percentages of bone and meat of the forequarter,
loin and hindquarter cuts, overall meat to bone ratio, total
meat and bone percentage of the carcass were assessed. For
separation of meat and bone, the carcasses were stored
overnight at 5° to 6°C and the retail cuts were de-boned
manually. The manually separated bone was boiled with 2%
KOH and the residue meat was scrapped off in the cuts and
weighed. Body and carcass lengths were measured from the
first thoracic vertebra to the tuber ischiadicum (pin bones).
Longissimus dorsi was collected and analysed for meat
Commercial broiler rabbit production is a profitable
enterprise in many countries throughout the world. However,
rabbit meat consumption is substantially lower in India due
to consumer’s preference for sheep and goat meat, marginal
economic feasibility of rabbit meat production, minimal
attention by the scientific community, pet appearance of
rabbits and above all limited supply of rabbit meat. Further,
information on carcass composition and quality of rabbit meat
is limited in contrast to that available for other meat animals.
Reported information indicates differences in carcass
characteristics among rabbit breeds and crossbreds (Gupta
et al. 2002) and age of slaughter (Bernardini et al. 1994) and
sexes (Sen and Bhagwan 1999, Poornima et al. 2003). Line
origin has also influence on some sensory traits determining
rabbit meat tenderness (Arino et al. 2007). However, such
information is lacking for finisher rabbits raised under hot
semiarid environment requiring organized slaughter studies
to optimize the age at slaughter. The study was therefore
conducted to determine the effect of age on carcass and meat
quality traits of Soviet Chinchilla rabbits.
MATERIALS AND METHODS
The kits weaned at 4 weeks of age were maintained in
individual cages and fed ad lib. on concentrate pellet and
Present address: 1 Principal Scientist, NRC on Meat,
Chengicherla, P.B. No.19, P.O. Uppal, Hyderabad 500 039 (email:
senarup@rediffmail.com), 2 Director.
94
April 2010]
EFFECT OF AGE ON CARCASS AND MEAT CHARACTERISTICS OF RABBITS
quality evaluation. Cooking loss was determined by
measuring the difference in the weight loss after cooking of
meat for 1 h in water bath at 80°C and the values were
expressed in percentage (Babiker et al. 1990). Muscle
tenderness was assessed by Warner-Bratzler shear press
method and the amount of force required to cut through the
muscle sample was recorded and expressed as kg/cm2.
The data on all the carcass and meat quality traits were
subjected to analysis of variance (Snedecor and Cochran
1968) and significant differences were compared by Duncan’s
multiple range test (Duncan 1955).
367
weight was similar in G2, G3 and G4. Abdominal fat%
significantly (P<0.05) increased with the advancement of
age. In general, a heavier carcass (G4) had higher (P<0.05)
deposition of abdominal fat. The results are in agreement
with the findings of Lukefahr et al. (1983). The average
dressing percentage ranged from 52.85 to 57.10% of live
weight. Dressing percentage was significantly influenced by
slaughter age whereas the rabbits slaughtered at 20 weeks
had higher (P<0.05) dressing percentage than those
slaughtered at 12, 16 and 24 weeks of age. Dressing
percentage values observed in this study are higher than
earlier reports (Rao et al. 1978; Nofal et al. 1995). The higher
dressing percentage with advancement of age may be due to
lower (P<0.05) alimentary canal percentage with increasing
age. Slaughter age influenced absolute weights of each
physical cuts, however, on their expression as the per cent of
carcass, the cuts were found similar in these age groups
ranging from 38.6–40.9, 19.3–20.6 and 39.7–41.0%,
respectively for hind quarter, loin and forequarter. The results
reported here are in agreement with the work of Rao et al.
(1978) who reported that dressed carcass weight had nonsignificant effect on the proportion of retail cuts. The
proportions of carcass in hindquarter, loin and forequarter
cuts, as observed in our study are in close agreement with
the observation in New Zealand White and Flemish Giant
rabbits by Lukefahr et al. (1983).
Body and carcass length and loin width are also presented
in Table 1. The higher age group had significantly (P<0.05)
wider loin as measured on the live rabbit. Carcass length
RESULTS AND DISCUSSION
Weaning weight (g) was significantly higher (P<0.01) in
G1 than in G2, G3 and G4 whereas the finishing weights
(kg) were significantly higher (P<0.01) in G3 and G4 than
G1 and G2. The higher finishing weight of G3 and G4 was
reflection of their age. The average daily gain (g) was
however higher (P<0.01) in G1 and progressively decreased
with advancement of age in G2, G3 and G4. Similar trend
was also observed in feed conversion efficiency (%), which
was 41.5 in G1 and decreased to 21.2, 18.3, and 13.0
respectively in G2, G3 and G4 with increasing slaughter age.
Similar types of findings were also observed by Larzul et al.
(2005).
Age at slaughter significantly (P<0.05) influenced pre
slaughter and carcass weights (Table 1). The pre slaughter
and carcass weight was lower (P<0.05) at 12 weeks of age
compared to other age groups. However, the pre slaughter
Table 1. Carcass traits of soviet chinchilla rabbits slaughtered at variable age
Age in weeks
Traits
Pre slaughter wt. (kg)
Carcass wt. (kg)
Abdominal fat%
Giblet (%)
Alimentary canal (%)
Dressing (%)
Hindquarter (%)
Loin (%)
Forequarter (%)
Skin (%)
Blood (%)
Head (%)
Lungs (%)
Tail and feet (%)
Body length (cm)
Loin width (cm)
Carcass length (cm)
Carcass loin width (cm)
G1
12
G2
16
G3
20
G4
24
1.71b±0.11
0.82b±0.08
1.21c±0.09
8.17±0.24
20.46a±0.62
52.85b±0.36
40.99±0.49
19.34±0.59
39.66±0.56
8.26b±0.31
3.80±0.40
8.77±0.34
1.02±0.21
2.92±0.21
21.75±0.46
4.75bc±0.27
19.37b±0.34
4.62±0.25
2.26a±0.14
1.11a±0.11
0.90c±0.26
6.36±0.33
18.47b± 0.56
52.99b±0.37
39.25±0.50
19.77±0.69
40.97±0.60
9.61b±0.33
3.18±0.29
8.65±0.20
0.62±0.19
2.55±0.26
23.37±0.34
5.87b±0.39
23.12a±0.25
5.12±0.25
2.42a±0.12
1.27a±0.12
2.45b±0.34
6.75±0.48
16.68b±0.73
57.10a±0.66
39.74±0.41
19.34±0.66
40.82±0.59
9.99b±0.32
3.12±0.35
8.83±0.23
1.07±0.15
2.59±0.29
22.75±0.40
6.25ab±0.46
21.75a±0.35
5.65±0.28
2.39a±0.18
1.17a±0.17
3.92a±0.37
7.88±0.54
17.29b±0.75
54.25b±0.82
38.64±0.58
20.64±0.65
40.58±0.73
11.27a±0.64
3.78±0.39
8.53±0.15
1.05±0.12
2.87±0.19
23.75±0.49
7.25a±0.27
23.47a±0.46
5.47±0.34
Means bearing different superscripts differ significantly (P<0.05).
95
368
SEN AND KARIM
[Indian Journal of Animal Sciences 80 (4)
Table 2. Lean yield traits and meat quality of soviet chinchilla rabbits slaughtered at variable age
Age in weeks
Traits
Total separable
Lean%
Bone%
Lean: bone
Hind quarter
Lean%
Bone%
Loin
Lean%
Bone%
Fore quarter
Lean%
Bone%
G1
12
G2
16
G3
20
G4
24
77.01c±1.08
16.03a±0.98
4.80
83.0b±0.68
12.61b±0.77
6.58
86.84a±1.33
13.07 b ±0.96
5.40
87.65a±0.32
11.55 b ±0.34
7.59
77.03c±1.45
15.92a±1.35
87.17ab±0.48
10.33 b ±1.41
89.05a±1.60
10.09 b ±0.48
85.58 b ±0.57
12.52 b ±1.11
85.00±1.08
7.50±0.76
82.31±1.28
10.77±0.73
85.59±0.53
10.40±0.99
82.83±1.73
10.37±1.66
73.33c±1.10
20.00a±0.58
79.28 b ±0.71
15.83 b±0.77
85.50a±0.95
11.80c±0.58
79.21 b ±0.17
18.81a±0.20
Means bearing different superscripts differ significantly (P<0.05).
increased significantly (P<0.05) up to 16 weeks and remained
constant thereafter while the loin width gradually increased
with the age. Results indicated that after reaching the
particular body conformation, the animal attained a more
compact body frame (wider loin and shorter carcass). It is
difficult to compare these results objectively with other
reports because of breed differences (Lukefahr et al. 1982).
Lean yield and meat quality characteristics are presented
in Table 2. The lean content significantly (P<0.05) increased
with age in G2 and G3 whereas the bone content was higher
in G1 than other groups. Meat bone ratio ranged from 4.80
to 7.59 and it was lower (P<0.05) in G1 than other groups.
These values are comparatively higher than those reported
by Rao et al. (1978) whereas, the increasing meat or bone
with age compared favorably with their results. The
maximum lean content was noticed in the fore quarter and
hindquarter cuts than in the loin. Per cent bone was lowest
in the loin cut and highest in the forequarter. The results are
in agreement with the findings of Lukefahr et al. (1983).
Cooking loss percentage decreased from 25.09 (G1) to
25.06 (G2), 24.56 (G3) and 24.49 (G4) with increasing age
however, the differences were statistically non- significant.
Shear force value of meat increased in higher age group
rabbits and found to be 3.59 kg/cm2 in 20 weeks group and
3.72 kg/cm2 in 24 weeks group as compared to 12 weeks
age (3.29 kg/cm2). This could possibly be due to collagen
content, its solubility and differences in fatness. Valin et al.
(1984) also reported increased cross linking in muscles with
advancement of age.
It is concluded from the study that average daily gain
significantly reduced with the advancement of age and
dressing yield was more in 20 weeks old rabbits than other
age groups. Further, lean content of the carcass increased
while its bone content decreased with the advancement of
age. However, no significant differences were observed in
meat quality parameters at variable age.
ACKNOWLEDGEMENTS
The authors are grateful to the Director, CSWRI for
providing necessary facilities and technical assistance by
Mr M. Nasimuddin is also acknowledged.
REFERENCES
Arino B, Hernandez P, Pla M and Blasco A. 2007. Comparison
between rabbit lines for sensory meat quality. Meat Science 75:
494–98.
Babiker S A, Elkhider I A and Shafie S A. 1990. Chemical
composition and quality attributes of goat meat and lamb. Meat
Science 28: 273–77.
Bernardini B M, Castellini C and Lattaioli P. 1994. Rabbit carcass
and meat quality: effect of strain, rabbitry and age. Italian
Journal of Food Science 6: 157–66.
Duncan D B. 1955. Multiple range and multiple ‘F’ tests. Biometrics
11: 1–42.
Gupta R B, Rao V P, Reddy C E, Satyanarayana A and Reddy P P.
2002. Effect of genetic and non genetic factors on post weaning
body weights and carcass traits of broiler rabbits. Indian Journal
of Animal Sciences 72: 70–74.
Kawinska J, Niedzwiadek S and Tuczynska J. 1980. Slaughter yield
and meat quality of White Angora rabbits. Roczniki Naukowe
Zootechniki 7: 147–55.
Larzul C, Combes, S and Rochambeau H. 2005. Carcass
composition, bone mechanical properties and meat quality traits
in relation to growth rate in rabbits. Journal of Animal Science
83: 1526–35.
Lukefahr S, Hohenboken W D, Cheeke P R and Patton N M.1982.
Carcass and meat characteristics of Flemish Giant and New
Zealand White purebred and terminal cross rabbits. Journal of
Animal Science 54: 1169–74
Lukefahr S, Hohenboken W D, Cheeke P R and Patton N M.1983.
96
April 2010]
EFFECT OF AGE ON CARCASS AND MEAT CHARACTERISTICS OF RABBITS
Appraisal of nine genetic groups of rabbits for carcass and lean
yield traits. Journal of Animal Science 57: 899–907.
Poornima K, Gupta B R, Rao G N and Satyanarayana A. 2003.
Evaluation of California white rabbits for carcass traits. Indian
Journal of Animal Sciences 73: 564–66.
Nofal R Y, Toth S and Virag G Y. 1995. Carcass traits of purebred
and crossbred rabbits. World Rabbit Science 3: 167–70.
Rao D R, Chen C P, Sunki G R and Johnson W M. 1978. Effect of
weaning and slaughter ages on rabbit meat production. 2.
Carcass quality and composition. Journal of Animal Science
46: 578–83.
Rudolph W, Gauss H and Fischer W. 1980. Meat quality
characteristics of broiler rabbits as influenced by age, sex and
369
slaughter weight. Archiv fuer tier Zucht 23: 387–91.
Saleh K, El-Hakim A M, Abd-elnani F M and Elqen R Y N. 1988.
Efficacy of crossbreeding in improving the productivity of
rabbits. 3–slaughter traits. Journal of Agricultural Research
Tanta University 14: 1590–1602.
Sen A R and Bhagwan P S K. 1999. Appraisal of two genetic groups
of rabbits for carcass and meat quality traits in males and
females. Indian Journal of Animal Sciences 69: 631–33.
Snedecor G W and Cochran W G. 1968. Statistical Methods. 6th
edn, pp 299–338.Oxford and IBH Publishing Co Calcutta, India.
Valin C, Pinkas A, Dragnev H, Boikovski S and Polikronov D.
1984. Comparative study of buffalo meat and beef. Meat Science
10: 69–84.
97
Short Communications
Indian Journal of Animal Sciences 80 (4): 370–372, April 2010
Identification of single nucleotide variations in the genes related to reproduction in
riverine buffalo
J THANISLASS1, R SUMATHY2, S VENKATESA PERUMAL3 and KV SUBBA REDDY4
Rajiv Gandhi College of Veterinary and Animal Sciences, Kurumbapet, Puducherry 605 009 India
Received: 6 June 2009; Accepted: 20 November 2009
Key words: Buffalo, Gene, Genetic marker, Single nucleotide variation
Microsatellite and single nucleotide polymorphism (SNP)
two types of DNA based genetic markers. Genetic markers
are defined as identifiable DNA segments that differ in
nucleotide sequence from one individual to the other. Genetic
markers or DNA based markers are powerful tools for
molecular dissection of traits of economic importance and
for their potential application in breeding for more productive
and efficient livestock. SNP markers are just a single base
changes in a DNA sequence which are extremely stable
(Sachidandam et al. 2001), abundant (Heaton et al. 2001)
and amenable to high-throughput automated analysis
(Lindblad-Toh et al. 2000). Due to these advantages SNPs
form a preferred DNA marker for genotyping studies.
The livestock industry depends on proper reproduction
resulting into optimum production. Reproductive hormones
play a very important role in fertilization and maintenance
of pregnancy. These hormones trigger broad array of tissue
and organ specific physiological responses by binding to their
respective receptors. Thus the genes for receptors of the
reproductive hormones can be candidate for the production
traits. Therefore the identification of DNA based markers in
these genes will be economically beneficial. Moreover, in
buffaloes, systematic studies to develop DNA based markers
are scanty. Hence present study was planned to identify single
nucleotide variations in the genes related to the reproduction
using PCR-SSCP followed by sequencing.
Genomic DNA was isolated from blood of 25 unrelated
animals representing five different buffalo breeds, viz.
Murrah, Mehsana, Surti, Jaffrabadi and Toda (5 animals in
each breed). Polymerase hain reaction was carried out using
gene specific primers – 5’AATCCATCCTACCCCTGGAG3’
and 5’GCAATGGA TGGCTAAAGGAG3’ for Estrogen
receptor (ER), 5’TCTTGGA GGCCGAAAGTTTA3’ and
5’TCGGAACTTACATATTGATGACCA3’ for progesterone
Receptor (PR), 5’GATCCTGATCACCAGCCAGT3’ and
5’AGATGGGAAAAAGGGCAACT3’ for FSH receptor
(FR), 5’TTGGGTAAA ATTCAAATGCAGA3’ and
5’ATGATGGTGTGGAGGGGTAA3’ for leptin receptor
(LR). PCR was conducted in a 20.0 l reaction mix containing
100 ng of genomic DNA for 30 cycles. The annealing
temperature was 59°C for ER and 55°C for PR, FR and LR.
The sizes of the PCR products obtained were 212 bp, 316
bp, 362bp and 440 bp for ER, PR, FR and LR, respectively.
The PCR products thus obtained were denatured in the
SSCP dye (containing formamide and EDTA) at 94°C for 10
min, immediately cooled in an ice bath and used for SSCP
analysis. The SSCP analysis was carried out using 15%
polyacrylamide gel (49: 1) containing 5% glycerol.
Electrophoresis was carried at 25°C, 250 volts for 3 h in
0.5% TBE buffer. The gel was subsequently silver stained
(Baseem et al. 1991) and difference in SSCP banding pattern
was identified. The samples which had produced varied PCRSSCP pattern were re-amplified, gel extracted and subjected
for custom sequencing. The sequences (Accession no.
EU662273 to EU662291) obtained were subjected for
‘megaBLAST’(Altschul et al. 1990) analysis to know the
specificity of the amplification. The sequences were further
subjected for multiple sequence alignment (ClustalW)
(Higgins et al. 1994) to identify the single nucleotide
variation. The effect of single nucleotide variation on the
amino acid sequence and restriction sites was analyzed using
‘BLASTx’ and ‘NEBcutter’.
PCR-SSCP is one of the methods of identification of single
nucleotide variation which is based on the conformational
change of DNA fragments due to single base change. The
change in conformation can be detected by non-denaturing
polyacrylamide gel electrophoresis. This is one of the
simplest and most widely used methods to identify nucleotide
variations (Orita et al. 1989). PCR-SSCP can detect 70 to
95% of potential base variations in short 200 or less base
Present address: 1 Associate Professor (Email: jthanislass
@gmail.com); 2Junior Research Fellow, Department of Veterinary
Biochemistry, 3Assistant Professor, Department of Veterinary
Biochemistry, 4Professor and Head, Department of Veterinary
Biochemistry.
98
April 2010]
SNPs IN THE GENES RELATED TO REPORDUCTION IN BUFFALO
371
Table 1. Variations identified and their effect on amino acid sequence and restriction site
Gene
Nucleotide
variation identified
Estrogen receptor (ER)
– Coding region
Progesterone receptor
(PR) - Coding region
FSH receptor (FR) –
Coding region
Leptin receptor (LR) –
Promoter region
Breeds of buffalo
A
2
3
1
B
Restriction site
A→G
Toda
Nil
Nil
A→G
T→C
C→T
A→G
T→C
A→G
T →A
T→C
T→C
T →A
A→G
T→G
T →A
Surti
Murrah and Mehsana
Jaffrabadi and Mehsana
Toda
Surti
Surti
Mehsana
Toda
Surti, Jaffrabadi and Mehsana
Mehsana and Murrah
Jaffrabadi
Toda
Murrah
T→A
V→A
P→L
Nil
I→T
I→G
L→Q
C→R
Nil
—
—
—
—
Creation of site for AciI
Creation of site for AciI
Nil
Nil
Nil
Nil
Nil
Nil
Nil
Creation of site for SfaNI
Creation of site for HinfI
Nil
Nil
ER gene sequence of five different breeds of buffalo resulted
in the identification of one nucleotide variation (A→G) in
the Toda breed of buffalo which had correlated with the
altered SSCP pattern (Fig. A). However, this nucleotide
variation identified neither resulted in amino acid change
nor restriction site. PCR-SSCP pattern of PR (Fig. B) was
different for each breed of buffaloes. Sequence analysis had
also revealed 4 different variations; 2 different nucleotide
variations were identified in Mehsana breed of buffaloes.
The variations identified are resulted in amino acid change
as well as change in restriction site as detailed in the table 2.
Analysis of FR and LR sequence had also revealed nucleotide
variations which were correlated with PCR-SSCP pattern
(Figs C and D). Some of the variations are resulted in amino
acid change as well as change in restriction site.
Overall, of the total 14 variations identified, 10 of them
pair products under optimum conditions (Gross et al. 1999).
However the method can be improved on its efficiency to
detect nucleotide variations in the DNA fragments size from
400 to 450 bp by using low cross linker percentage and 5%
glycerol. This helps in the successful determination of
nucleotide variation in large PCR products (Hamzeiy et al.
2002). Therefore, in the present study PCR products of size
212 bp, 316 bp, 362bp and 440 bp of ER, PR, FR and LR,
respectively were used for PCR-SSCP analysis and the
different SSCP pattern obtained is shown in figure A, B, C,
and D, respectively. The PCR products were obtained using
the primers designed based on the cattle sequence but they
were found to amplify the corresponding gene of buffalo
which was confirmed by sequence analysis. The respective
PCR products were sequenced and the nucleotide sequences
were subjected for ‘BLAST” and “clustalW”. Alignment of
1
Amino acid
change
2
3
4
5
1
2
3
4
C
5
1
2
3
4
5
6
7
8
9
10
D
Figs A–D: A. PCR-SSCP pattern of estrogen receptor (Template DNA used Lane 1.Jaffrabadi, Lane 2: Murrah and Lane 3: Toda),
B. PCR-SSCP pattern of progesterone receptor (Template DNA used Lane 1: Jaffrabadi, Lane 2: Mehsana, Lane 3: Murrah, Lane 4: Surti
and Lane 5: Toda), C. PCR-SSCP pattern of FSH receptor (Template DNA used Lane 1: Jaffrabadi, Lane 2: Mehsana, Lane 3: Murrah, Lane
4: Surti and Lane 5: Toda), D. PCR-SSCP pattern of Leptin receptor (Template DNA used Lane 1, 2: Toda, Lane 3, 4: Surti, Lane 5, 6:
Murrah, Lane 7, 8: Mehsana, Lane 9, 10: Jaffrabadi).
99
372
THANISLASS ET AL.
are transitional in nature. The study on human SNPs from
EST traces data bases given transition to transversion ratio
of 1.7 (Picoult et al. 1999). The variations identified in
chicken EST sequence were found 2.3 (Smith et al. 2001)
and 4 (Kim et al. 2002) are higher than mammals. Out of 14
variations identified, 7 variations affected the amino acid
sequence and 4 variations resulted in change in restriction
sites. The variations which have resulted in amino acid
change can be functionally important as these can affect the
structure of the protein. The variations which had changed
the RE site can be used to develop PCR-RFLP marker.
All the nucleotide variations identified in this study are
associated with difference in PCR-SSCP pattern, which
demonstrate the potential usefulness of PCR-SSCP analysis
for the detection of nucleotide variation. The nucleotide
variations identified are found in coding region and promoter
region of the genes studied, therefore these variations can be
utilized as DNA markers of functional importance. The
pregnancy rate, outcome of in vivo fertilization, fertility, liter
size were shown to be associated with single nucleotide
variations identified in the above genes. But the efficacy of
single nucleotide variations identified in this study depends
on the information content of these variations shown under
association studies in the population at large.
[Indian Journal of Animal Sciences 80 (4)
Biology 218: 403–10.
Bassem B J, Caetano-Anollesb G, and Gresshoff P M. 1991. Fast
and sensitive silver staining of DNA in polyacrylamide gels.
Analytical Biochemistry 196: 80–83.
Gross E, Arnold N, Goette J, Schwartz–Boeger U and Kiechle
M. 1999. A comparison of BRCA1 mutation analysis by
direct sequencing, SSCP and DHPLC. Human genetics 105:
72–78.
Hamzeiy U, Mashhadian N V, Edwards H J, and Goldfarb P S.
2002. Mutation analysis of the human CYP3A4 gene 5’
regulatory region: population screening using non-radioactive
SSCP. Mutation Research 500: 103–10.
Heaton M P, Grosse W M, Kappes S M, Keele J W, Chitko-McKown
C G, Cundiff L V, Braun A, Little D P and Laegreid W W. 2001.
Estimation of DNA sequence diversity in bovine cytokine genes.
Mammalian Genome 12: 32–37
Higgins D, Thompson J, Gibson T, Thompson J D, Higgins D G,
Gibson T J. 1994. CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix
choice. Nucleic Acids Research 22: 4673–80.
Kim H, Schmidt C J, Decker K S and Emara M G. 2002. Chicken
SNP discovery by EST data mining, in: Plant, Animal and
Microbe. Genome 10: 12–16
Lindblad-Toh K, Winchester E, Daly M J, Wang D G, Hirschhorn J
N, et al. 2000. Large-scale discovery and genotyping of singlenucleotide polymorphisms in the mouse. Nature Genetics 24:
381–86
Orita M, Suzuki Y, Sekiya T and Hayashi K. 1989. Rapid and
sensitive detection of point mutations and DNA polymorphisms
using the polymerase chain reaction. Genomics 5: 874–79.
Picoult-Newberg L, Ideker T E, Pohl M G, Taylor S L, Donaldson
M A, Nickerson D A and Boyce-Jacino M. 1999. Mining SNPs
from EST database. Genome Research 9: 167–74.
Sachidanandam R, weissman D, Schmidt S C, et al. 2001. A map
of human genome sequence variation containing 1.42 million
single nucleotide polymorphism. Nature 409: 928–33
Smith E J, Shi L, Drummond P, Rodriguez L, Hamilton L, Ramalal
S, Smith G, Pierce K, and Foster J. 2001. Expressed sequences
tags for the chicken genome from a normalized 10–day-old
white leghorn whole embryo cDNA library: 1. DNA sequence
characterization and linkage analysis. Journal of Heredity 92:
1–8.
ACKNOWLEDGEMENT
The authors gratefully acknowledge the financial support
provided by the Department of Biotechnology (DBT),
Government of India in the form of research grant (Ref. BT/
PR4729/AAQ/01/180/2004). The authors also thank
Dr.G.Butchaiah, Dean, RAGACOVAS for his support and
encouragement in developing this research project. Our
grateful acknowledgements are to the authorities of livestock
farms, Katuupakkam, Tamil Nadu, Mehsana and Dantiwada,
Gujarat.
REFERENCES
Alstchul S P, Gish W, Miller W, Mayers E W and Lipman D J.
1990. Basic local alignment search tool. Journal of Molecular
100
Indian Journal of Animal Sciences 80 (4): 373–375, April 2010
Effect of farms on growth pattern of crossbred cattle
SURENDRA SINGH1, A K VASISHT2, A K PAUL3 and L M BHAR4
Indian Agricultural Statistics Research Institute, New Delhi 110012 India
Received: 6 July 2009; Accepted: 5 December 2009
Key words: Growth models, Double and tripple cross, Root mean square error
Where Xt is weight of cattle at time t, 1-Asymptotic
weight, 2-Scaling parameter, ?3 -Rate of maturity, 4Inflection parameter.
For testing for homogeneity of variances at different farm
the Bartlett’s test has been used, and it was found with the
test result that there is a variability between the farms.
Researchers in the field of behavioural and life sciences
often come across with the studies on growth. Growth studies
are very important for the livestock production because
growth is the foundation on which the other forms of
production such as milk, meat, wool etc rests. Growth models
are used to predict growth rates and change in the shape of
the organism. Comparison of nonlinear models for weight
age data in cattle has been done under homoscedasticity
Brown et al. (1972), Brown et al. (1976), Alessandra et al.
(2002), Kolluru et al. (2003). Lambe et al. (2006), also
studied different growth models in lambs. Various nonlinear
models are available for comparing the growth pattern of
cattle, but comparison of growth pattern is needed to find
most appropriate model
In this paper, comparison of performance of different
breeds maintained at different farms has been done on the
basis of non-linear models under homoscedastic error
variance condition and heteroscedastic error condition on
the data of same breed for different farms.
Data used in the study were collected from Dehradun, Agra
and Bareilly farms for Friesian × Sahiwal × Hariana breed,
from birth to 36 months of age. The data for cattle in case of
Friesian × Sahiwal breeds was collected for Agra and
Dehradun farms for comparing the growth pattern of cattle
among farms. Following models are fitted for comparing the
performance of double cross and triple cross cattle.
1. Logistic model
X = β/(1+β
t
2e
–β t
3)
3. Richards model
X = β exp(1+β
t 1
2e
–β t
3 1/β 4
)
Measure of model adequacy
To determine the adequacy of the models, statistical
measure, RMSE which is MSE , is considered for judging
the goodness of fit of the model. It is given by
1/2
⎡ n Y1 –Y$ i ⎤
⎥
Root mean squared error (RMSE) = ⎢ ∑
⎢⎣i=1 n–p ⎥⎦
n = number of observations, p = number of parameters in the
model.
RESULTS AND DISCUSSION
From Table 1, it is evident that RMSE (23.9349) is least
for Von Bertalanffy model, but RMSE (23.9597) for
Gompertz model is very close to this value and Gompertz
model gives good prediction for birth and maturity weight,
so Gompertz model is the best fitted model for F × S × H
breed at Dehradun farm. Asymptotic weight (349.2) is
maximum for Gompertz model followed by Richards model
(343.2). Growth rate (0.1949) is maximum for logistic model.
RMSE (4.4825) values is least in Richards model observed
from Table 2 and it also shows that prediction for birth weight
and maturity weight is good. Therefore Richard is the best
fitted model for F×S breed at Dehradun Station followed by
Gompertz model as this model over estimates the weight at
birth and gives good prediction of weight at maturity. Table 1
also indicates high RMSE for Von Bertalanffy model than
Gompertz model. Asymptotic weight (619.80) is maximum
for Richards model followed by Gompertz (382.5) and Von
Bertalanffy models. Growth rate (0.1534) is the highest for
Brody and Logistic models and the least (0.0207) for Richards
model.
2. Gompertz model
X = β exp(1β
t 1
2e
–β t
3)
4. Von Bertalanffy Model
X = β /(1+β
t 1
2e
–β t
3 )3
5. Brody Model
X = β /(1+β e
t 1
2
;
–β t
3)
Present address: 1, 2, 3, 4Indian Institute of Agricultural Statistics
Research Institute (email: singh_iasri@yahoo.co.in)
101
374
SINGH ET AL.
[Indian Journal of Animal Sciences 80 (4)
Table 1. Station-wise parameter estimates by different models under homoscedastic error structure
model
Logistic
Parameter
ß1
ß2
ß3
Gompertz
RMSE
ß1
ß2
ß3
Richards
RMSE
ß1
ß2
ß3
ß4
Brody
RMSE
ß1
ß2
ß3
Von-Bertalanffy
RMSE
ß1
ß2
ß3
RMSE
Bareilly
Agra
Dehradun
F×S×H
F×S×H
F×S
F×S×H
F×S
340.3000
(16.5271)
6.6046
(0.9968)
0.0404
(0.0043)
19.2179
368.0000
(17.2467)
2.3180
(0.1215)
0.0974
(.00905)
13.5646
619.9000
(171.0000)
–0.9849
(0.0171)
0.0195
(0.0118)
–1.2270
(0.1840)
7.19420
340.3000
(16.5270)
–6.6046
(0.9968)
0.1614
(0.0175)
19.2179
355.4000
(16.7750)
–1.0792
(0.0864)
0.1185
(.1185)
15.6515
339.5000
(14.1131)
6.9597
(0.9061)
0.1614
(0.0147)
16.1711
367.3000
(13.6603)
2.3697
(0.0978)
0.0967
(0.0070)
10.4996
536.3000
(59.7119)
619.8000
(0.0165)
0.0275
(0.0072)
–1.0838
(0.1103)
4.2206
339.5000
(14.1131)
–6.9597
(0.9061)
0.1614
(0.0147)
16.1710
354.6000
(13.7857)
–1.1132
(0.0733)
0.1180
(0.0093)
12.6185
410.5000
(13.6002)
6.9597
x(0.8657
0.1623
0.0114)
15.0360
446.1000
(12.8978)
2.5350
(0.0807)
0.0951
0.0051)
9.3217
526.3000
(41.1868)
–0.8693
(0.0772)
0.0503
(0.0112)
–0.6752
(0.1589)
6.8825
410.5000
(13.6002)
–8.0829
(0.8657)
0.1623
(0.0114)
15.0360
429.4000
(12.9894)
–1.2214
(0.0634)
0.1173
(0.0069)
11.3303
327.8000
(17.2990)
8.5121
(1.9712)
0.1949
(0.0262)
24.3640
349.2000
(23.9764)
2.5636
(0.2814)
0.1156
(0.0176)
23.9571
343.2000
(32.9774)
0.6171
(3.2792)
0.1304
(0.0680
0.1937
(0.8430)
24.8196
327.8000
(17.29900
–8.5121
(1.9712)
0.1949
(0.0262)
24.3640
339.5000
(20.5903)
–1.2482
(0.1825)
0.1412
(0.0200)
23.9349
354.4000
(15.6193)
6.6555
(0.8399)
0.1534
(0.0142)
16.7320
382.5000
(15.7104)
2.3190
(0.0966)
0.0927
(0.0072)
11.3109
619.8000
(101.6000)
–0.9811
(0.0127)
0.0207
(0.0074)
–1.1862
(0.1165)
4.4825
354.4000
(15.6193)
–6.6555
(0.8399)
0.1534
(0.0142)
16.7320
369.5000
(15.5772)
–1.0815
(0.0703)
0.1128
(0.0093)
13.3384
Figures in brackets indicate standard errors.
From the above results it is found that maturity
weight is more for F × S breed than F × S×H breed,
whereas the growth rate of F × S×H breed is better than F ×
S breed.
It is observed from Table 1 that F×S×H breed growth is
maximum at Dehradun farm and minimum at Bareilly farm
under homoscedastic error condition using nonlinear models.
Maturity weight is found maximum at Dehradun farm and
minimum at Bareilly farm.
Table 1 revealed that growth rate is found better at Agra
farm than Dehradun farm for F×S breed under homoscedastic
error condition using nonlinear models and maturity weight
is also found to be better at Agra farm than at Dehradun
farm.
RMSE is least for Dehradun farm for F×S×H breed for
logistic model Table 2 and Growth rate is found better for
Bareilly farm. The maturity weight is found to be maximum
at Dehradun farm and minimum at Agra farm when models
102
April 2010]
EFFECT OF FARMS ON GROWTH PATTERN OF CROSSBRED CATTLE
375
Table 2. Station-wise parameter estimates by different model under heteroscedastic error structure
Model
Logistic
Parameter
ß1
ß2
ß3
Gompertz
RMSE
ß1
ß2
ß3
RMSE
Bareilly
F×S×H
Agra
F×S×H
F×S
F×S×H
F×S
287.9250
(2.3784)
8.9420
(0.1056)
0.2643
(0.0028)
0.1320
318.6515
(1.1803)
2.4832
(0.0042)
0.1361
(0.0006)
0.0778
285.6676
(2.7842)
9.2417
(0.1272)
0.2618
(0.0032)
0.1427
315.6594
(1.4062)
2.5214
(0.0051)
0.1354
(0.0008)
0.0851
343.9066
(4.0048)
10.4364
(0.1656)
0.2531
(0.0034)
0.1534
315.6594
(1.4062)
2.5214
(0.0510)
0.1354
(0.0008)
0.0851
303.6285
(2.7840)
9.7401
(0.1208)
0.2409
(0.0025)
0.1346
337.3123
(2.4365)
2.5720
(0.0079)
0.1236
(0.0011)
0.1040
289.2903
(3.3954)
8.8038
(0.1473)
0.2659
(0.0040)
0.1571
318.0417
(1.8383)
2.4744
(0.0067)
0.1394
(0.0011)
0.0981
are fitted under heteroscedastic error condition.
F×S breed growth rate is found (Table 2) to be better at
Dehradun farm than at Agra farm. The maturity weight is
also found to be better at Agra farm than at Dehradun farm
under heteroscedastic error condition.
Dehradun
REFERENCES
Brown J E, Brown C J and Butts W T. 1972. A discussion of the
aspects of weight, mature weight and rate of maturing in
Hereford and Angus cattle. Journal of Animal Sciences 34: 525.
Brown J E, Fitzhugh H A and Cartwright T C. 1976. A comparison
of nonlinear models for describing weight-age relationships in
Cattle. Journal of Animal Science 43: 810–18
Draper N R and Smith H.1966. Applied Regression Analysis. New
York: Wiley.
Lambe N R, Navajas E A, Simm G and Bunger L. 2006. A genetic
investigation of various growth models to describe growth of
lambs of two contrasting breeds. Journal of Animal Science 84:
2642–54
Ramesh Kolluru, Rana P S and Paul A K. 2003. Modelling for
growth pattern in crossbred cattle. Journal of Animal Science
73(10): 1174–79
Richards F J.1959. A flexible growth function for empirical use
Journal of Experimental Botany 10: 290–300.
SAS. 1990. SAS Users’ Guide Version6. Rdn. 4. SAS Institute
Incorporation. USA.
SUMMARY
Different sigmoidal nonlinear growth models are fitted
in growth data of double cross Friesian×Sahiwal and triple
cross Friesian × Sahiwal × Hariana breed at different farms.
It is found that growth rate of Friesian×Sahiwal× Hariana
breed under homoscedastic and heteroscedastic error
condition is found maximum at Bareilly farm and minimum
at Dehradun farm. Maturity weight is maximum at Dehradun
farm and minimum at Agra farm. For Friesian × Sahiwal
breed maturity weight is better at Agra farm than Dehradun
farm. Growth rate is better at Dehradun farm than at Agra
farm.
103
Indian Journal of Animal Sciences 80 (4): 376–378, April 2010
Influence of genetic and non-genetic factors on growth profile of
Bharat Merino sheep in semi-arid region of Rajasthan
ASHISH CHOPRA1, L L L PRINCE1, G R GOWANE1 and A L ARORA2
Central Sheep and Wool Research Institute, Avikanagar, via- Jaipur, Rajasthan 304 501 India
Received: 25 March 2009; Accepted: 23 November 2009
Key words: Bharat Merino sheep, Genetic factors, Growth traits, Non-genetic factors, Sheep
Bharat Merino is a synthetic dual type fine wool and
mutton sheep with 75% exotic inheritance, developed and
maintained at Central Sheep and Wool Research Institute
Avikanagar, Rajasthan. The purpose of this study was to
quantify the effect of non-genetic factors such as year of
birth, season and status of ewe at birth, in order to construct
an operational model for the accurate estimation of genetic
parameters and prediction of breeding values. Data, collected
over a period of 28 years (1980–2007) were classified in 4
classes. The traits included in the analysis were birth weight
(BWT), 3 month weight (3WT), 6 month weight (6WT),
average daily gain from birth to 3 months (ADG1) and
average daily gain from 3 to 6 months (ADG2) of 4,388 lambs
pertaining to both sexes. Likewise data were also classified
in 4 groups according to dam weight.
All the animals in this flock were kept under semiintensive management system. The flock was a closed type
where about 250 breedable females were maintained in the
flock over the years. These animals were subject to selection
mainly for weight at 6 months and first greasy fleece yield.
Male to female ratio for breeding was around 1: 25.
Regarding feeding, concentrate mixture was offered ad-lib.
to suckling lambs from 15-day age till weaning (90 days).
After about 3 weeks of age, lambs were sent for grazing in
morning and evening. During post-weaning period in addition
to 8–10 h grazing and dry fodder supplementation, 300 g
concentrate mixture per head to weaner lambs was provided.
Since the subclass numbers were unequal and
disproportionate the data were analyzed by the least squares
procedure of fitting constants and using LSMLMW
programme (Harvey 1990). The statistical model included
period (four classes), season, sex, dam weight (four classes),
interaction between period and sex, interaction between
season and sex, interaction between period and season and
interaction between period, season and sex as fixed effects
and regression of ewe’s age at lambing was taken as covariate.
Duncan’s multiple range tests was used for comparing subgroup means. Least squares means for BWT, 3WT, 6WT,
ADG1 and ADG2 were 3.31±0.01 kg, 15.67±0.07 kg,
22.39±0.10 kg, 138±01 g and 77±01 g, respectively.
Lambing period
Data spread over 28 years was included in this study and
classified in 4 periods. Effect of period was highly significant
(P<0.001) for all the traits (Table1). Body weights and ADGs
were significantly higher through out the period of study
except during third period, i.e. from 1996 to 2001. Change
in the feeding practices where zero supplementation was
practised from 1996 onwards for few years might have
resulted in down fall in the body weights of the animals.
Decreasing trend in the rainfall and higher frequency of
draught in last decades faced by this region might have also
contributed toward low production performance. Variation
in physical environmental conditions, feed and forage
availability prevailing in different years could lead to
significant period differences. Similar significant effect of
year of lambing was also reported by Dixit et al. (2001) in
Bharat Merino sheep, Sharma et al. (2003) in Marwari sheep,
Nehra and Singh (2006) in Marwari sheep and Rao et al.
(2004) in Nellore sheep.
Season of lambing
Spring born lambs were heavier than the autumn born
lambs (Table 1). Spring season is being practised as a major
season for lambing in the institute flock. Results indicate
that practice of getting major crop in spring season should
be continued further for getting heavier lambs. Due to higher
exotic inheritance of this strain, extra care was taken to avoid
external stress. Pregnant and lactating ewes of this period
were compensated for dry matter requirement by
supplementary feeding to protect animals from metabolic
stress. Lambs were also provided green feed mainly Lucerne
with stall feeding. This effect is continued in 3WT and 6WT
also as a carry over maternal permanent environmental effect.
Pre-weaning daily gain (ADG1) has non-significant effect
Present address: 1Scientists, 2PS and Head, Division of Animal
Genetics and Breeding (e mail: ashishshopra1234@gmail.com).
104
April 2010]
EVALUATION OF GROWTH PROFILE OF BHARAT MERINO SHEEP
377
Table 1. Least squares mean along with standard error (SE) for growth traits of Bharat Merino lambs
Traits/factors
LSμ±SE
Period
Up to 1989
1990 to 1995
1996 to 2001
2002 to 2007
SSN
1
2
Sex
Male
Female
Ewe weight at lambing
≤ 33 kg
33.01 to 37.0 kg
37.01 to 41.0 kg
≥ 41.01 kg
Period*Sex
Season*Sex
Period*SSN
Period*SSN*Sex
Regression of Damage
BWT (kg)
3WT (kg)
6WT (kg)
ADG1 (g)
ADG2 (g)
3.31±0.01 (4388)
**
3.44±0.03a(759)
3.38±0.02a(1082)
3.31±0.02b(1278)
3.12±0.03c(1269)
**
3.46±0.01(3654)
3.16±0.02(734)
**
3.40±0.02(2165)
3.22±0.02(2223)
**
3.01±0.02a(1551)
3.29±0.02b(1256)
3.43±0.02c(818)
3.50±0.02d(763)
NS
NS
*
NS
NS
15.67±0.07(3875)
**
16.64±0.17a(680)
16.64±0.12a(984)
13.36±0.13 b(1040)
16.02±0.13c(1171)
**
15.82±0.05(3214)
15.51±0.13(661)
**
16.16±0.10(1871)
15.17±0.09(2004)
**
13.94±0.10a (1307)
15.18±0.10 b(1123)
16.29±0.12c(746)
17.26±0.13 d (699)
NS
NS
**
NS
**
22.39±0.10(3468)
**
22.80±0.24a(591)
23.80 ±0.17 b(915)
20.01±0.19c(963)
22.97±0.18a(999)
**
23.00±0.08(2878)
21.78±0.18(590)
**
23.53±0.14(1605)
21.26±0.13(1863)
**
20.52±0.15a (1176)
21.94±0.15 b(996)
22.91±0.17c(678)
24.21±0.18 d (618)
NS
NS
**
NS
**
138±01(3875)
**
147±02a b(680)
148±01 b(984)
112±01c(1040)
144±01a(1171)
NS
138±01(3214)
138±01(661)
**
143±01(1871)
133±01 (2004)
**
122±01a (1307)
133±01 b (1123)
143±01c (746)
154±01d (699)
NS
NS
**
NS
**
77±01(3421)
**
72±02a(589)
85±02c (895)
75±02ab (950)
78±02b (987)
**
82±02(2845)
72±01(576)
**
86±01(1586)
68±01(1835)
*
74±01a (1166)
76±01a(980)
78±02a b(666)
81±02b (609)
NS
NS
**
NS
NS
Numbers in parentheses indicates the number of animals, **(P≤0.01), *(P≤0.05), NS (nonsignificant).
source of variation in all the body weights (Table 1). The
effect of dam weight was more on ADG1 than ADG 2. A
clear cut increasing trend towards an increase in the body
weights of the lambs with increase in the weight of the ewe
at lambing was seen. Heavier dams gave birth to heavier
lambs because of better nutrition and more uterine space
provided by them for developing foetus. Weaning weight
and ADG1 of these lambs were also observed to be
significantly high. After weaning, these heavier lambs
maintained their superiority in advanced age whereas their
ADG 2 was significant only at P<0.05. Similar results were
found by Dixit et al. (2001); Dey and Poonia (2005) and
Nehra and Singh (2006).
of season of lambing. ADG1 is non-significant owing to
intensive type feeding management up to 3 weeks of age
during pre-weaning period (hence getting the similar
environment) is being followed here in Avikanagar.
These results corroborated with the observations of Nehra
and Singh (2006), Dixit et al. (2001) and Dey and Poonia
(2005) whereas Singh et al. (1987) found autumn lambs were
heavier than the spring born lambs and Sivakumar et al.
(2005) found no effect of season of lambing. The lower body
weight of autumn born lambs emphasized the need to provide
supplementary feed and adequate management of these
lambs, to protect them from the variance inducing factor.
Sex
The sex of the lamb was a significant (<0.01) source of
variation in all the traits (Table1). The male lambs were
significantly heavier than the female lambs at birth and this
superiority of the male lambs increased with the advancement
of age. Higher pre-weaning and post-weaning daily gain was
also found in male lambs than females. Better pre-natal and
post-natal growth of male lambs may be due to differences
in their endocrine profile and in their culling level practised
at different ages. These results were in agreement with
Sharma et al. (2003), Rao et al. (2004), Dey and Poonia
(2005) and Nehra and Singh (2006).
Dam’s age at lambing
Dam’s age at lambing was a non-significant source of
variation at the birth (Table 1). This indicates the avoidance
of extreme ends in birth weight by nature to maintain the
genetic variance in a trait under selection. Similar results
were also reported by Negi et al. (1987) in Gaddi sheep and
its crosses. Dam’s age was highly significant (P<0.01) at
3WT and 6WT, may be because older dams have more milk
production and good mothering ability. Dixit et al. (2001)
reported effect of age of ewe at birth and post-weaning ADG
less significant, whereas it was found to be highly significant
on all other traits in Bharat Merino sheep which is similar
finding to our study.
Dam weight at lambing
Weight of the dams at lambing was a highly significant
105
378
CHOPRA ET AL.
[Indian Journal of Animal Sciences 80 (4)
ACKNOWLEDGEMENTS
Interaction effects
Among the interaction of fixed effect studied, only
interaction between period and season had significant effect
on birth weight (P<0.05) (Table 1). This indicated the
constancy of seasonal variation under the study period which
was always high. Interaction between period and season,
interaction between season and sex, and interaction between
period, season and sex were non-significant. Contrary to our
study, the interaction between sex and year of birth was
observed to be highly significant by Sharma et al. (2003).
Results clearly indicate that all the effects taken in study
were either highly or moderately significant sources of
variation on the growth traits. These findings demonstrate
the need of giving proper attention to the significant factors
and requirement of efficient flock management to obtain the
optimum productivity. To obtain the more accurate estimates
of genetic parameters and breeding values it is necessary to
adjust the growth records for significant factors prior to
further analysis.
Authors thank the Director of this Institute for providing
facilities. Assistance in data management by Shri N.C. Gupta,
T-5 is acknowledged.
REFERENCES
Dey B and Poonia J S. 2005. Factors affecting growth traits in Nali
sheep. Indian Journal of Small Ruminants 11(1): 77–79.
Dixit S P, Dhillon J S and Singh G. 2001. Genetic and non-genetic
parameter estimates for growth traits of Bharat Merino lambs.
Small Ruminant Research 42: 101–04.
Harvey R W. 1990. User’s Guide for LSMLMW. Mixed Model Least
squares and Maximum Likelihood computer programme, PC–
2 Version. Ohio State University, Columbus, (Mimeograph)
USA.
Negi P R, Bhat P P and Garg R C. 1987. Factors affecting preweaning weights in Gaddi sheep and its crosses. Indian Journal
of Animal Sciences 57(5): 489–92.
Nehra K S and Singh V K. 2006. Genetic evaluation of Marwari
sheep in arid zone: Growth. Indian Journal of Small Ruminants
12(1): 91–94.
Rao V S T, Reddy R V, Veerabrhmalah K and Suresh J. 2004. Nongenetic factors effecting pre-and post-weaning body weights in
two strains of Nellore sheep. Indian Journal of Small Ruminants
10(1): 86–87.
Sharma M K, Sharma N K, Singh V K and Beniwal B K. 2003.
Genetic evaluation of Nali and Marwari sheep in arid zone of
Rajasthan: Body weights. Indian Journal of Small Ruminants
9(1): 65–68.
Singh G, Mehta B S, Sethi I C and Arora C L. 1987. Genetic and
non-genetic factors affecting growth traits of Nali and its
crossbred lambs under semi-arid conditions. Indian Journal of
Animal Sciences 57(7): 728–34.
Sivakumar T, Soundararajan C, Palanidorai R, Ganeshkumar K,
Mahendrans M and Malathi G. 2005. Factors affecting birth
weight in Madras Red lambs. Indian Journal of Small Ruminants
12(1): 115–16.
SUMMARY
Present study was conducted to assess the effect of nongenetic factors on growth traits of Bharat Merino sheep.
Effect of period was significant for all the traits. Season was
significant for all the traits except ADG1 indicating uniform
management during pre-weaning stage. Heavier dams gave
birth to heavier lambs because of better nutrition and more
uterine space provided by them for developing foetus. Dam’s
age at lambing was a non-significant source of variation at
the birth, indicating the avoidance of very high and very low
weight at birth by nature. Interactions were mostly nonsignificant except the interaction between period and
season.
106
Indian Journal of Animal Sciences 80 (4): 379–381, April 2010
Impact of breed improvement programme on goat production under farmers’ flocks
M K SINGH1, A K GOEL2, B RAI3, ASHOK KUMA4 and M C SHARMA5
Central Institute for Research on Goats, Makhdoom, Uttar Pradesh 281 122 India
Received: 10 September 2009;Accepted: 24 November 2009
Key words: Barbari, Breeding, Goat improvement, Conservation
Population of Barbari goats is continuously declining in
its home tract which has put this breed in endangered category
(Singh and Rai 2006). Important reasons for decline in
population are indiscriminate breeding due to lack of pure
Barbari bucks and dilution with Sirohi breed of goats as Sirohi
breeding bucks are available with large flocks and Sirohi
goats are hardy for climatic, feeding and housing stress and
perform better under grazing/browsing (Rai et al. 2009).
Besides population, performance of these goats is also
declining due to breeding with low potential bucks since
males with good growth are sold without their replacement.
Poor adoption of technology due to lack of knowledge is
another reason of low performance. Therefore, to improve
the goat productivity under farmers’ conditions, it is necessary
to provide quality germ plasm especially breeding male,
support services (prophylactic measures, market for their goat
and goat produces) and awareness on improved management
practices.
The Central Institute for Research on Goats, Makhdoom
(Uttar Pradesh) launched a multidisciplinary transfer of
technology (TOT) programme in the home tract of Barbari
goat ie Farah block of Mathura district of Uttar Pradesh in
the year 2005. Villages Jalal, Bar Ka Nagla, Popa Burj and
Pauri Sahjadpur were adopted under TOT programme on the
basis of sizable goat population. Data on socio-economic
attributes of goat keeper families, breed and flock
composition, housing, disease status and management
practices etc. were collected on structured schedule through
conducting surveys. Later on 6 breeding bucks and 41 females
of Barbari breed were provided to goat keepers of selected
villages. Performance data on body weight, reproductive
traits and service record of bucks were recorded by
performing fortnightly visits and with the help of resource
person.
Body weights of kids were recorded at an interval of 3
months with respect to breed/type, type of birth and sex by a
dial balance. Goat keepers were motivated to adopt breeding
package of practices such as advantage of keeping purebred
buck, awareness on criteria’s and bases of males and females
selection, disadvantage of inbreeding (goat keepers used a
buck for 3–5 years and later on its progeny), proper age of
first service, proper time of service (mid oestrus), care before
and during late pregnancy and at the time of parturition,
kidding in favourable seasons (climate and feeding
resources), optimum interval for re-breeding etc. Besides
personal visits; awareness camps, health camps, farmer’s day
etc were also arranged. Data on various traits were analyzed
using appropriate statistical tools.
Socio-economic attributes: Number of Households were
127, 54, 102 and 202 in the village Jalal, Bar ka Nagla, Popa
burj and Pauri Sahjadpur. Out of these households, 33, 28,
30 and 34 goat keepers in the corresponding villages were
goat rearing (Table 1). Maximum goat rearing households
belong to backward (74%) followed by schedule caste (22%)
communities. Maximum goat keepers were marginal (59%),
followed by landless (38) and small (3%) landholding
category. Goat rearing was mostly (84%) practised as
secondary source of income and contributes substantially
(20–40%) of their total income. Present results were in
agreement with the findings of Gokhale et al. 2002, Kumar
et al. 2006 and Singh and Rai 2006. About 20–40% goat
keepers also kept buffaloes. There were about 5–7% families
in each village whose major source of income was from goats
and their secondary sources of incomes were from crop
farming and factory labour. Most of the (>55%) goat keepers
were illiterate. Male kids were sold through middleman
(butchers) between 5 and 9 months of age whereas females
Table 1. Goat population profile in adopted villages
Present addresses: 1Senior Scientist (e mail: manoj@cirg.res.in),
Scientists, Division of Physiology Dynamics.
5Director, IVRI, Izatnagar, Uttar Pradesh 243 122.
2,3,4Principal
107
Villages profile
Jalal
Bar Ka
Nagla
Popaburj
Pauri
Sahjadpur
No. of households
No. of goat rearing
families
Average flock size
Range
127
33
54
27
102
30
202
31
4.2
1–16
8.6
1–12
5.4
1–12
5.9
1–14
380
SINGH ET AL.
[Indian Journal of Animal Sciences 80 (4)
Table 2.Status of type of birth and service rendered by the institute buck
Village
Jalal
Bar ka Nagla
Popa Burj
Pauri Sahjadpur
Year
Institutes buck (%)
Village bucks (%)
Single (%)
Twins (%)
Triplets(%)
2006–07
2007–08
2008–09
2006–07
2007–08
2008–09
2006–07
2007–08
2008–09
2006–07
2007–08
2008–09
82.6
84.3
84.6
52.0
70.0
68.0
57.7
56.0
74.3
64.0
76.8
71.6
17.4
15.6
15.4
48.0
30.0
32.0
42.4
46.0
25.7
36.0
23.2
27.4
50.0
32.5
36.0
35.2
47.2
30.0
32.3
37.0
32.0
35.7
23.3
25.0
50.0
67.5
59.0
54.0
45.5
58.0
67.7
53.0
57
64.3
66.7
66.0
–
0.0
5.0
10.8
8.3
12.0
–
9.0
11.0
–
10.0
9.0
normal requirements besides inadequate protection against
inclement weather. The breed composition in terms of
Barbari, Barbari type and non-descript goats was 10.8, 41.9
and 47.2%, respectively, in Jalal, 0, 7.6 and 92.4% in Bar Ka
Nagla, 0, 22.7 and 72.3% in Popa Burj and 4, 27.6 and 68.4%,
respectively in Pauri Sahjadpur, respectively in 2006
(Table 3). There was no buck in the village Jalal and Popa
Burj and farmers were dependent on non-descript bucks of
low potential of adjoining villages. PPR, ET, diarrhoea,
pneumonia and internal parasitic infestation were major cause
of morbidity and mortality. Diarrhoea and pneumonia
together accounted for 82% mortality in kids in adopted
villages.
Impact of breeding interventions: The bucks from Institute
were provided to the goat keepers to extend services to 85,
68, 75.0 and 72% goat keepers in Jalal, Bar Ka Nagla, Popa
Burj and Pauri Sahjadpur villages, respectively (Table 2).
The impact of buck distribution over the years (from 2005–
06 to 2008–09) resulted in an increase of Barbari type young
kids from 42 to 92.3% in Jalal, from 0 to 30.82% in Bar Ka
Nagla, from 23 to 68.18% in Popa Burj and from 31.6 to
were mostly sold among goat keepers.
Goat management practices: The average flock size
(including followers) was 4.2, 8.6, 5.4 and 5.8, respectively,
in village Jalal, Bar Ka Nagla, Popa Burj and Pauri Sahjadpur,
respectively (Table 1). Goats were maintained mainly on
grazing however, grains were also provided in the form of
sani consisted of wheat straw mixed with fermented crushed
grains of barley or wheat. However, sani is provided to
lactating or quality goats for a limited period in a year (40–
100 days). Amount of concentrate varies from 50–250 g/head/
day. The percentage of farmers rearing goats on stall-fed,
low level of semi-intensive, moderate level of semi intensive
and extensive feeding systems were 0, 7.7, 69.2, and 23%,
respectively, in Jalal. Corresponding values were 4.1, 12.5,
29.1 and 45.8%, respectively in Bar Ka Nagla; 7.1, 17.9,
67.8 and 10.7%, respectively in Popa Burj and 7.1, 32.1,
50.0 and 17.9%, respectively in Pauri Sahjadpur. Weaning
of kids continued till dam allowed the kids to suckle usually
up to 4–6 months of age. Most of the flocks (75%) were
provided inadequate housing space. The average open and
covered housing space was 3 and 2 times lesser than the
Table 3. Breed composition of adult goats and in kids after buck distribution in the year 2005 in adopted villages
Village (s)
No of goat
keepers
Year
Jalal
26
Bar Ka Nagla
26
Popa –Burj
29
Pauri –Sahjadpur
29
2006–07
2007–08
2008–09
2006–07
2007–08
2008–09
2006–07
2007–08
2008–09
2006–07
2007–08
2008–09
Breed composition in adultgoats (%)
Breed composition in kids (%)
Barbari
Barbari type
Non descript
Barbari
Barbari type
Non descript
10.8
25.0
24.4
0.0
2.7
4.2
0.0
3.6
7.8
4.0
5.0
11.4
41.9
43.7
44.2
7.6
6.8
12.5
22.7
25.4
29.2
17.6
22.5
27.5
47.2
31.5
31.2
92.4
90.0
83.3
72.3
70.9
63.0
78.4
72.5
61.1
0.0
40.0
38.0
0.0
20.0
18.0
4.5
6.8
11.6
12.0
10.5
18.2
92.3
47.5
50.0
30.8
55.0
58.0
68.2
62.0
62.6
60.3
68.4
63.8
7.7
12.5
12.0
69.2
25.0
24.0
27.3
31.0
26
27.6
21.0
18.0
108
April 2010]
IMPACT OF BREED IMPROVEMENT PROGRAMME ON GOAT PRODUCTION
72.4% in Pauri- Sahjadpur. The overall body weight of goats
belonging to Jalal village was 2.63±0.05, 8.03±0.15,
14.90±0.36, 16.89±0.81, 19.43±1.09 and 24.12±0.51 kg at
birth and 3, 6, 9, 12 and >18 months, respectively. The
corresponding estimates in village Bar Ka Nagla were
2.90±1.04, 8.56±0.79, 13.83±0.99, 17.75±2.03, 23.33±180
and 28.45±0.89 kg, respectively; in Popa-Burj were
3.55±0.09, 8.86±0.24, 14.14±0.35, 17.95±0.91, 22.08±0.73
and 30.11±0.91 kg, respectively and in Pauri-Sahjadpur were
3.34±1.54, 8.73±0.92, 15.73±0.95, 22.51±1.27, 27.66±1.88
and 29.64±1.01 kg, respectively. Body weights of kids at
different ages however, were less than the kids maintained
at Institute flock under semi-intensive management system
(CIRG, 2007). A significant increase was recorded in
incidences of multiple births in every adopted village as a
result of breeding with Institute buck. The incidences of
overall multiple births increased from to 42.8 (2005–06) to
64.7% (2008–09).
Barbari bucks distribution in its home tract was
quite effective, quick and easily manageable intervention by
goat keepers. Such intervention is also useful in mobilizing
goats for breed oriented market and ultimately technological
improvisation for maximization of production. Distribution
of 1–2 Barbari bucks in each village depending upon goat
population is very sustainable approach for the improvement
and conservation of Barbari goats. Since Barbari goats are
found in a very large area, more breeding farms should be
established to cater to the need of elite bucks for field.
381
with occasional supplementation of concentrate diet without
any prophylactic measures. One or two Barbari bucks were
provided in each adopted village which increased Barbari/
Barbari type of adult goats from 52.2 to 61.2% in Jalal, 7.6
to 10% in Bar Ka Nagla, 22.7 to 29.1% in Popa Burj and
from 21.6 to 27.5% in Pauri Sahjadpur. The incidences of
birth of Barbari/Barbari type kids in above corresponding
villages were 87.5, 70.0, 69.0 and 78.9%, respectively. Buck
supply also increased incidences of multiple births in adopted
villages.
ACKNOWLEDGEMENT
Authors are thankful to Incharge Barbari Unit of AICRP
on Goats for providing bucks and females to goat keepers
and Director for help.
REFERENCES
CIRG. 2007. Annual Progress Report. Central Institute for Research
on Goats, Makhdoom, Mathura (UP).
Gokhale S B, Gokhale R B, Phadlke N L and Desale R J. 2002.
Status in village goat management practices in Maharashtra.
Indian Journal of Animal Sciences 72: 810–14.
Kumar Shalander, Vaid R K and Sagar R L. 2006. Contribution of
goats to livelihood security of small ruminant farmers in semiarid region. Indian Journal of Small Ruminants 12: 61–66.
Rai B and Singh M K. 2004. Rearing practices of Jakhrana goats
in their native tract. Indian Journal of Small Ruminants 10 (1):
33–35.
Rai B, Singh M K, Sharma R B and Sharma M C.2009. Caprine
biodiversity and Sustainable Management for their Conservation
in National Seminar on Goat Biodiversity Conservation:
Challenges and Opportunities. 20–21 March, page. 1–9 held at
MPKV, Rahuri,
Singh M K, Rai B, Kumar Ashok, Simaria M B and Singh N P
2009. Performance of Zalawadi goats under range conditions.
Indian Journal of Animal Sciences 79 (1): 68–73.
Singh M K and Rai B. 2006. Barbari breed of goat: Reasons of
dilution in its home tract. Indian Journal of Animal Sciences
76: 716–19.
SUMMARY
Barbari, a highly prolific, dual purpose goat and highly
suitable for commercial goat farming has come in endangered
category of goat breed. Four villages of Farah block in
Mathura district of Uttar Pradesh were selected for motivating
farmers to adopt technologies in the form of germplasm and
package of breeding practices. None of the village has
purebred Barbari buck. Goats were maintained on grazing
109
Indian Journal of Animal Sciences 80 (4): 382–384, April 2010
Evaluation of growth, feed conservation efficiency and carcass traits of Jamunapari
goats under intensive feeding system
M K SINGH1, T K DUTTA2, R B SHARMA3, A K DAS4 and N P SINGH5
Central Institute for Research on Goats, Makhdoom, Mathura, Uttar Pradesh 281 122 India
Received: 20 April 2009; Accepted: 28 November 2009
Key words: Carcass traits, Complete feed, DM intake, Feed Conservation Energy (FCE), Jamunapari goat
Jamunapari is one of the important large sized dualpurpose goat breeds of India. These goats have been
extensively used across the country and aboard for upgradation of non-descript and poor performing goats.
However, presently Jamunapari breed has come under
endangered category on account of reduction in population
in its home tract mainly due to lack of feeding resources
(browsing material), improper marketing policy and
inadequate development programmes etc. (Singh et al. 2008).
Therefore, it is essential to find out alternate feeds to maintain
the production potential of these goats so that sustainable
livelihood of goat keepers and conservation of this valuable
germplasm could be ensured. Balanced feeding in terms of
energy and protein optimizes growth and this interrelationship is additive (Chowdhury and Ørskov 1997). The
complete feed pellet (CP12% and TDN 60%) containing
Cajanus cajan straw as basal roughage gave 51.11 g ADG in
weaned (5–10 months) Barbari kids (Dutta et al. 2003).
Development of suitable feeding system for this endangered
goat breed is one of the targeted areas for its conservation.
Commercial goat farming is coming up with fast pace nowa-day. Therefore, it is high time to develop alternate feedings
schedule suitable for pace of changes occurring in land
utilization pattern particularly shrinkage of grazing land.
Therefore, present study was conducted to evaluate complete
feed based legume straw (Cajanus cajan) in 2 physical forms
(pellet and total mixed ration) in Jamunapari kids.
The experiment was carried out in Jamunapari goat unit
of All India Coordinated Research Programme located at the
Central Institute for Research on Goats (CIRG), Makhdoom,
Farah (P.O.), Mathura, Uttar Pradesh in 2006–07. Eighteen
weaned Jamunapari males at 3 months of age were divided
into two equal groups based on their body weight. Animals
were kept individually during the experimental period i.e. 3
to 9 months of age. Kids under group 1 (T1) were fed ad lib.
complete pelleted feed and in group 2 (T2) ad lib. total mixed
ration (TMR). The rations were prepared using the ingredients
as mentioned in Table 1.
Samples of feeds and residues were analyzed for
Proximate Principles (AOAC 1984) and cell wall constituents
(Goering and Van Soest 1970). Observations on body weights
were recorded at weekly interval up to 9 months of age
whereas nutrients intake was recorded daily. Freshwater was
freely available to kids. These kids at the age of 9 months
were slaughtered for carcass evaluation. The animals were
weighed prior to slaughter. Bleeding, skinning and
evisceration were done as per the standard procedures. After
dressing the carcass measurements were taken as per Prasad
and Agnihotri (1992). Weight of edible and non-edible offal’s
Table 1. Formulation and chemical composition (%)
of complete feeds
Parameters
Ration formulation (%)
Maize
Barley
Groundnut cake
Wheat bran
Mineral mixture
Common salt
Cajanus cajan straw
Total
Chemical composition (%)
CP
EE
Ash
NDF
ADF
(T1) complete
pellet feed
10
15
15
8.5
1
0.5
50
100
14.52
2.26
11.04
52.78
28.75
(T2) total
mixed ration
10
15
15
8.5
1
0.5
50
100
14.38
2.42
11.63
54.10
31.42
Vitamins supplemented per quintal of feed mixture: -vitaminA 500000 IU, vitamin D3 100000 IU, vitamin B2 0.2 g, vitamin E
75 units, vitamin K 0.1 g, calcium pantothenate 0.25 g, nicotinamide
1.0 g, vitamin B12 0.6 mg.
Present address: 1,2,3Senior Scientists, 4Scientist, 5Formerly
Director (1email: manoj@cirg.res.in)
110
April 2010]
EVALUATION OF GROWTH, FCE AND CARCASS TRAITS OF JAMUNAPARI GOATS
383
Table 2. Nutrient intake and growth in weaned Jamunapari kids under complete feeds
Parameters
Initial body weight (kg)
DM intake (g)
DMI (kg)/100 kg BW
DMI (kg)/W0.75 kg BW
CP intake (g)
CPI (g)/W0.75 kg BW
NDF intake (g)
NDF (g)/W0.75 kg BW
Final body weight (kg)
Weight gain (kg)
ADG (g)
Feed conversion efficiency (%)
T1 (complete pellet feed)
T2 (total mixed ration)
Significance
11.33±0.57
891.86±72.84
4.82±0.18
99.41±3.65
129.50±10.58
14.43±0.53
470.72±38.45
52.46±1.93
29.80±2.13
16.42±2.15
90.23±8.92
10.47±0.60
10.61±0.50
663.05±55.90
4.67±0.51
90.64±9.22
95.35±8.04
13.03±1.33
358.71±30.24
49.04±4.99
24.93±2.36
11.81±0.52
64.89±2.89
10.44±1.06
NS
NS
NS
NS
NS
P<0.05
NS
P<0.05
NS
NS
P<0.05
NS
Table 3. Carcass traits, variety meat and different cut weights of
Jamunapari kids fed with different pelleted feeds
and separated fat to the nearest of 1 g, empty body weight to
the nearest of 5 g and dressing percentage were recorded as
described by Dhanda et al. (1999). Immediately after dressing
carcass measurements were recorded using a measuring tape
to the nearest of 1 mm. Different cut weights were taken
following standard procedure. Statistical analysis of data was
done using student t-Test as per Snedecor and Cochran
(1980).
The CP, EE and NDF were 14.52, 2.26 and 52.78% in
complete feed pellet, corresponding estimates were 14.38,
2.42 and 54.10% in total mixed ration (Table 1). Higher DM
intake in T1 than T2 was recorded, though the difference was
nonsignificant (Table 2). The DM intake/kg W0.75 was 99.41
in T1 and 90.64 g in T2. Whereas, CP and NDF intakes/kg
W0.75 were (P<0.05) higher in T1 (14.43 and 52.46 g) as
compared to T2 (13.03 and 49.04 g). Therefore, palatability
of complete pelleted feed was better than total mixed ration
in these kids. The results corroborated the findings of Dutta
et al. (2003) in Barbari kids. Weight gain and final body
weight (slaughter) were higher in T1 by 4.61 and 5.33 kg
over T2, but the difference was nonsignificant, which might
be due to high individual variations within group. However,
average daily gain (ADG) was significantly (P<0.05) higher
in T1 (90.23 g) than T2 (64.89 g), which was mainly due to
higher nutrients intake in pellet fed group. Feed conversion
efficiency (%) was statistically similar in both the groups
(10.47 vs 10.44). Prakash et al. (2006) in Barbari kids
reported similar finding. The complete feed pellet (CP12%
and TDN 60%) containing Cajanus cajan straw as basal
roughage gave 51.11 g ADG in weaned (5–10 months)
Barbari kids (Dutta et al. 2003). Higher growth rate in T1
due to higher intake was almost similar with the results of
earlier study in Mawari kids reared under feed lot system
(Shinde et al. 2000).
The slaughter weight was 4.87 kg higher in T1 than T2
although difference was non-significant (Table 3). Body
measurements and carcass measurements were higher in T1
than T2, however significant (P<0.05) effect was observed
Traits
T1
T2
Significance
Slaughter weight (kg)
29.80±2.13 24.93±2.36
Carcass measurements
Carcass loin width (cm) 12.94±0.47 11.67±0.34
Chest circumference (cm)66.44±1.77 59.78±2.19
Leg circumference (cm) 29.22±1.26 26.97±1.69
1.08±0.03
GR measurement (mm)# 1.16±0.07
Loin eye area (cm2)
10.68±0.71
9.88±0.54
Fat thickness##
Back fat (mm)
1.18±0.07
1.10±0.02
Breast fat (cm)
2.26±0.26
1.72±0.29
Carcass traits
Hot carcass weight (kg) 14.29±0.29 11.27±1.25
47.56±1.29 44.71±0.88
Dressing (%)b
55.55±1.20 55.65±0.97
Dressing (%)a
Variety meatb
Testes (g)
170.00±13.87 125.56±11.68
Pancreas (g)
39.44±2.42 32.22±4.01
Spleen (g)
56.11±8.93 40.00±5.27
Kidney (g)
98.33±6.24 86.11±9.20
Liver (g)
483.33±30.26 401.11±35.68
Heart (g)
117.22±9.39 87.22±9.32
Depot fat (kg)
Cod fat (kg)
77.22±8.68 64.44±9.23
Kidney fat (kg)
149.44±20.92 131.11±40.36
Omental fat (kg)
250.00±24.49 194.44±30.76
Cut weights
Leg cut weight (kg)
2.19±0.20
1.93±0.13
Loin cut weight (kg)
0.88±0.07
0.82±0.10
Rack cut weight (kg)
0.96±0.09
0.90±0.06
Neck and shoulder
1.66±0.20
1.58±0.16
weight (kg)
Breast and shank
1.41±0.12
1.25±0.12
cut weight (kg)
Saleable meat yield as 44.03±1.18 40.76±1.08
% of SW
NS
NS
NS
NS
P<0.05
NS
P<0.05
NS
NS
NS
NS
NS
P<0.05
NS
NS
NS
NS
NS
NS
P<0.05
NS
NS
NS
NS
NS
NS
*P<0.05; # GR measurement is the soft tissue thickness,
measured 11 cm from midline on 12th rib of the carcass; ## Fat
thickness measured with vernier caliper. aOn empty body weight
basis; bincludes heart, liver kidney, pancreas, spleen and testes;
CW carcass weight; SW slaughter weight.
111
384
SINGH ET AL.
only in GR measurement (T1, 2.16 mm and T2, 2.08 mm).
Kids from the pellet fed group had better type chevon carcass
with larger loins and enhanced back and breast fat thickness.
Hot carcass weight and dressing percentage on slaughter
weight basis was also numerically higher in T1 than T2,
however, difference in both the group for carcass and noncarcass traits was nonsignificant (Table 3). Kidney and cod
fat depot were similar in both the groups, whereas, pelleted
feed resulted higher (P<0.05) omental fat deposit in T1 than
T2. Due to higher body weight in T1, the weight of different
edible organs (testis, spleen, kidney, liver and heart) tended
to be higher in T1 than T2. Different cut weights like leg cut,
loin cut, rack cut, neck and shoulder cut and breast and shank
cut were higher in T1 than T2. Sealable meat yield was 44.03
in T 1 and 40.76% in T 2 , however, differences were
nonsignificant. The complete feeds in this experiment
contained 50% concentrate mixture, therefore, contain higher
protein (CP 14.52 and 14.38%) and energy (estimated TDN
60.65% in both treatments) contents. The intake of nutrients
was increased by the kids under T1 due to reduced particle
size of pelleted feed, which triggered into more fat deposit
in the carcass as compared to TMR fed kids. Higher
proportion of cod and kidney fat for intensively fed kids were
probably brought about by higher intake of protein and energy
(Shinde et al. 2000 and Abdullah and Musallan 2007).
Additional DM intake of 229 g/day/kid in complete pellet
fed group resulted into 3.02 kg higher meat yield in the same
feeding period than TMR fed kids of Jamunapari breed. The
growth rate (90.23 g) of Jamunapari kids under T1 was better
than the reported weight gain/day (50.33 g) in the same breed
reared under intensive feeding. Therefore, complete pelleted
feed prepared with 50% concentrate mixture and 50%
roughage (C. cajan) can be used for higher growth and chevon
production in Jamunapari kids under commercial goat
production as well as conservation of this endangered breed
of goat.
[Indian Journal of Animal Sciences 80 (4)
back and breast fat thickness. Hot carcass weight and dressing
percentage on slaughter weight basis was numerically higher
in T1 than T2. Additional DM intake of 229 g/day/kid in
complete pellet fed group on account of better palatability
resulted into higher body weight by 4.87 kg, weight gain by
25.34 g/day and 3.02 kg higher meat yield over total mixed
ration in the same period. Results indicate that Jamunapari
goat farmers could utilize complete pelletd feed for higher
growth and sustainable conservation of the unique
Jamunapari goat breed.
REFERENCES
Abdullah A Y and Musallam H S. 2007. Effect of different levels
of energy on carcass composition and meat quality of lame black
goat kids. Livestock Science 107: 70–80.
AOAC. 1984. Official Methods of Analysis, 14th edn. Association
of Official Analytical Chemists, Washington DC, USA.
Chowdhury S A and Orskov E R. 1997. Protein energy relationship
with particular references to energy under nutrition: A review.
Small Ruminant Research 26: 1–7.
Dhanda J S, Taylor D G, Murray P J and McCosker J E. 1999. The
influence of goat genotype on capretto and chevon cacasses.
Chemical composition of muscle and fatty acid profile of
adipose tissue. Meat Science 52: 375–79.
Dutta T K, Singh Nawab, Rekhate D H, Reddy T J and Settar V B.
2003. Utilization of by-products of pulses, oilseeds along with
coarse cereals grain for intensive goat production. Final Report
of NATP-RPPS–12. Central Institute for Research on Goats,
Makhdoom, Farah, Mathura, Uttar Pradesh 281 122 (India), pp
61–93.
Goering H K and Van Soest P J. 1970. Forage fiber analyses.
Apparatus, reagents, procedures and some application. U.S.D.A,
A.R.S. Agriculture Handbook, No. 379, Washington, D.C.
Prakash B, Dutta T K and Siddiqui I A. 2006. Effect of plane of
nutrition on nutrient utilization and performance of Barbari kids.
Indian Journal of Animal Nutrition 23: 29–33.
Prasad V S S and Agnihotri M K. 1992. Relevance of frame size
and fatness indices to liv animal and carcass classification in
goats. Indian Journal Animal Sciences 62: 461–66.
Rekhate D H, Madavi V B, Dhok A P and Patil. 2004. Evaluation
of arhar and gram straw based pelleted complete feed in goat.
Indian Journal of Animal Nutrition 21: 257–60.
Saini A L, Pakash B and Khan B U. 1986. System of management
in relation to growth performance in Jamunapari kids. Indian
Journal of Animal Production and Management 2: 26–29.
Shinde A K, Singh N P, Sen A and Verma D L. 2000. Evaluation of
kids rearing system for meat production. Indian Journal of
Animal Sciences 70: 200–02.
Singh M K, Rai B, Singh Pallavi, Singh P K and Singh N P. 2008.
Status of goat production in different agro-climatic regions of
India: An Overview. Indian Journal of Small Ruminants 14:
48–70
Snedecor G W and Cochran W G. 1980. Statistical Methods. 6th
edn. Oxford and IBH Publishing Co. Pvt. Ltd., New Delhi.
SUMMARY
Post-weaned Jamunapari males at 3 months of age were
fed either with ad lib. complete pelleted feed (CPF) (T1) or
with total mixed ration (TMR) (T 2 ). The rations were
prepared with 50% concentrate mixture and 50% Cajanus
cajan straw. Kids consumed numerically higher DM in T1
than T2, however, the difference was nonsignificant. Whereas,
CP and NDF intakes/kg W0.75 were significantly (P<0.05)
higher in T1 as compared to T2. Average daily gain (ADG)
was significantly higher (P<0.05) in T 1 than in T 2 .
Biometrical and carcass measurements were statistically
similar in both the groups. Kids from the pellet fed group
had better type chevon carcass with larger loins and enhanced
112
Indian Journal of Animal Sciences 80 (4): 385–387, April 2010
Housing and feeding managemental practices for goats followed in South Gujarat
G P SABAPARA 1, S B DESHPANDE 2, V B KHARADI 3 and P K MALIK4
Navsari Agricultural University, Navsari 396 450 India
Received: 3 July 2009; Accepted: 20 November 2009
Key words: Feeding management, Goats, Housing management
Goat husbandry is a popular enterprise among the artisan
people and back word communities in South Gujarat region
comprising seven districts, viz. Bharuch, Surat, Narmada,
Navsari, Valsad, Tapi and Dangs, where goats mainly thrive
well on zero or minimum inputs system with high prolificacy.
The managemental practices for goat followed by their
keepers are entirely different in various geographical regions
and even it is somewhat different in the South Gujarat than
the followed in other region of Gujarat. Therefore, an attempt
was made to study the housing and feeding pattern of goat
followed by the owners in South Gujarat region. For the
purpose, a field survey was conducted on 1243 goat keepers
of 45 villages in three districts, viz. Navsari, Surat and
Bharuch of South Gujarat region to study the prevailing
housing and feeding practices followed by them. The data
were analyzed and tabulated to draw the meaningful
Table 1. Housing management practices on caste basis
Particulars
Type of housing
Open
Close
Kachcha
Pacca
Roof
Kachcha
Pacca
Flooring
Kachcha
Pacca
Manger
Yes
No
Watering
Well
Pond
Others
Place of housing
Near Residence
Inside Residence
Others
Goats Keepers
SC
(n =124)
ST
(n =565)
OBC
(n =164)
Other
(n =390)
Overall
(n =1243)
121(97.58)
3 (2.42)
3 (100)
0 (0)
129 (22.83)
436 (77.17)
434 (99.54)
2 (0.36)
91 (55.49)
73 (44.51)
68 (93.15)
5 (6.89)
226 (57.95)
164 (42.05)
141 (85.98)
23 (14.02)
567 (45.62)
676 (54.38)
646 (95.56)
30 (4.44)
3 (100)
0 (0)
433 (99.31)
3 (0.69)
68 (93.15)
5 (6.85)
138 (84.15)
26 (15.85)
642 (94.97)
34 (5.03)
3 (100)
0 (0)
433 (99.31)
3 (0.69)
68 (93.15)
5 (6.85)
138 (84.15)
26 (15.85)
642 (94.97)
34 (5.03)
0 (0)
3 (100)
0 (0)
436 (100)
0 (0)
73 (100)
0 (0)
164 (100)
0 (0)
676 (100)
100 (80.65)
16 (12.90)
8 (6.45)
75 (13.28)
139 (24.60)
351 (62.12)
26 (15.85)
30 (18.29)
108 (65.86)
19 (4.87)
193 (49.49)
178 (45.64)
220 (17.70)
378 (30.41)
645 (51.89)
118 (95.16)
5 (4.03)
1 (0.81)
143 (25.31)
350 (68.95)
72 (12.74)
81 (49.39)
56 (34.15)
27 (16.46)
337 (86.41)
19 (4.87)
34 (8.72)
679 (54.63)
430 (34.59)
134 (10.78)
Figures in parenthesis indicate per cent.
inferences. Among the 1243 goat keepers surveyed, the castewise distribution indicated that maximum goats keeping was
practised by scheduled tribes (45.45%) in the region followed
by general category (31.39%) and OBC (13.19% and results
Present address: 1Assistant Professor, 2 Associate Professor and
Head, 3Professor and Head, Animal Genetics and Breeding,
Veterinary College, 4Assistant Professor, Department of Animal
Sciences (4email: malikndri@gmail.com).
113
386
SABAPARA ET AL.
[Indian Journal of Animal Sciences 80 (4)
Table 2. Feeding practices followed by goat keepers.
Particulars
Grazing pattern
Semi-intensive
Extensive
Grazing duration
0–4 hrs
4–8 hrs
Green fodder feeding
Yes
No
Dry fodder feeding
Yes
No
Concentrate feeding
(A) Lactating does
Yes
No
(B)During pregnancy
Yes
No
(C) Growing kids
(I) male
Yes
No
(II) Female
Yes
No
Type of concentrate
Home made
Purchased
Mineral mixture feeding
Yes
No
Goats Keepers
SC
(n =124)
ST
(n =565)
OBC
(n =164)
Other
(n =390)
Overall
(n =1243)
00 (00)
124 (100)
00 (00)
565 (100)
98 (59.76)
66 (40.24)
248 (63.59)
142 (36.41)
346 (27.84)
897 (72.16)
00 (00)
124 (100)
00 (00)
565 (100)
98 (59.76)
66 (40.24)
248 (63.59)
142 (36.41)
346 (27.84)
897 (72.16)
124 (100)
00 (00)
560 (99.12)
05 (0.88)
152 (92.68)
12 (7.32)
376 (94.41)
14 (3.59)
1212 (97.51)
31 (2.49)
00 (00)
124 (100)
00 (00)
565 (100)
32 (19.51)
132 (80.49)
92 (23.59)
298 (76.41)
124 (9.98)
1119 (90.02)
32 (25.81)
92 (74.19)
262 (46.37)
303 (53.63)
84 (51.22)
80 (48.78)
266 (68.21)
124 (31.79)
644 (51.81)
599 (48.19)
04 (3.23)
120 (96.77)
32 (5.66)
533 (94.34)
12 (7.32)
152 (92.68)
28 (7.18)
362 (92.82)
76 (6.11)
1167 (93.89)
124 (100)
00 (00)
532 (94.16)
33 (5.84)
152 (92.68)
12 (7.32)
358 (91.79)
32 (8.21)
1166 (93.81)
77 (6.19)
22 (17.74)
102 (82.26)
84 (14.87)
481 (85.13)
16 (9.76)
148 (90.24)
48 (12.31)
342 (87.69)
170 (13.68)
1073 (86.32)
124 (100)
00 (00)
565 (100)
00 (00)
164 (100)
00 (00)
390 (100)
00 (00)
1243 (100)
00 (00)
00 (00)
124 (100)
00 (00)
565 (100)
00 (00)
164 (100)
00 (00)
390 (100)
00 (00)
1243 (100)
Figures in parentheses indicate per cen.t
of the study and least preferred by SC. The results of the
study are well supported by the findings of Tanwar et al.
(2008), reported that the goat keeping is most popular
(90.83%) among tribes of Mavli and Jhadol talukas of
Udaipur district.
Housing management: The animals 45.62% surveyed were
kept under open housing system and rest of the animals were
maintained under close housing system in the region and
among this scheduled tribes were stood on the top (77.17%)
for giving the shelter to their goats however, least shelter
(2.42%) was provided to the goats by SC (Table 1), which
indicated that the goats are the major source of livelihood
for scheduled tribes in South.
Gujarat region: Similar to the findings, Tanwar et al.
(2008) also reported same pattern tribes in the region. 95.56%
of goat keepers built kachcha type house under close housing
system and among the pacca housing system, 94.97% goat
keepers had kachcha type roof and floor. Only 5.03% of goat
keepers provided pacca floor and roof to their goats in the
category. Manger was not built in shed by any of the
respondent in south Gujarat. The common feeling is to
provide much natural comfort and conditions to the animals
by providing kachcha flooring among the goat keepers of
South Gujarat also strengthen the observation reported by
Tanwar et al. (2008) in Rajasthan.
Majority of goat keepers use bore well/hand pump or tap
water (51.89%) followed by Pond (30.41%) and well
(17.70%) as source of drinking water however, Tanwar et
al. (2008) reported that goat keepers provide pond water to
the goats for drinking purpose in Rajasthan. This difference
in the pattern of type of drinking water may be attributed to
the availability of water, as plenty of fresh water is available
in South Gujarat region. During the heavy rainfall, goat
keepers kept their goats in a Machan type houses made up
114
April 2010]
HOUSING AND FEEDING MANAGEMENTAL PRACTICES FOR GOATS IN SOUTH GUJARAT
387
Figs 1–2. Housing (Machan Type) of goats in Heavy Rainfall Zone of South Gujarat
of wooden logs and bamboo sticks to protect them from
adversity of rain (Figs 1–2). The males and females housed
separately in machan type system prevail in the south Gujarat
region however, kids are kept along with mothers. Results
of the study are corroborated with the findings of Jayashree
(2009) in heavy rainfall zone (Malnad area) of Karnataka.
Feeding management: Majority of the goat keepers follow
extensive grazing (72.16%) for 4 to 8 hrs in a day (Table 2).
Dhuppe et al. (2008) reported similar pattern of the grazing
in Sangamner Tahsil of Maharashtra. Singh and Rai (2006)
also reported same kind of the grazing pattern in the home
tract of Barbari goat. The feeding of green fodder as tree
lopping from Neem (Azadirachta indica), Tamarind
(Tamarindus indica), Goras Amli (Pithecellobium dulce),
Babul (Acasia niloticaica), Subabul (Leucaena
leucocephala), Samadi (Prosopis cineraria), Banyan tree
leaves (Ficus benghalensis L), Peepal (Ficus religigosa L),
Ber (Zizyphus rotundifolia), Kavathi (Limonoa acidissima
L.) etc. is very common and practised by 97.51% goat
keepers. Similar observations have been reported by Dixit
et al. (2007) in the breeding tract of Marwari goat of
Rajasthan and Singh et al. (2009) in the breeding tract of
Zalawadi goats in Surendranagar district of Gujarat. The
feeding of dry fodder to the goats is uncommon in the region
and practised only by 9.98% goat keepers. The concentrate
mixture comprising of bajra, jowar, wheat, tuer chuni, gram
chuni and babul pod etc. Feeding of home made concentrate
to the pregnant does practised in the region by 6.11% owners,
only however, 51.81% goat keepers fed concentrate to
lactating does for better nourishment of kids. The feeding of
concentrate is very common to the male kids (93.81%) rather
than the female kid (13.68%) for achieving the better growth
rate resulting good return. The feeding of common salt was
general practice in the area but animal holders did not provide
the mineral mixture to the goats, irrespective of the category.
Concentrate feeding was not practice by goat keepers in the
breeding tract of Zalawadi goats of Gujarat as reported by
Singh et al. (2009), which showed the variation within the
state for feeding pattern.
SUMMARY
Peculiar characteristic of goats to thrive well on zero or
minimum input system makes the goat enterprise very
popular among the artisan people and back word communities
of the South Gujarat. The managemental practice in the region
is somewhat better than the other parts of the Gujarat but not
up to the mark. Results of the study indicated that there is an
urgent need to make aware the goat keepers for the scientific
feeding as well as the housing so that the owners can achieve
maximum return from the enterprise to improve their socioeconomic status.
REFERENCES
Dhuppe S U, Shinde S B, Mote M G and Chavan K D. 2008. Study
of Management Practices of Goats in Sangamner Tahsil in
Maharashtra. Journal of Maharashtra Agricultural Universities,
33 (3): 377–80.
Dixit S P, Verma N K, Aggarwal R A K, Patel A K, Kumar
D, Sharma R and Ahlawat S P S. 2007. Phenotypic and
Genetic Characterization of Marwari Breed of Goat in Hot-Arid
Region of India. Indian Journal of Animal Sciences 77 (5):
395–99.
Jayashree R. 2009. Housing Practices Adopted for Local Goats in
Malnad Area of Karnataka. National Seminar on Goat
Biodiversity Conservation: Challenges and Opportunity held
at M.P.K.V. Rahuri (Maharashtra) during March, 20–21, 2009
pp.194.
Singh M K and Rai B. 2006. Barbari Bred of Goat: Reasons of
Dilution in its Home Tract. Indian Journal of Animal Sciences
76 (9): 716–19.
Singh M K, Rai B, Kumar A, Simaria M B and Singh N P. 2009.
Performance of Zalawadi Goats under Range Conditions. Indian
Journal of Animal Sciences 79 (1): 68–72.
Tanwar P S, Vaishnava C S and Sharma V. 2008. A Study on
Socio-economic Aspects of Goat keepers and Management
Practices Prevailed in the Tribal Area of Udaipur District
of Rajasthan. Indian Journal of Animal Research 42 (1):
17–74 .
115
388
SABAPARA ET AL.
[Indian Journal of Animal Sciences 80 (4)
The Indian Journal of Animal Sciences
ARTICLE CERTIFICATE
F.No.
Article Entitled
:
.............................................................................................................................................................
.............................................................................................................................................................
Title changed to :
.............................................................................................................................................................
.............................................................................................................................................................
Authors (names) :
.............................................................................................................................................................
.............................................................................................................................................................
It is certified that:
1. The article has been seen by all the authors (signatures given below), who are satisfied with its form and content.
2. The sequence of names of authors in the by-line is as per their relative contribution to this experiment, giving due
credit to all scientists who made notable contribution to it.
3. The address of the organization where the research was conducted is given in the by-line (changes of author’s
address is given the footnote).
4. The experiment was carried out during 200.............. and the article is submitted soon after completion of the experiment.
5. The article is exclusive for this journal, and the results reported here have not been sent (and not be sent during its
consideration by this journal) for publication in any other journal.
6. The article has not been rejected for publication in any other journal/rejected in .................................................................
whose comments are attached (such a rejection does not disqualify the article for consideration in this journal).
7. It is based/not based on a part/complete M.Sc/Ph.D thesis of the first author, who submitted the thesis in 200.........
to the ........................................................................ university, place).
8. Correct data and facts are presented in the article.
9. I/we agree to abide by the objective comments of referees and do agree to modify the article into a shortnote as per
the recommendation, for publication in The Indian Journal of Animal Sciences.
10. If published in The Indian Journal of Animal Sciences, the copyright of this article would vest with the Indian Council
of Agricultural Research who will have the right to enter into any agreement with any organization in India or abroad
engaged in reprography, photocopying, storage and dissemination of information contained in it, and neither we nor
our legal heirs will have any claims on royalty.
Signature
Name in full and designation
Present official address
Subscription
with date
number
1. .......................................................................................................................................................................................
.......................................................................................................................................................................................
2. .......................................................................................................................................................................................
.......................................................................................................................................................................................
3. .......................................................................................................................................................................................
.......................................................................................................................................................................................
4. .......................................................................................................................................................................................
.......................................................................................................................................................................................
5. .......................................................................................................................................................................................
.......................................................................................................................................................................................
OPTIONAL
The above certificate is correct to the best of my knowledge and I have no objection to the publication of the article cited
above in The Indian Journal of Animal Sciences
Signature and address of
Head of the department /Head of the Institute
116