E-book
African Journal of Biotechnology Volume 14 Number 9, 3 March, 2015 ISSN 1684-5315 ABOUT AJB The African Journal of Biotechnology (AJB) (ISSN 1684-5315) is published weekly (one volume per year) by Academic Journals. African Journal of Biotechnology (AJB), a new broad-based journal, is an open access journal that was founded on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed. Submission of Manuscript Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author Click here to Submit manuscripts online If you have any difficulty using the online submission system, kindly submit via this email ajb@academicjournals.org. With questions or concerns, please contact the Editorial Office at ajb@academicjournals.org. Editor-In-Chief Associate Editors George Nkem Ude, Ph.D Plant Breeder & Molecular Biologist Department of Natural Sciences Crawford Building, Rm 003A Bowie State University 14000 Jericho Park Road Bowie, MD 20715, USA Prof. Dr. AE Aboulata Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt 30 D, El-Karama St., Alf Maskan, P.O. Box 1567, Ain Shams, Cairo, Egypt Editor N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria Dr. S.K Das Department of Applied Chemistry and Biotechnology, University of Fukui, Japan Prof. Okoh, A. I. Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare. P/Bag X1314 Alice 5700, South Africa Dr. Ismail TURKOGLU Department of Biology Education, Education Faculty, Fırat University, Elazığ, Turkey Prof T.K.Raja, PhD FRSC (UK) Department of Biotechnology PSG COLLEGE OF TECHNOLOGY (Autonomous) (Affiliated to Anna University) Coimbatore-641004, Tamilnadu, INDIA. Dr. George Edward Mamati Horticulture Department, Jomo Kenyatta University of Agriculture and Technology, P. O. Box 62000-00200, Nairobi, Kenya. Dr. Gitonga Kenya Agricultural Research Institute, National Horticultural Research Center, P.O Box 220, Thika, Kenya. Editorial Board Prof. Sagadevan G. Mundree Department of Molecular and Cell Biology University of Cape Town Private Bag Rondebosch 7701 South Africa Dr. Martin Fregene Centro Internacional de Agricultura Tropical (CIAT) Km 17 Cali-Palmira Recta AA6713, Cali, Colombia Prof. O. A. Ogunseitan Laboratory for Molecular Ecology Department of Environmental Analysis and Design University of California, Irvine, CA 92697-7070. USA Dr. Ibrahima Ndoye UCAD, Faculte des Sciences et Techniques Departement de Biologie Vegetale BP 5005, Dakar, Senegal. Laboratoire Commun de Microbiologie IRD/ISRA/UCAD BP 1386, Dakar Dr. Bamidele A. Iwalokun Biochemistry Department Lagos State University P.M.B. 1087. Apapa – Lagos, Nigeria Dr. Jacob Hodeba Mignouna Associate Professor, Biotechnology Virginia State University Agricultural Research Station Box 9061 Petersburg, VA 23806, USA Dr. Bright Ogheneovo Agindotan Plant, Soil and Entomological Sciences Dept University of Idaho, Moscow ID 83843, USA Dr. A.P. Njukeng Département de Biologie Végétale Faculté des Sciences B.P. 67 Dschang Université de Dschang Rep. du CAMEROUN Dr. E. Olatunde Farombi Drug Metabolism and Toxicology Unit Department of Biochemistry University of Ibadan, Ibadan, Nigeria Dr. Stephen Bakiamoh Michigan Biotechnology Institute International 3900 Collins Road Lansing, MI 48909, USA Dr. N. A. Amusa Institute of Agricultural Research and Training Obafemi Awolowo University Moor Plantation, P.M.B 5029, Ibadan, Nigeria Dr. Desouky Abd-El-Haleem Environmental Biotechnology Department & Bioprocess Development Department, Genetic Engineering and Biotechnology Research Institute (GEBRI), Mubarak City for Scientific Research and Technology Applications, New Burg-Elarab City, Alexandria, Egypt. Dr. Simeon Oloni Kotchoni Department of Plant Molecular Biology Institute of Botany, Kirschallee 1, University of Bonn, D-53115 Germany. Dr. Eriola Betiku German Research Centre for Biotechnology, Biochemical Engineering Division, Mascheroder Weg 1, D-38124, Braunschweig, Germany Dr. Daniel Masiga International Centre of Insect Physiology and Ecology, Nairobi, Kenya Dr. Essam A. Zaki Genetic Engineering and Biotechnology Research Institute, GEBRI, Research Area, Borg El Arab, Post Code 21934, Alexandria Egypt Dr. Alfred Dixon International Institute of Tropical Agriculture (IITA) PMB 5320, Ibadan Oyo State, Nigeria Dr. Sankale Shompole Dept. of Microbiology, Molecular Biology and Biochemisty, University of Idaho, Moscow, ID 83844, USA. Dr. Mathew M. Abang Germplasm Program International Center for Agricultural Research in the Dry Areas (ICARDA) P.O. Box 5466, Aleppo, SYRIA. Dr. Solomon Olawale Odemuyiwa Pulmonary Research Group Department of Medicine 550 Heritage Medical Research Centre University of Alberta Edmonton Canada T6G 2S2 Prof. Anna-Maria Botha-Oberholster Plant Molecular Genetics Department of Genetics Forestry and Agricultural Biotechnology Institute Faculty of Agricultural and Natural Sciences University of Pretoria ZA-0002 Pretoria, South Africa Dr. O. U. Ezeronye Department of Biological Science Michael Okpara University of Agriculture Umudike, Abia State, Nigeria. Dr. Joseph Hounhouigan Maître de Conférence Sciences et technologies des aliments Faculté des Sciences Agronomiques Université d'Abomey-Calavi 01 BP 526 Cotonou République du Bénin Prof. Christine Rey Dept. of Molecular and Cell Biology, University of the Witwatersand, Private Bag 3, WITS 2050, Johannesburg, South Africa Dr. Kamel Ahmed Abd-Elsalam Molecular Markers Lab. (MML) Plant Pathology Research Institute (PPathRI) Agricultural Research Center, 9-Gamma St., Orman, 12619, Giza, Egypt Dr. Jones Lemchi International Institute of Tropical Agriculture (IITA) Onne, Nigeria Prof. Greg Blatch Head of Biochemistry & Senior Wellcome Trust Fellow Department of Biochemistry, Microbiology & Biotechnology Rhodes University Grahamstown 6140 South Africa Dr. Beatrice Kilel P.O Box 1413 Manassas, VA 20108 USA Dr. Jackie Hughes Research-for-Development International Institute of Tropical Agriculture (IITA) Ibadan, Nigeria Dr. Robert L. Brown Southern Regional Research Center, U.S. Department of Agriculture, Agricultural Research Service, New Orleans, LA 70179. Dr. Deborah Rayfield Physiology and Anatomy Bowie State University Department of Natural Sciences Crawford Building, Room 003C Bowie MD 20715,USA Dr. Marlene Shehata University of Ottawa Heart Institute Genetics of Cardiovascular Diseases 40 Ruskin Street K1Y-4W7, Ottawa, ON, CANADA Dr. Hany Sayed Hafez The American University in Cairo, Egypt Dr. Clement O. Adebooye Department of Plant Science Obafemi Awolowo University, Ile-Ife Nigeria Dr. Ali Demir Sezer Marmara Üniversitesi Eczacilik Fakültesi, Tibbiye cad. No: 49, 34668, Haydarpasa, Istanbul, Turkey Dr. Ali Gazanchain P.O. Box: 91735-1148, Mashhad, Iran. Dr. Anant B. Patel Centre for Cellular and Molecular Biology Uppal Road, Hyderabad 500007 India Dr. Yee-Joo TAN Department of Microbiology Yong Loo Lin School of Medicine, National University Health System (NUHS), National University of Singapore MD4, 5 Science Drive 2, Singapore 117597 Singapore Prof. Hidetaka Hori Laboratories of Food and Life Science, Graduate School of Science and Technology, Niigata University. Niigata 950-2181, Japan Prof. Thomas R. DeGregori University of Houston, Texas 77204 5019, USA Dr. Wolfgang Ernst Bernhard Jelkmann Medical Faculty, University of Lübeck, Germany Prof. Arne Elofsson Department of Biophysics and Biochemistry Bioinformatics at Stockholm University, Sweden Dr. Moktar Hamdi Department of Biochemical Engineering, Laboratory of Ecology and Microbial Technology National Institute of Applied Sciences and Technology. BP: 676. 1080, Tunisia Prof. Bahram Goliaei Departments of Biophysics and Bioinformatics Laboratory of Biophysics and Molecular Biology University of Tehran, Institute of Biochemistry and Biophysics Iran Dr. Salvador Ventura Department de Bioquímica i Biologia Molecular Institut de Biotecnologia i de Biomedicina Universitat Autònoma de Barcelona Bellaterra-08193 Spain Dr. Nora Babudri Dipartimento di Biologia cellulare e ambientale Università di Perugia Via Pascoli Italy Dr. Claudio A. Hetz Faculty of Medicine, University of Chile Independencia 1027 Santiago, Chile Dr. S. Adesola Ajayi Seed Science Laboratory Department of Plant Science Faculty of Agriculture Obafemi Awolowo University Ile-Ife 220005, Nigeria Prof. Felix Dapare Dakora Research Development and Technology Promotion Cape Peninsula University of Technology, Room 2.8 Admin. Bldg. Keizersgracht, P.O. 652, Cape Town 8000, South Africa Dr. Geremew Bultosa Department of Food Science and Post harvest Technology Haramaya University Personal Box 22, Haramaya University Campus Dire Dawa, Ethiopia Dr. José Eduardo Garcia Londrina State University Brazil Prof. Nirbhay Kumar Malaria Research Institute Department of Molecular Microbiology and Immunology Johns Hopkins Bloomberg School of Public Health E5144, 615 N. Wolfe Street Baltimore, MD 21205 Prof. M. A. Awal Department of Anatomy and Histplogy, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh Prof. Christian Zwieb Department of Molecular Biology University of Texas Health Science Center at Tyler 11937 US Highway 271 Tyler, Texas 75708-3154 USA Prof. Danilo López-Hernández Instituto de Zoología Tropical, Facultad de Ciencias, Universidad Central de Venezuela. Institute of Research for the Development (IRD), Montpellier, France Prof. Donald Arthur Cowan Department of Biotechnology, University of the Western Cape Bellville 7535 Cape Town, South Africa Dr. Ekhaise Osaro Frederick University Of Benin, Faculty of Life Science Department of Microbiology P. M. B. 1154, Benin City, Edo State, Nigeria. Dr. Luísa Maria de Sousa Mesquita Pereira IPATIMUP R. Dr. Roberto Frias, s/n 4200-465 Porto Portugal Dr. Min Lin Animal Diseases Research Institute Canadian Food Inspection Agency Ottawa, Ontario, Canada K2H 8P9 Prof. Nobuyoshi Shimizu Department of Molecular Biology, Center for Genomic Medicine Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku Tokyo 160-8582, Japan Dr. Adewunmi Babatunde Idowu Department of Biological Sciences University of Agriculture Abia Abia State, Nigeria Dr. Yifan Dai Associate Director of Research Revivicor Inc. 100 Technology Drive, Suite 414 Pittsburgh, PA 15219 USA Dr. Zhongming Zhao Department of Psychiatry, PO Box 980126, Virginia Commonwealth University School of Medicine, Richmond, VA 23298-0126, USA Prof. Giuseppe Novelli Human Genetics, Department of Biopathology, Tor Vergata University, Rome, Italy Dr. Moji Mohammadi 402-28 Upper Canada Drive Toronto, ON, M2P 1R9 (416) 512-7795 Canada Prof. Jean-Marc Sabatier Directeur de Recherche Laboratoire ERT-62 Ingénierie des Peptides à Visée Thérapeutique, Université de la Méditerranée-Ambrilia Biopharma inc., Faculté de Médecine Nord, Bd Pierre Dramard, 13916, Marseille cédex 20. France Dr. Fabian Hoti PneumoCarr Project Department of Vaccines National Public Health Institute Finland Prof. Irina-Draga Caruntu Department of Histology Gr. T. Popa University of Medicine and Pharmacy 16, Universitatii Street, Iasi, Romania Dr. Dieudonné Nwaga Soil Microbiology Laboratory, Biotechnology Center. PO Box 812, Plant Biology Department, University of Yaoundé I, Yaoundé, Cameroon Dr. Gerardo Armando Aguado-Santacruz Biotechnology CINVESTAV-Unidad Irapuato Departamento Biotecnología Km 9.6 Libramiento norte Carretera IrapuatoLeón Irapuato, Guanajuato 36500 Mexico Dr. Abdolkaim H. Chehregani Department of Biology Faculty of Science Bu-Ali Sina University Hamedan, Iran Dr. Abir Adel Saad Molecular oncology Department of Biotechnology Institute of graduate Studies and Research Alexandria University, Egypt Dr. Azizul Baten Department of Statistics Shah Jalal University of Science and Technology Sylhet-3114, Bangladesh Dr. Bayden R. Wood Australian Synchrotron Program Research Fellow and Monash Synchrotron Research Fellow Centre for Biospectroscopy School of Chemistry Monash University Wellington Rd. Clayton, 3800 Victoria, Australia Dr. G. Reza Balali Molecular Mycology and Plant Pthology Department of Biology University of Isfahan Isfahan Iran Dr. Beatrice Kilel P.O Box 1413 Manassas, VA 20108 USA Prof. H. Sunny Sun Institute of Molecular Medicine National Cheng Kung University Medical College 1 University road Tainan 70101, Taiwan Prof. Ima Nirwana Soelaiman Department of Pharmacology Faculty of Medicine Universiti Kebangsaan Malaysia Jalan Raja Muda Abdul Aziz 50300 Kuala Lumpur, Malaysia Prof. Tunde Ogunsanwo Faculty of Science, Olabisi Onabanjo University, Ago-Iwoye. Nigeria Dr. Evans C. Egwim Federal Polytechnic, Bida Science Laboratory Technology Department, PMB 55, Bida, Niger State, Nigeria Prof. George N. Goulielmos Medical School, University of Crete Voutes, 715 00 Heraklion, Crete, Greece Dr. Uttam Krishna Cadila Pharmaceuticals limited , India 1389, Tarsad Road, Dholka, Dist: Ahmedabad, Gujarat, India Prof. Mohamed Attia El-Tayeb Ibrahim Botany Department, Faculty of Science at Qena, South Valley University, Qena 83523, Egypt Dr. Nelson K. Ojijo Olang’o Department of Food Science & Technology, JKUAT P. O. Box 62000, 00200, Nairobi, Kenya Dr. Pablo Marco Veras Peixoto University of New York NYU College of Dentistry 345 E. 24th Street, New York, NY 10010 USA Prof. T E Cloete University of Pretoria Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria, South Africa Prof. Djamel Saidi Laboratoire de Physiologie de la Nutrition et de Sécurité Alimentaire Département de Biologie, Faculté des Sciences, Université d’Oran, 31000 - Algérie Algeria Dr. Tomohide Uno Department of Biofunctional chemistry, Faculty of Agriculture Nada-ku, Kobe., Hyogo, 657-8501, Japan Dr. Ulises Urzúa Faculty of Medicine, University of Chile Independencia 1027, Santiago, Chile Dr. Aritua Valentine National Agricultural Biotechnology Center, Kawanda Agricultural Research Institute (KARI) P.O. Box, 7065, Kampala, Uganda Prof. Yee-Joo Tan Institute of Molecular and Cell Biology 61 Biopolis Drive, Proteos, Singapore 138673 Singapore Prof. Viroj Wiwanitkit Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok Thailand Dr. Thomas Silou Universit of Brazzaville BP 389 Congo Prof. Burtram Clinton Fielding University of the Western Cape Western Cape, South Africa Dr. Brnčić (Brncic) Mladen Faculty of Food Technology and Biotechnology, Pierottijeva 6, 10000 Zagreb, Croatia. Dr. Meltem Sesli College of Tobacco Expertise, Turkish Republic, Celal Bayar University 45210, Akhisar, Manisa, Turkey. Dr. Idress Hamad Attitalla Omar El-Mukhtar University, Faculty of Science, Botany Department, El-Beida, Libya. Dr. Linga R. Gutha Washington State University at Prosser, 24106 N Bunn Road, Prosser WA 99350-8694. Dr Helal Ragab Moussa Bahnay, Al-bagour, Menoufia, Egypt. Dr VIPUL GOHEL DuPont Industrial Biosciences Danisco (India) Pvt Ltd 5th Floor, Block 4B, DLF Corporate Park DLF Phase III Gurgaon 122 002 Haryana (INDIA) Dr Takuji Ohyama Faculty of Agriculture, Niigata University Dr Mehdi Vasfi Marandi University of Tehran Dr FÜgen DURLU-ÖZKAYA Gazi Üniversity, Tourism Faculty, Dept. of Gastronomy and Culinary Art Dr. Reza Yari Islamic Azad University, Boroujerd Branch Dr. Sang-Han Lee Department of Food Science & Biotechnology, Kyungpook National University Daegu 702-701, Korea. Dr Zahra Tahmasebi Fard Roudehen branche, Islamic Azad University Dr. Bhaskar Dutta DoD Biotechnology High Performance Computing Software Applications Institute (BHSAI) U.S. Army Medical Research and Materiel Command 2405 Whittier Drive Frederick, MD 21702 Dr Ping ZHENG Zhejiang University, Hangzhou, China Dr. Muhammad Akram Faculty of Eastern Medicine and Surgery, Hamdard Al-Majeed College of Eastern Medicine, Hamdard University, Karachi. Prof. Pilar Morata University of Malaga Dr. M. Muruganandam Departtment of Biotechnology St. Michael College of Engineering & Technology, Kalayarkoil, India. Dr Hsiu-Chi Cheng National Cheng Kung University and Hospital. Dr. Gökhan Aydin Suleyman Demirel University, Atabey Vocational School, Isparta-Türkiye, Dr. Rajib Roychowdhury Centre for Biotechnology (CBT), Visva Bharati, West-Bengal, India. Dr Albert Magrí Giro Technological Centre Dr. Kgomotso P. Sibeko University of Pretoria Dr Greg Spear Rush University Medical Center Dr Jian Wu Harbin medical university , China Prof. Pavel Kalac University of South Bohemia, Czech Republic Dr Kürsat Korkmaz Ordu University, Faculty of Agriculture, Department of Soil Science and Plant Nutrition Dr. Shuyang Yu Department of Microbiology, University of Iowa Address: 51 newton road, 3-730B BSB bldg. Iowa City, IA, 52246, USA Dr. Binxing Li Dr. Mousavi Khaneghah College of Applied Science and TechnologyApplied Food Science, Tehran, Iran. Dr. Qing Zhou Department of Biochemistry and Molecular Biology, Oregon Health and Sciences University Portland. Dr Legesse Adane Bahiru Department of Chemistry, Jimma University, Ethiopia. Dr James John School Of Life Sciences, Pondicherry University, Kalapet, Pondicherry Instructions for Author Electronic submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial font). The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. Article Types Three types of manuscripts may be submitted: Regular articles: These should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Short Communications: A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. The style of main sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to 12 manuscript pages) in length. Reviews: Submissions of reviews and perspectives covering topics of current interest are welcome and encouraged. Reviews should be concise and no longer than 4-6 printed pages (about 12 to 18 manuscript pages). Reviews are also peer-reviewed. Review Process All manuscripts are reviewed by an editor and members of the Editorial Board or qualified outside reviewers. Authors cannot nominate reviewers. Only reviewers randomly selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. The process will be blind review. Decisions will be made as rapidly as possible, and the journal strives to return reviewers’ comments to authors as fast as possible. The editorial board will re-review manuscripts that are accepted pending revision. It is the goal of the AJFS to publish manuscripts within weeks after submission. Regular articles All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title page. The Title should be a brief phrase describing the contents of the paper. The Title Page should include the authors' full names and affiliations, the name of the corresponding author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. The Abstract should be 100 to 200 words in length.. Complete sentences, active verbs, and the third person should be used, and the abstract should be written in the past tense. Standard nomenclature should be used and abbreviations should be avoided. No literature should be cited. Following the abstract, about 3 to 10 key words that will provide indexing references should be listed. A list of non-standard Abbreviations should be added. In general, non-standard abbreviations should be used only when the full term is very long and used often. Each abbreviation should be spelled out and introduced in parentheses the first time it is used in the text. Only recommended SI units should be used. Authors should use the solidus presentation (mg/ml). Standard abbreviations (such as ATP and DNA) need not be defined. The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the proposed approach or solution. It should be understandable to colleagues from a broad range of scientific disciplines. Materials and methods should be complete enough to allow experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. Capitalize trade names and include the manufacturer's name and address. Subheadings should be used. Methods in general use need not be described in detail. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the authors' experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion, speculation and detailed interpretation of data should not be included in the Results but should be put into the Discussion section. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can include subheadings, and when appropriate, both sections can be combined. The Acknowledgments of people, grants, funds, etc should be brief. Tables should be kept to a minimum and be designed to be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes. Each table should be on a separate page, numbered consecutively in Arabic numerals and supplied with a heading and a legend. Tables should be self-explanatory without reference to the text. The details of the methods used in the experiments should preferably be described in the legend instead of in the text. The same data should not be presented in both table and graph form or repeated in the text. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Microsoft Word. Use Arabic numerals to designate figures and upper case letters for their parts (Figure 1). Begin each legend with a title and include sufficient description so that the figure is understandable without reading the text of the manuscript. Information given in legends should not be repeated in the text. References: In the text, a reference identified by means of an author‘s name should be followed by the date of the reference in parentheses. When there are more than two authors, only the first author‘s name should be mentioned, followed by ’et al‘. In the event that an author cited has had two or more works published during the same year, the reference, both in the text and in the reference list, should be identified by a lower case letter like ’a‘ and ’b‘ after the date to distinguish the works. Examples: Abayomi (2000), Agindotan et al. (2003), (Kelebeni, 1983), (Usman and Smith, 1992), (Chege, 1998; 1987a,b; Tijani, 1993,1995), (Kumasi et al., 2001) References should be listed at the end of the paper in alphabetical order. Articles in preparation or articles submitted for publication, unpublished observations, personal communications, etc. should not be included in the reference list but should only be mentioned in the article text (e.g., A. Kingori, University of Nairobi, Kenya, personal communication). Journal names are abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. Examples: Chikere CB, Omoni VT and Chikere BO (2008). Distribution of potential nosocomial pathogens in a hospital environment. Afr. J. Biotechnol. 7: 3535-3539. Moran GJ, Amii RN, Abrahamian FM, Talan DA (2005). Methicillinresistant Staphylococcus aureus in community-acquired skin infections. Emerg. Infect. Dis. 11: 928-930. Pitout JDD, Church DL, Gregson DB, Chow BL, McCracken M, Mulvey M, Laupland KB (2007). Molecular epidemiology of CTXM-producing Escherichia coli in the Calgary Health Region: emergence of CTX-M-15-producing isolates. Antimicrob. Agents Chemother. 51: 1281-1286. Pelczar JR, Harley JP, Klein DA (1993). Microbiology: Concepts and Applications. McGraw-Hill Inc., New York, pp. 591-603. Short Communications Short Communications are limited to a maximum of two figures and one table. They should present a complete study that is more limited in scope than is found in full-length papers. The items of manuscript preparation listed above apply to Short Communications with the following differences: (1) Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental procedures may be incorporated into Figure Legends and Table footnotes; (3) Results and Discussion should be combined into a single section. Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF file. Page proofs are considered to be the final version of the manuscript. With the exception of typographical or minor clerical errors, no changes will be made in the manuscript at the proof stage. Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances Copyright: © 2015, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title. Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher. Disclaimer of Warranties In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked. African Journal of Biotechnology International Journal of Medicine and Medical Sciences Table of Contents: Volume 14 Number 9, 3 March, 2015 ARTICLES Status and implementation of reproductive technologies in goats in emerging countries Aime J. Garza Arredondo, Adan González Gómez, José Fernando Vázquez-Armijo, Rogelio Alejandro Ledezma-Torres, Hugo Bernal-Barragán and Fernando Sánchez-Dávila The nutritional efficiency of Coffea spp. A review Lima Deleon Martins, Lindomar de Souza Machado, Marcelo Antonio Tomaz and José Francisco Teixeira do Amaral Recent characterization of cowpea aphid-borne mosaic virus (CABMV) in Bahia State, Brazil, suggests potential regional isolation José Romário Fernandes de Melo, Antonia dos Reis Figueira, Charles Neris Moreira and Antonio Carlos de Oliveira Validation of a reference gene for transcript analysis in cassava (Manihot esculenta Crantz) and its application in analysis of linamarase and α-hydroxynitrile lyase expression at different growth stages Sukhuman Whankaew, Supajit Sraphet, Ratchadaporn Thaikert, Opas Boonseng, Duncan R. Smith and Kanokporn Triwitayakorn Detection of MspI polymorphism and the single nucleotide polymorphism (SNP) of GH gene in camel breeds reared in Egypt Sekena H. Abd El-Aziem, Heba A.M. Abd El-Kader, Sally S. Alam and Othman E. Othman Characterization of cathelicidin gene from buffalo (Bubalus bubalis) Dhruba Jyoti Kalita Bacterial mediated amelioration of drought stress in drought tolerant and susceptible cultivars of rice (Oryza sativa L.) Yogendra Singh Gusain, U. S. Singh and A. K. Sharma Table of Contents: Volume 14 Number 9, 3 March, 2015 The efficacy of four gametocides for induction of pollen sterility in Eragrostis tef (Zucc.) Trotter Habteab Ghebrehiwot, Richard Burgdorf, Shimelis Hussein and Mark Laing Genetic diversity of sweet yam “Dioscorea dumetorum “(Kunth) Pax revealed by morphological traits in two agro-ecological zones of Cameroon Christian Siadjeu, Gabriel MahbouSomoToukam, Joseph Martin Bell and S. Nkwate Isolation and characterization of some drought-related ESTs from barley Alzahraa Radwan, Rania M. I. Abou Ali, Ahmed Nada, Wardaa Hashem, Shireen Assem and Ebtissam Husein Metabolic and biofungicidal properties of maize rhizobacteria for growth promotion and plant disease resistance Pacôme A. Noumavo, Nadège A. Agbodjato, Emma W. Gachomo, Hafiz A. Salami, Farid Baba-Moussa, Adolphe Adjanohoun, Simeon O. Kotchoni and Lamine Baba-Moussa High-level lipase production by Aspergillus candidus URM 5611 under solid state fermentation (SSF) using waste from Siagrus coronata (Martius) Becari Cyndy Mary Farias, Odacy Camilo de Souza, Minelli Albuquerque Sousa, Roberta Cruz, Oliane Maria Correia Magalhães, Érika Valente de Medeiros, Keila Aparecida Moreira and Cristina Maria de Souza-Motta Effects of cashew nut shell liquid (CNSL) component upon Aedes aegypti Lin. (Diptera: Culicidae) larvae’s midgut Ajit Kumar Passari, Vineet Kumar Mishra, Vijai Kumar Gupta and Bhim Pratap Singh In vitro dilutions of thioridaxine with potential to enhance antibiotic sensitivity in a multidrug resistant Staphylococcus aureus uropathogen Otajevwo, F. D. Vol. 14(9), pp. 719-727, 4 March, 2015 DOI: 10.5897/AJB2014.14300 Article Number: 7FCD94450949 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Review Status and implementation of reproductive technologies in goats in emerging countries Aime J. Garza Arredondo1, Adan González Gómez2, José Fernando Vázquez-Armijo3, Rogelio Alejandro Ledezma-Torres1, Hugo Bernal-Barragán2 and Fernando Sánchez-Dávila2* 1 Universidad Autónoma de Nuevo León, Facultad de Medicina Veterinaria y Zootecnia. 2 Universidad Autónoma de Nuevo León, Facultad de Agronomía, México. 3 Centro Universitario UAEM Temascaltepec, Universidad Autónoma del Estado de México. Received 3 November, 2014; Accepted 19 February, 2015 In modern cattle breeding, assisted reproductive technologies in small ruminants have been used even out-of-season breeding, but in emerging countries these technologies have been mainly used for estrous synchronization and artificial insemination. However, in the last 30 years, significant progress in the matter of transfers of in vivo derived and in vitro produced embryos has been achieved. Currently, eight donor embryos are obtained by goat, due to the physiological knowledge of the presence of dominant follicles; above alter results recovered embryos (4 embryos / donor). Whereas, the goat has the advantage of presenting a shorter interval between generations compared to cow; this promote more research in in vitro fertilization, and overcome the limitations presented in a traditional embryo transfer. However cloning and transgenesis, are two techniques that will begin to have a commercial application, because goats can be used as bioreactors to produce milk with specific proteins to develop drugs. The objective of this study was to establish and describe in a general way the use of these techniques in goats, to promote their use so as to achieve genetic improvement in goats. Key words: Reproductive technologies, goats, estrous synchronization, embryo transfer. INTRODUCTION Worldwide, goat population is predominantly distributed in tropical, subtropical and semi-desert rural areas under unfavorable nutritional conditions (Holtz, 2005; Mellado, 2008). Likewise, goats are characterized as being one of the most fertile domestic species, with up to 90% conception rate and the litter size varies from 1 to 1.5 offspring each year, depending on the breed, season and environmental conditions where it is exploited (Mellado, 2008; Cseh et al., 2012). On the other hand, the natural breeding season of breeds exploited in temperate areas is restricted to the beginning of autumn and winter, so mother goats give birth in early spring, which coincides with natural growth of vegetation (Delgadillo et al., 1999; Jackson et al., 2006). Since goats belong to the group of species subject to seasonal fluctuations and considering the different geographical areas in which they are exploited, their limited genetic improvement blends with the photoperiod effect (Delgadillo et al., 1999), the *Corresponding author. E-mail: fernando_sd3@hotmail.com. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 720 Afr. J. Biotechnol. nutritional effect (Scaramuzzi et al., 2006) and the health effect (Cseh et al., 2012), as well as sociocultural aspects of the majority of the regions in which goats are exploited and that almost 90% of goat producers have little knowledge of new technologies (Mellado, 2008). Taking into consideration the aforementioned, the application of new technologies in small ruminants has been restricted in developing countries (Chang et al., 2006; Lehloenya and Greyling, 2010; Paramio, 2010; Gama and Bressan, 2011; Guerra et al., 2011). Traditionally, transfer of in vivo produced embryos include: estrous synchronization techniques, artificial insemination, superovulation treatments and embryo implantation (Sánchez-Dávila et al., 2014). However, in countries with large goat population, the high costs of this methodology have restricted the use of these techniques in a massive way. An alternative could be to work with embryos produced in vitro, in order to be offered cheaper and shorten the generation interval used in this technique compared to the in vivo traditional technique. Since in a traditional MOET programme, the interval between generations is approximately one year, through in vitro produced embryos, this can be substantially reduced by half (5 to 6 months) and theoretically, can double the rate of genetic gain in the herd (Magalhaes et al., 2011; Amiridis and Cseh, 2012; Baldassarre, 2012). Additionally, genetic gain can be improved using sex-sorted semen; however, the use of this technology is very restricted in small ruminants compared to bovines. According to the International Embryo Transfer Society, in 2009, the number of embryos produced in vivo or in vitro for bovines and small ruminants were 842 376 and 2 086, respectively (Cseh et al., 2012). Therefore, the objective of the present study was to describe in a general way the restrictions and advantages of using assisted reproductive technologies in goats and worldwide current trends. ARTIFICIAL INSEMINATION Great part of the success of genetic improvement in goats worldwide has been the use of artificial insemination (AI) in programmes for the upgrading of goats (Ahmed et al., 2011), since this improvement is achieved by using an “improved” buck, it requires the presence of great number of superior bucks to be evaluated, selected and finally, their genetic value must be compared with reference males (Gama and Bressan, 2011; Cseh et al., 2012). For instance, in countries such as France, the systematic use of AI for genetic improvement of dairy goats, is currently part of the routine management of the exploitation. The AI technique in goats could have additional advantages by using it massively, since goat herds are geographically dispersed and they are a species subject to seasonal fluctuations. Basically, as AI technique itself, three techniques have been promoted which are already in use worldwide (Holtz, 2005; Amiridis and Cseh, 2012). The first technique is transcervical insemination, a method in which the semen is transferred into the uterus, using a rigid endoscope, a light source and an insemination gun with recommended dosage between 80 and 100 million of spermatozoids (Holtz, 2005). When artificial insemination is performed using fresh, diluted semen, conception rates can be comparable to those in natural breeding (Paramio, 2010). Conception rates of minimum 50% and as good average, 60 to 65% are reported worldwide. However, some breeds have only reached 40% (Angora breed) (Tasmedir et al., 2011). In Mexico, the extensive use of AI has been concentrated in two states: Guanajuato and Coahuila, due to governmental programmes since 2000. The results obtained in these states show an annual positive genetic trend for milk production of 2.99 ± 1.06 kg (0.32%), still far below the 1 to 2% obtained in France (Torres-Vásquez et al., 2010). In Brazil, pregnancy rates of 59% by transcervical route are reported, using fresh, diluted semen at 5°C and coconut water as diluent, mainly in dairy breeds, such as Saanen. As in other countries, different protocols for estrous synchronization have been used in Brazil, such as the use of devices between 5 and seven days, reaching pregnancy rates between 60 and 73% (Guerra et al., 2011). The second technique for AI in goats is laparoscopy, which was initially used in the 80s in sheep by a group of Australian researchers; currently, countries in South America, mainly Argentine, Brazil and Uruguay, have obtained successful results since the 90s. In general, substantial and consistent pregnancy rates have been achieved with the use of this technique in comparison with the transcervical method (Holtz, 2005). This technique requires the use of specialized equipment, which includes: a light source, optical fibre, and dedicated pipettes from global enterprises. The doe is fasted with no access to water for a minimum of 12 h before the procedure is performed. The goat is then placed in a laparoscopy cradle, positioned in a supine head-down position to an approximate angle of 45° (Cseh et al., 2012). Subsequently, a small skin incision is made 10 cm ventral to the udder on each side of the midline for introducing laparoscope and insemination pipette. A light stab action is made and one-half of the semen dose is deposited in each uterine horn at approximately 5 cm from the uterine bifurcation. In emerging countries, the use of these techniques has been directed towards evaluating the variations in time periods of AI, semen dose, sperm concentration, type of semen used (fresh, diluted, refrigerated or frozen-thawed semen), finding variable pregnancy rates ranging from 43 to 68% (Gama and Bressan, 2011; Guerra et al., 2011). The third technique developed in Germany is to expose the cervix and deposit semen in the uterine horns by Arredondo et al. transcervical route, reporting up to 71% of births compared to 51% obtained by laparoscopy (Holtz, 2005). The use of this technique has been restricted because no study has been reported. Future research should be conducted to standardize protocols for synchronization of ovulation to achieve pregnancy rates increase using IATF; and intensify research regarding male effect and achieve synchrony of estrous and inseminated at estrous observed. This is with the aim of reducing the use of hormones and produce meat and milk are free of hormones and are labeled as ethical and green. Estrous cycle control (estrous synchronization) In a simplified form, the aim of estrous synchronization is that a group of goats show a fertile estrous within a specified time period between an average of 24 and 48 h and be able to carry out breeding services, either natural breeding or AI, using one of the aforementioned techniques (Holtz, 2005; Fonseca et al., 2005; Fatet et al., 2011; Cseh et al., 2012; Amiridis and Cseh, 2012; Álvarez et al., 2013). At global level, estrous synchronization protocols developed in the major centers for goat (France) and sheep production (Australia), to later disseminate worldwide; following an important growth in Uruguay, Brazil, Argentine and Mexico, speeding up this process by beginning to use real-time ultrasonography, in order to understand and explain the follicular dynamics in small ruminants, mainly in sheep and goats (Leboeuf et al., 2000; Mellado, 2008; Menchaca et al., 2010; Guerra et al., 2011). As with the majority of countries worldwide, the protocols used are based on the use of progestogen or progesterone treatment in the form of vaginal devices (sponges/CIDR) or ear implants (Fonseca et al., 2005; Abecia et al., 2012; Vilariño et al., 2011). This hormonal manipulation can be used either out or during breeding season, by means of estrous synchronization protocols, which mainly differ in the type of device to be used, its duration, the combination of prostaglandin analogues, as well as the moment of application of hormones that induce and synchronize ovulation, such as: equine chorionic gonadotrophin (eCG), estradiol benzoate and GnRH (Menchaca and Rubianes, 2007; Menchaca et al., 2009; Modu-Bukar et al., 2012). However, the use of progestogen may cause several responses depending on the cycle phase in which treatment is initiated; for instance, during the luteal phase, follicular development speeds up, but at the same time, the number of large follicles decreases, increasing the rate of follicular atresia and supporting the persistence of large estrogenic follicles (Nava et al., 2010). During the follicular phase, the number of large follicles and ovulation rate decreases (Riaz et al., 2012). However, the use of progestogen sources during the period of sexual rest induces a form of diestrous that 721 generates normal ovarian follicle development. When the progestogen is removed, the follicles can ovulate during the season in which breeding fails, due to seasonal negative feedback action of the hormone, thus it is necessary that the gonadotropin stimulates total follicle maturation and ovulation. In each case, the use of vaginal devices increases progesterone concentration, but on the second day, it starts to decline, which physiologically alters Luteinizing Hormone (LH) secretion. Several alternatives were developed to improve the aforementioned; one of them is the substitution of the vaginal device at day seven, in comparison with the synchronization programme which traditionally substitutes the device between days 11 and 14 (Baldassarre, 2012) and also a prostaglandin F2α (PGF2α) dose is administered at the moment that the second device is removed. A second option is the use of short protocols (five to seven days) with vaginal devices, which began to develop in the 90s with satisfactory results with respect to the rate of synchronization and ovulation, either in goats or in sheep (Menchaca et al., 2007; Menchaca et al., 2010). It has been determined that short estrous synchronization protocol induces LH peak from 40 h and ovulation takes place 60 h after the completion of the progesterone treatment (Menchaca et al., 2007). When using short estrous synchronization protocols, the goats show a new wave of follicles 3.5 days after the insertion of the device, allowing that in embryo transfer programmes, the development of dominant follicles is avoided and better embryonic response will be obtained (Fonseca et al., 2013). Currently, the use of recycled CIDR has played a key role in the projection of similar results between new CIDR (62.5%), sterilized CIDR (79.5%) and CIDR placed in autoclaves (69%) with respect to pregnancy rate and estrous rate from 97.5 to 100% (Álvarez et al., 2013). Researchers in South America confirm that the use of recycled CIDR does not affect the rate of fertility and pregnancy (Vilariño et al., 2011; Oliviera et al., 2013). Another device which has been used in sheep and goat has been the implant impregnated with the potent progestogen norgestomet (Crestar), which is inserted in the middle part of the animal’s ear and one-half of the implant is usually used in goats. The use of CIDR and subcutaneous implants in goats showing poor physical development and in goats kidding for the first time, may be more comfortable in comparison to sponges that cause stress in the animals and they are very difficult to remove (Holtz, 2005; Palvenz et al., 2005; Souza et al., 2011; Penna et al., 2013). Accordingly, in the last decade, these two aspects have been modified in a vast body of scientific literature worldwide; however, the limitations of the use of synchronization protocols, short or long, because of vaginitis problems and presence of progesterone in milk, are justified by a pregnancy rate of 60% (López-Sebastián et 722 Afr. J. Biotechnol. al., 2007; Menchaca et al., 2007). Nevertheless, they have gained strength in the European Community and the marketing of this milk is still legal in our country on a large scale (Mellado, 2008). An interesting point, linked to the previous, is the use of eCG in the synchronization protocols, where the best pregnancy results are obtained (61%), compared to other sources of synchronization of ovulation, such as: estradiol benzoate (40%) and GnRH (39%) (Menchaca et al., 2007; Zarazaga et al., 2014) considering that further studies must be done to evaluate alternative sources of ovulation, as previously described. Although, it has been reported that successive use of eCG generates development of antibodies, it is still used in countries such as Mexico and South America, where pregnancy rate has not been evaluated, due to repeated use of eCG in goat herds. Other synchronization protocols have been use based on the use of prostaglandin F2α analogues (cloprostenol, dinoprost tromethamine), which are potent luteolytic agents and can be used during breeding season as an alternative for estrous synchronization. It has been reported that PGF2α effectivity is limited between day 3 and 14 of the estrous cycle and affects the time of LH peak and subsequent ovulation (Holtz, 2005). Another way to use PGF2α is to combine it with the male effect and a source of progesterone (López-Sebastián et al., 2007), where the treatment involves administering 25 mg of progesterone in olive oil by intramuscular route at the moment of introducing the male, followed by a dose of 75 µg of cloprostenol by intramuscular route, seven days after exposing the male to the females. Based on this synchronization protocol, a pregnancy rate of 65% is achieved, compared to the traditional protocols of vaginal device and the use of eCG at a dose of 350 IU (47%). Other protocols that have been used in bovines, such as the ovsynch protocol, which is based on the administration of two doses of GnRH at intervals of 9 days and PGF2α is applied two days before the second administration of GnRH; this protocol is based on the fact that the first GnRH injection in the presence of a large follicle triggers ovulation and the formation of corpus luteum, considering that the administration of PGF2α will destroy both, the natural developed corpus luteum and the one developed by the first GnRH injection, so that the second GnRH injection triggers ovulation (Holtz et al., 2008). With the previous protocol, great synchronization of preovulatory LH peak can be achieved and pregnancy rates of 58% are obtained (Holtz et al., 2008). Other natural techniques or so called sustainable are those related to the combined use of photoperiod, male effect and nutritional supplementation, for establishing alternative strategies and breeding management to the use of drugs (hormones) previously described. Although, the male effect has been known in sheep and in goats, groups of researchers are working strongly to be able to use the male effect in a more efficient way without the need of hormones. For instance, in sheep and in goats, the presence of short cycles is not uncommon when a male is introduced to a group of anoestrus females; however, a way to avoid it is to administer a dose of progesterone at the moment the male is introduced. Nevertheless, this methodology contrasts the use of hormonal products with the use of clean, green and ethical methods promoted by groups of researchers (Delgadillo et al., 2012). Since the 90’s, the interest to determine the photoperiod is determinant for at least in some regions of seasonal anoestrus in goats and low libido in bucks (Pellicer-Rubio et al., 2008; Delgadillo et al., 2012), has led to use strategies for activating the male through light programmes that regulate the photoperiod of males, in such a way that they must be activated in the anoestrus season and be able of inducing estrous in the anoestrus goat (Delgadillo et al., 2012), as well as the use of females in heat (Rodríguez-Martínez et al., 2013) or males treated with testosterone (Véliz et al., 2013). However, it has been demonstrated that as unique effect it can be affected by the male itself, varying or affecting age, breed, physical condition, forms of grouping, experience of itself, as well as hierarchy. On the other hand, the doe plays an important role in its response at the moment the buck is introduced, behaving differently according to the stage of anoestrus and breeding season, whereas during breeding season the effect could be minor, due to high progesterone levels and during the anoestrus season, the goat gets excited as soon as the male is introduced and the effect shows up because of an increase in LH (Delgadillo et al., 2012). In the breeding season, the male effect has better LH release output patterns when the goats are in the early and late luteal phase and not in the middle luteal phase; whereas high levels of progesterone inhibit further output of LH (Martínez-Álvarez et al., 2007). On the other hand, previous isolation of the male is conditioned even in goats, which is currently determined that this is not a necessary thing to do, because being separated from the male or remaining in contact makes no difference in goats (Delgadillo et al., 2012). The male effect may increase breeding efficiency in goats and the behavioural signs of estrous increase in goats exposed to bucks (Prado et al., 2003). For instance, when goats are artificially inseminated, sterile service by using a vasectomized buck may reduce the time duration of estrous, increasing the rate of conception. The presence of the buck after removing the progestin or after the second injection of prostaglandin in synchronized goats reduces the time of pessary withdrawal or injection of prostaglandin for initiating estrous. The male effect incorporates each aspect of a clean, green and ethical animal production. It does not need the use of exogenous hormones, has no negative effect in the environment and optimizes animal welfare; additionally, animals do not need to be handled or manipulated Arredondo et al. at some moment to previous breeding. However, there are male effect limitations that restrict its deve-lopment as a reliable, repeatable and flexible tool that can be used in different breeds, seasons and latitudes. Consequently, it is proposed that the challenge for today’s scientists is not only to find solutions to problems, but also understand when and why they happen. Future research should be directed to combine the use of hormones and the male effect. It requires conducting research that achieve standardized protocols synchroni-zation of ovulation. Intensify the use of short estrous synchronization protocols to make them more econo-mical, less time use of hormones and equal or better results than long estrous synchronization protocols. Semen processing In comparison with bovines, semen processing and its market in emerging countries, has been restricted, among other reasons, due to lack of adequate knowledge about the use of the insemination technique, where goat producers prefer to have higher pregnancy rates by natural breeding, instead of using goat semen genetically evaluated (Mara et al., 2007) whereas currently, purebred seed stock producers still rely on the importation of semen from European countries (France, Spain) and from the United States of America and Canada. Today, studies are focused on trying to improve the results of mass motility, progressive motility, abnormalities, live sperms, acrosomal disruption, among other goat semen variables (Mellado et al., 2006; Mainga et al., 2010). Now, studies have been conducted to efficiently use the egg yolk (Salmani et al., 2014) under different concentrations, used as an antioxidant (Ahmed et al., 2011) and alternative use of non-animal origin sources (soy milk) (Khalifa and El-Saidy, 2006; Salmani et al., 2014). Alternatively, different times and temperatures of semen storage have been evaluated (Paulenz et al., 2005; Islam et al., 2006; Salvador et al., 2006; Nainga et al., 2010), as well as its wash and centrifugation for seminal plasma removal (Sariozkan et al., 2010). Likewise, it has been found that in the use of enzymes, such as arginine, an enzyme of the urea cycle, which has two isoforms of mammalian arginase (types I and II), type II plays an important role in the synthesis of polyamines and through the parameter of seminal plasma activity of arginase, there is a high correlation between sperm motility and sperm concentration (Turk et al., 2011). All the aforementioned has been carried out with the aim to avoid one of the biggest problems that goat semen has, such as presence of the coagulating enzyme of the egg yolk, which is secreted by bulbourethral glands and reacts upon contact with the egg yolk and hydrolyzes lecithin into fatty acids and spermicidal lysolecithin (Cseh et al., 2012). Likewise, the secretion of bulbourethral 723 glands has a toxic reaction with milk; this effect has been identified as a lipase (glycoprotein), where this enzyme hydrolyzes trioline and triglycerides into free fatty acids, which decrease sperm motility and harm the sperm acrosomal membrane (Shia et al., 2010). The use of frozen semen overcomes farm dispersion problems, enhancing the more accurate genetic evaluation of animals. However, the success of AI with frozen–thawed semen is lower than with fresh or cooled semen or that achieved by natural service. In Alpine and Saanen breeds, Guerra et al. (2011) observed a kidding rate of 75 and 44% for fresh and frozen semen, respectively. Overall, AI fertility rates with frozen–thawed semen vary from 40 to 60%, and seem to be highly affected by factors such as season, farm (Ahmed et al., 2011; Cseh and Amiridis, 2012), reproductive status of female (Leboeuf et al., 2000), and site of semen deposition (Paulenz et al., 2005). Transfer of in vivo and in vitro produced embryos Embryo transfer (ET) consists in administering high doses of follicle-stimulating hormone (FSH) of porcine or ovine origin, with the aim to obtain maximum follicular growth, which develops to the preovulatory follicle stage (González-Bulnes et al., 2004; Baldassarre, 2012). According to classic protocols of superovulation, follicular population starts to modify between 12 and 24 h after the administration of the first FSH dose (Sánchez et al., 2013). These changes in follicular population are associated with an increase in the total number of large follicles or equal to 2 mm, which grow to 5 mm in diameter in 12 to 48 h, reaching the preovulatory stage at 48 to 60 h (González-Bulnes et al., 2004). Although, the follicular growth pattern varies according to the FSH formulation and the administration protocol, the ovulatory follicles obtained as result of different protocols of superovulation are characterized by being smaller than the ovulatory follicles of non-stimulated, natural cycles (with gonadotropins) (Driancourt et al., 1991; Baldassarre, 2012; Melican and Gavin, 2008). This decrease in the size of ovulatory follicles has also been observed during natural cycles in all sheep breeds considered prolific, such as: Romanov, Booroola Merino and Chios (Paramio, 2010). The FSH presents a short half-life; consequently, its effect on growth and estradiol production is maintained during shorter periods of time, this is why it has to be frequently administered (González-Bulnes et al., 2004; Baldassarre, 2012). FSH-superovulated goats present lower incidence of premature regression of corpus luteum in comparison with other treatments, such as eCG, that also causes luteolysis, due to FSH effect on estradiol secretion. Therefore, after ovulation, its residual effect is low and its effect declines on the production of estradiol, 724 Afr. J. Biotechnol. thus triggering, in smaller number of cases, the cascade of events that lead to prostaglandin F2α secretion (González-Bulnes et al., 2004). FSH superovulation protocols have indeed the disadvantage in that the hormone has to be frequently administered, due to the similarity of physiological secretion pattern of FSH during the follicular stage of the goat and the heterogeneous response of animals to treatment, mainly because of limiting factors, both extrinsic (origin, purity and protocol of gonadotropin administration) and intrinsic (breed, age, and nutritional and reproductive status), of the animal (Melican and Gavin, 2008; Menchaca et al., 2010). An average of six to eight transferable embryos per donor can be produced in a successful goat MOET program (Baril et al., 1993; Cognié, 1999; Cognié et al., 2003). These results, however, depend on many factors (including breed, age and nutrition) that contribute to the high variability. It is common for the number of transferable embryos to range from 0 to 30 per donor with 25 to 50% of the donors failing to produce any transferable embryos due to fertilization failure and early regression of corpora lutea (González-Bulnes et al., 2004; Lehloenya et al., 2008; Baldasarre, 2012). Multiple ovulation and embryo transfer in small ruminants in many countries are restricted to the breeding season, due to seasonal cyclic activity (Delgadillo et al., 2012). For instance, in South Africa, it has been reported that Boer goats show maximum sexual activity in autumn and minimum activity in spring (Lehloenya and Greyling, 2010). This coincides with González-Bulnes et al. (2004), who report that certain goat breeds manifest the highest ovulation rate and embryo performance during the breeding season and that the minimum ovulation rate, as well as embryo performance are recorded in the anoestrus period; however, Lehloenya et al. (2008) and Sánchez-Dávila et al. (2004), found that multiple ovulation is independent of the breeding and nonbreeding season in Boer and dairy goats. However, currently, attempts have been made for changing the strategies of embryo collection, intensifying the attempts to avoid laparotomy and consequently, increase the reproductive life of donors with high genetic potential. For instance, Fonseca et al. (2013) have evaluated the nonsurgical technique along with short protocols of estrus synchronization, with promising results for applying this technique worldwide; where they found that the percentage of recovery by wash medium was higher than 90% and 13.4 ± 4.1 of embryos recovered per female donor. On the other hand, in vitro embryo production has been developed a little bit more constantly in small ruminants, but more in sheep than in goats (Sánchez et al., 2013). This technology requires specific manipulations, such as: collection and maturation of oocytes, fertilization and development of zygotes, and embryos already developed are frozen or fresh transferred (Amirdis and Cseh, 2012). However, still today, the fact that embryos produced in vivo are generally of higher quality than embryos produced in vitro, due to their high implantation rate and to better freezing tolerance (Baldassarre, 2012). Today, still research purposes, oocytes are routinely collected from slaughtered females. After removing their ovaries and observing the presence of certain size of follicles, oocytes are aspirated from each one of the follicles with sterile syringes. Conversely, it can be done in live animals by laparotomy, which is used less often, or by laparoscopy. This collection can be preceded by FSH or eCG administration for ovarian stimulation or by nonstimulated animals. It has been reported that aspiration of available follicles decreases in time, taking into consideration that gonadotropin dose, time of aspiration with respect to stimulation, aspiration pressure and the donor, are more determinant factors in cumulus-oocyte complex recovery rate. Likewise, it is mentioned that oocyte collection can be carried out both during breeding season and non-breeding season; considering that in the latter, melatonin implants can be used to improve the number of available follicles and oocyte development (Holtz, 2005; Baldassarre, 2012) then, comes maturation process (Amiridis and Cseh, 2012). There have been great changes in the development of oocytes by using temperatures of 38 to 39°C for 24 h in a humid atmosphere with 5% of CO2; from then on, oocytes exhibit the first polar body and metaphase II stage is completed. The most commonly used maturation medium is TCM-199 supplemented with pyruvate, inactive serum and hormones (FSH and LH); what is more, if it is used in combination with estrogens and FSH, blastocyst formation rate is improved. Currently, the combination of growth hormone and ICF-I at a rate of one dose of 100 ng/ml in the maturation medium has been used for obtaining a more uniform maturation of oocytes. Likewise, the inclusion of follicular fluid from non-atrestic follicles or from goats treated with gonadotropin in the maturation medium, may have some beneficial effect on oocyte in vitro maturation, because the follicular fluid contains a number of peptides, steroids and growth factors (Paramio, 2010, Tasdemir et al., 2011; Amiridis and Cseh, 2012). Oocytes with development capacity can be selected from ovaries of slaughtered goats. Between 1,5 and 2,1 oocytes per ovary are obtained by aspiration or dissection of follicles. Additionally, cumulus-oocyte complex (COC) recovery by cutting the ovary is a simple and more efficient technique in comparison with aspiration and perforation methods. Follicles larger than 3 mm have more cumulus layers and show a better in vitro maturation, circumstances to be taken into account for selecting oocytes at the end of the growth stage. Oocytes from large follicles (> 5 mm in diameter) generate greater number of blastocysts than medium-small follicles (< 5 mm in diameter). An average of 9 COC are obtained per Arredondo et al. ovary after preparing the goats with FSH. Oocyte collection by aspiration under laparoscopic observation of anatomic structures of genetically superior goats, allows the recovery after FSH priming of 3-4 COC per ovary. The effects of medium supplementation using glucoproteins (LH, FSH, hCG and TSH) during in vitro maturation of goat oocytes, show that these hormones are required for successful development of oocytes in AI. TRANSGENESIS This technique has been considered the great hope of the human being, because great quantities of catalytic proteins can be produced. These have great effect on certain human diseases, such as the human stimulating factor of granulocyte colonies. The objective of this technique is to manipulate the DNA of an individual so that it expresses its genetic potential and the production of proteins at large scale can be achieved, since they are of great benefit to human health and pharmaceutical industry. Unlike bovines, the goat is an excellent model for transgenesis worldwide (Paramio, 2014). Also, they are potentially ideal bioreactor animals for producing great quantities of recombinant proteins of pharmaceutical use (Guerra et al., 2011), taking into consideration that just as in bovines, there is great loss of embryos when using this technique, but the great advantage of goats is that there is a very low percentage of placental retention, respiratory/cardiovascular dysfunction, abnormal postnatal development and postnatal losses (quotation). Additionally, goats are an important source of recombinant protein production, reaching 1 to 5 g/litre of milk produced by transgenic animals. In herds of transgenic animals, the production rate reaches 300 kg of this purified product per year (quotation). The methodology of animal cloning employing the technique used in the creation of the first transgenic animal “Dolly”, is still inefficient, even more in bovines, where perinatal losses are high, reaching 63% in the first three months of age of calves created by the protocol of somatic cell nuclear transfer (quotation). Considering that today, only recombinant human antithrombin III, produced by the European Community, is commercially manufactured (quotation). FINAL CONSIDERATIONS With respect to first-generation technology, as the case of estrous and ovulation synchronization, and AI, instead of standardizing the protocols of both techniques, they should be focused on their intensive use to increase the number of offspring as product of AI, using genetically outstanding bucks. In relation to semen, it is necessary to conduct further studies in strengthening acrosomal integrity, as well as to begin to use sex-sorted semen and 725 process it without egg yolk, with the aim to export it without having health problems. With regard to embryo transfer, further studies should be carried out to improve embryo collection by avoiding, blocking or eliminating presence of dominant follicles, as well as to improve and disseminate nonsurgical technologies for obtaining more embryos from female donors during their reproductive life; whereas the tendency is to eliminate laparotomy method. Likewise, in vitro fertilization should be developed in emerging countries to achieve greater short-term genetic advance. However, the use of transgenesis is still restricted in this species, mainly due to cost-benefit of production. Based on the fact that assisted reproductive technologies aforementioned, must reach the field level in goat production systems for improving production and reproductive performance of goat herds. Conflict of interest The authors did not declare any conflict of interest. ACKNOWLEDGEMENTS Special thanks to the Department of Agronomy, Universidad Autónoma de Nuevo León (UANL). REFERENCES Abecia JA, Forcada F, and González-Bulnes A (2012). Hormonal control of reproduction in small ruminants. Anim. Reprod. Sci. 130:173-179. Ahmed M, Wahida H, Rosnina Y, Gohb YM, Ebrahimib M, Nadiac FM, Audreyc G (2011). Effect of butylated hydroxytoluene on cryopreservation of Boer goat semen in Tris egg yolk extender. Anim. Repr. Sci. 129:44-49. Alvarez L, Gamboa D, Zarco L, Ungerfeld R (2013). Response to the buck effect in goats primed with CIDRs, previously used CIDRs, or previously used autoclaved CIDRs during the non-breeding season. Liv. Sci. 155:459-462. Amiridis GS and Cseh S (2012). Assisted reproductive technologies in the reproductive management of small ruminants. Anim. Repr. Sci. 130:152-161. Baldasarre H (2012). Practical aspects for implementing in vitro embryo production and cloning programs in sheep and goats. Anim. Reprod. 9:188-194. Chang Z, Fan ML, Wu-Tan J (2006). Factors affecting superovulation and embryo transfer in Boer goats. Asian Austr. J. Anim. Sci. 19:341346. Cseh S, Faigl V, Amiridis GS (2012). Semen processing and artificial insemination in health management of small ruminants. Anim. Repr. Sci. 130:187-192. Delgadillo JA, Cañedo GA, Chemineau P, Guillaume D, Malpaux B (1999). Evidence for an annual reproductive rhythm independent of food availability in male creole goats in subtropical northern Mexico. Theriogenology 52:727-737. Delgadillo JA, Duarte G, Flores JA, Vielma J, Hernández H, FitzRodriguez G, Bedos M, Graciela Fernández I, Muñoz-Gutiérrez M, Retana-Márquez MS, Keller M (2012). Control of the sexual activity of goats without exogenous hormones: use of photoperiod, male effect and nutrition. Trop. Subtrop. Agroecos. 15:15-27. Driancourt MA, Webb R, Fry RC (1991). Does follicular dominance occur in ewes? J. Reprod. Fert. 93:63-70. 726 Afr. J. Biotechnol. Fatet A, Pellicer-Rubio MA, Leboeuf B (2011). Reproductive cycle of goats. Anim. Reprod. Sci. 124:211-219. Fonseca JF, Bruschi JH, Santos ICC, Viana JHM, Maagalhaes ACM (2005). Induction of estrus in non lactating dairy goats with diferente estrous synchrony protocols. Anim. Repr. Sci. 85:117-124. Fonseca JF, Zambrini FN, Alvim GP, Peixoto MGD, Verneque RS, Viana JHM (2013). Embryo production and recovery in goats by nonsurgical transcervical technique. Small Rum. Res. 111:96-99. Gama LT, Bressan MC (2011). Biotechnology applications for the sustainable management of goat genetic resources. Small Rum. Res. 98:133-146. Gonzalez-Bulnes A, Baird DT, Campbell BK, Cocero MJ, García-García RM, Inskeep EK, Lopez-Sebastian A, McNeilly AS, Santiago-Moreno J, Souza CJH, Veiga-Lopez A (2004). Multiple factors affecting the efficiency of multiple ovulation and embryo transfer in sheep and goats. Repr. Fert. and Dev. 16:421-435. Guerra MMP, Silva SV, Batista AM, Coleto ZF, Silva ECB, Monteiro Jr. PLJ, Carneiro GF (2011). Goat reproductive biotechnology in Brazil. Small Rum. Res. 98:157-163. Holtz W (2005). Recent developments in assited reproduction in goats. Small Rum. Res. 60:95-110. Holtz W, Sohnrey B, Gerland M, Driancourt MA (2008). Ovsynch synchronization and fixed time insemination in goats. Theriogenology 69:785-797. Islam R, Ahmed K, Deka BC (2006). Effect of holding and washing on the quality of goat semen. Small Rum. Res. 66:51-57. Jackson DJ, Fletcher CM, Keisler DH, Whitley NC (2006). Effect of melengesterol acetate (MGA) treatment or temporary kid removal on reproductive efficiency in meat goats. Small Rum. Res. 66:253-257. Khalifa TAA and El-Saidy BE (2006). Pellet-freezing of Damascus goat semen in a chemically defined extender. Anim. Repr. Sci. 93:303315. Konyali C, Tomas C, Blanch E, Gomez EA, Graham JK, Moce E (2013). Optimizing conditions for treating goat semen with cholesterol-loaded cyclodextrins prior to freezing to improve cryosurvival. Cryobiology 67:124-131. Leboeuf B, Restall B, Salamon S (2000). Production and storage of goat semen for artificial insemination. Anim. Repr. Sci. 62:113-141. Lehloenya KC, Greyling JP. (2010). The ovarian response and embryo recovery rate in Boer goat does following different superovulation protocols, during the breeding season, Small Rum. Res. 88:38-43. Lehloenya KC, Greyling JPC, Grobler S (2008). Effect of season on the superovulatory response in Boer goat does. Small Rum. Res. 78:7479. López-Sebastian A, González-Bulnes A, Carrizosa JA, Urrutia B, DíasDelfa C, Santiago-Moreno J, Gómez-Brunet A (2007). New estrus synchronization and artificial insemination protocol for goats base on male exposure, progesterone and cloprostenol during the nonbreeding season. Theriogenology 68:1081-1087. Magalhaes DM, Duarte ABG, Araujo VR, Brito IR, Soares TG, Lima IMT, Lopes CAP, Campello CC, Rodrigues APR, Figueiredo JR (2011). In vitro production of a caprine embryo from a preantral follicle cultured in media supplemented with growth hormone. Theriogenology 75:182-188. Mara L, Dattena M, Pilichi S, Sanna D, Branca A, Cappai P (2007). Effect of different diluents on goat semen fertility. Anim. Reprod. Sci. 102:152-157. Martínez-Álvarez LE, Hernández-Cerón J, González-Padilla E, PereraMarín G, Valencia J (2007). Serum LH peak and ovulation following synchronized estrus in goats. Small Rum. Res. 69:124-128. Melican D and Gavin W (2008). Repeat superovulation, non-surgical embryo recovery, and surgical embryo transfer in transgenic dairy goats. Theriogenology 69: 197-203. Mellado M (2008). Técnicas para el manejo reproductivo de las cabras en agostadero, Trop Subtrop Agroecos. 9:47-63. Mellado M, Pastora F, Lopez R, Rios F (2006). Relation between semen quality and rangeland diets of mixed-breed male goats. J. of Arid Env. 66:727-737. Menchaca A, Miller V, Salveraglio V, Rubianes, E (2007). Endocrine, luteal and follicular responses after the use of the short-term protocol to synchronize ovulation in goats. Anim. Repr. Sci. 102:76-87. Menchaca A and Rubianes E (2007). Pregnancy rate obtained with short-term protocol for timed artificial insemination in goats. Repr. Dom. Anim. 42:590-593. Menchaca A, Vilariño M, Crispo M, de Castro T, Rubianes E (2010). Menchaca A, Vilariño M, Pinczak A, Kmaid S, Saldaña JM (2009). Progesterone treatment, FSH plus eCG, GnRH administration and Day 0 protocol for MOET programs in sheep. Theriogenology 72:477483. Modu-Bukar M, Yusoff R, Haron AW, Dhaliwal GK, Goriman-Khan MA, Ariff OM (2012). Estrus response and folicular development in Boer does synchronized with flugestone acetate and PGF2α or their combination with eCG or FSH. Trop. Anim. Health and Prod. 44:1505-1511. Nainga SW, Wahida H, Mohd Azamc K, Rosninaa Y, Zukib AB, Kazhala S, Bukara MM, Theind M, Kyawe T, San MM (2010). Effect of sugars on characteristics of Boer goat semen after Cryopreservation. Anim. Repr. Sci. 122: 23-28. Nava TH, Chango VJ, Finol PG, Torres RP, Carrillo FF, Maldonado SJ, Gil HL, Adamou A (2010). Efecto de la dosis de eCG sobre la inducción del celo en cabras mestizas luego de un tratamiento cortó con Medroxiprogesterona. Rev. Cient. FCV-LUZ 20:181-183. New approaches to superovulation and embryo transfer in small ruminants. Repr. Fert. and Dev. 22:113-118. Oliveira JK, Martins G, Esteves JV, Penna B, Hamond C, Fonseca JF, Rodrigues AL, Brandao FZ, Lilenbaum W (2013). Changes in the vaginal flora of goats following a short-term protocol of oestrus induction and synchronisation with intravaginal sponges as well as their antimicrobial sensivity. Small Rum. Res. 113:162-166. Paramio MT (2010). In vivo and in vitro embryo production in goats. Small Rum. Res. 89:144-148. Paramio, MT and Izquierdo, D (2014). Assisted reproduction technologies in goats. Small Rum. Res. 121:21-26. Paulenz H, Soderquistc L, Adnøyd T, Soltund K, Sæthere PA, Fjellsøye KR, Andersen- Berg K (2005). Effect of cervical and vaginal insemination with liquid semen stored at room temperatura on fertility of goats. Anim. Repr. Sci. 86:109-117. Pellicer-Rubio MT, Leboeuf B, Bernelas D, Forgerit Y, Pougnard JL, Bonné JL, Senty E, Breton S, Brun F, Chemineau P (2008). High fertility using artifitial insemination during deep anoestrus after induction and synchronisation of ovulatory activity by the “male effect” in lactating goats subjected to treatment with artificial long days and progestagens. Anim. Repr. Sci. 109:172-188. Penna B, Libonati H, Director A, Sarzedas AC, Martins G, Brandao FZ, Fonseca J, Lilenbaum W (2013). Progestin-impregnated intravaginal sponges for estrus induction and synchronization influences on goats vaginal flora and antimicrobial susceptibility. Anim. Repr. Sci. 142:7174. Prado V, Orihuela A, Lozano S, Isabel Pérez-León I (2003). Effect on ejaculatory performance and semen parameters of sexually-satiated male goats (Capra hircus) after changing the stimulus female. Theriogenology. 60: 261–267. Riaz H, Sattar A, Arshad MA, Ahmad N (2012). Effect of synchronization protocols and GnRH treatment on the reproductive performance in goats. Small Rum. Res. 104:151-155. Rodriguez-Martínez R, Angel-García O, Guillen-Muñoz JM, RoblesTrillo PA, De Santiago-Miramontes M de los A, Meza-Herrera CA, Mellado M, Véliz FG (2013). Estrus induction in anestrus mixed breed goats using the “female-to female effect”. Trop. Anim. Health Prod. 45: 911-915. Salmani H, Towhidi A, Zhandi M, Bahreini M, Mohsen Sharafi M (2014). Sánchez F, Bernal H, del Bosque A, González A, Olivares E, Padilla G, Ledezma R (2013). Superovulation and embryo quality with pFSH in Katahdin hair sheep during breeding season. A. J. Agr. Res. 8:29772982. Sánchez-Dávila F, Ledezma-Torres, RA, Padilla-Rivas G, del BosqueGonzález AS, González-Gómez A, Bernal-Barragán H (2014). Effect of three levels of pFSH on superovulation and embryo quality in goats during two breeding seasons in Northeastern Mexico. Reprod. Dom. Anim. 49:40-43. Arredondo et al. In vitro assessment of soybean lecithin and egg yolk based diluents for cryopreservation of goat semen. Cryobiol. 68:276-280. Salvador I, Yániz J, Viudes-de-Castro MP, Gómez EA, Silvestre MA (2006). Effect of solid storage on caprine semen conservation at 5°C. Theriogenology 66:974-981. Sarıozkan S, Bucak MN, Tuncer PB, Tas¸demir U, Kinet H, Ulutas PA (2010). Effects of different extenders and centrifugation/washing on postthaw microscopic-oxidative stress parameters and fertilizing ability of Angora buck sperm. Theriogenology 73:316-323. Scaramuzzi RJS, Bruce KC, Jeff AD, Nigel RK, Muhammad K, Minerva MG, Anongnart S (2006). A review of the effects of supplementary nutrition in the ewe on the concentrations of reproductive and metabolic hormones and the mechanisms that regulate folliculogenesis and ovulation rate. Repr. Nutr. Dev. 46:339-354. Shia L, Zhang Ch, Yuea W, Shi L, Zhua X, Lei F (2010). Short-term effect of dietary selenium-enriched yeast on semen parameters, antioxidant status and Se concentration in goat seminal plasma. Anim. Feed Sci. Tech. 157:104-108. Souza JMG, Torres CAA, Maia ALRS, Brandao FZ, Brushi, JH, Viana JHM (2011). Autoclaved, previously used intravaginal progesterone devices induces estrus and ovulation in anestrus Toggenburg goats. Anim. Repr. Sci. 129:50-55. Tasdemir U, Reha AA, Kaymaz M, Karakas K (2011). Ovarian response and embryo yield of Angora and Lilis goats given the day 0 protocol for superovulation in the non-breeding season. Trop. Anim. Health Prod. 43:1035-1038. Torres–Vázquez, J.A., Valencia–Posadas, M., Héctor Castillo–Juárez, H., Montaldo, H.H. 2010. Tendencias genéticas y fenotípicas para características de producción y composición de la leche en cabras Saanen de México. Rev. mex. de cienc. pecuarias 1:337-348. 727 Turk G, Gur S, Mehmet-Kandemir F, Sonmez M (2011). Relationship between seminal plasma arginase activity and semen quality in Saanen bucks. Small Rum. Res. 97:83-87. Véliz FG, Meza-Herrera CA, De Santiago-Miramontes MA, ArellanoRodriguez G, Leyva C, Rivas-Muñoz R, Mellado M (2009). Effect of parity and progesterone priming on induction of reproductive function in Saanen goats by buck exposure. Liv. Sci. 125:261-265. Vilariño M, Rubianes E, Menchaca A (2011). Re-use of intravaginal progesterone devices associated with the Short-term Protocol for timed artificial insemination in goats. Theriogenology. 75: 1195-1200. Zarazaga LA, Gatica MC, Gallego-Calvo L, Celi I, Guzmán JL (2014). The timing of oestrus the provulatory LH surge and ovulation in Blanca Andaluza goats synchronised by intravaginal progestagen sponge treatment is modified by season but not by body condition score. Anim. Reprod. Sci. Article in Press. Vol. 14(9), pp. 728-734, 4 March, 2015 DOI: 10.5897/AJB2014.14254 Article Number: CE4882A50950 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Review The nutritional efficiency of Coffea spp. A review Lima Deleon Martins1*, Lindomar de Souza Machado1, Marcelo Antonio Tomaz1 and José Francisco Teixeira do Amaral2 1 Department Produção Vegetal, Centro de Ciências Agrárias, Univ. Federal do Espírito Santo (CCA/Ufes), Post Office Box 16, 29500-000, Alegre, ES, Brazil. 2 Department Engenharia Rural, Centro de Ciências Agrárias, University Federal do Espírito Santo (CCA/Ufes), PostOffice Box 16, 29500-0 00, Alegre, ES, Brazil. Received 18 October, 2014; Accepted 16 February, 2015 Reduced soil fertility has been surpassed by the supply of mineral nutrients, which results in increased rates of plant production and costs. In this context, the optimization of plants’ nutritional efficiency is critical to increase productivity and reduce the cost of agricultural production systems. The nutritional efficiency of plants is conditioned by numerous factors and the growing environment. Therefore, the knowledge of genetic basis and mode of inheritance can assist in selecting genotypes with desirable agronomic characteristics coupled with nutritional efficiency and genetic variability. The trend of expanding agricultural frontiers has increased interest in the use of genotypes with the potential to adapt to adverse conditions of soil fertility. Within crops, the coffee beans are the second most traded commodity in the world. In this sense, optimization of nutritional efficiency of the coffee has a positive impact on the sum of efforts to make sustainable activity. This review aimed to present a systematic analysis of the nutritional efficiency of the coffee. Key words: Nutrient absorption and utilization, root length, genetic variability. INTRODUCTION In the world, coffee is grown in about 80 countries. It is the second most traded commodity in the world after oil, generating approximately U$ 90,000 million per year and involves about 500 million people in its management from cultivation to final product for consumption. The genus Coffea comprises more than 100 species, with particular relevance to Coffea arabica L. and Coffea canephora Pierre ex Froehner, which together are responsible for about 99% of the production of coffee beans in the world (DaMatta and Ramalho, 2006; Ramalho et al., 2013; Martins et al., 2014). Based on global demand, there must be awareness of farmers for the activity to be more sustainable, without harming the environment while ensuring a better quality of life for future generations. However, this awareness is connected to adopting numerous cultivation techniques and management of crops ground especially in an increase in the use of efficiency of raw materials, so that the increased production of coffee is not coupled to a similar increase in magnitude in fertilizer use. *Corresponding author: E-mail: deleon_lima@hotmail.com. Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Martins et al. The exploration of a coffee with low energy consumption and sustainable environment has stimulated research to identify mechanisms responsible for the greater nutritional efficiency, with the aim of utilizing them by selection and other methods of plant breeding. Moreover, there has been extensive genetic diversity due to a series of physiological, morphological and biochemical mechanisms developed by various species of plants, and also the coffee, when subjected to adverse conditions of soil fertility (Moura et al., 1999; Cardoso, 2010; Soares, 2013; Martins et al., 2013a, 2013b, 2014). As absorption, transportation and redistribution of nutrients have genetic control, it is possible to improve and/or select cultivars for more efficient utilization of nutrients (Gabelman and Gerloff, 1983; Amaral et al., 2011a; Fageria and Moreira, 2011). Numerous morphological and physiological mechanisms contribute to the efficient use of nutrients, for example: extensive root system (which allows the exploration of large soil volume); high ratio between roots and shoots; root system's ability to modify the rhizosphere (enabling it to overcome low nutrient levels); increased absorption or utilization efficiency of nutrients; the ability to maintain normal metabolism with low nutrient content in tissues and high photosynthetic rate (Gabelman and Gerloff, 1983; Blair, 1993; Fageria and Baligar, 1993; Fageria, 1998; Fageria and Moreira, 2011). The low productivity of crop plants in the world’s many soils is due, in large part, to excess or deficiency of mineral elements. Acidity, alkalinity, salinity and erosion promote degradation and low fertility soils; therefore, correction and soil fertilization, and the use of appropriate management techniques are essential to achieve yields. However, in general, the recovery efficiency of nutrients applied as fertilizer is low: about 50% N, less than 10% for P and approximately 40% for K (Baligar and Fageria, 1998). Overall, this context implies the need to select plants efficient in the absorption and utilization of nutrients applied to the soil. Thus, optimizing the nutritional efficiency of coffee is of great importance for increased productivity, particularly in tropical soils (Fageria, 1989; Furtine Neto et al., 1998). The study of mineral nutrition of plants may contribute to diagnose the correct requirement of soil and plant in the production process, avoiding misapplication of fertilizers, controlling restrictions productivity to ensure the sustainability of agriculture. This review aimed to present a systematic analysis of the nutritional efficiency of coffee. CONCEPTS OF NUTRITIONAL EFFICIENCY Numerous concepts on nutritional efficiency are reported in the literature, ranging from conceptualization of the nutrient, species and the researcher. Therefore, the mechanisms of acquisition and utilization of nutrients 729 should be interpreted to prevent errors in relation to increased productivity. The term nutritional efficiency is used to characterize plants in their ability to absorb and utilize nutrients. Nutritional efficiency is also related to economic output per unit of fertilizer applied and the absorption, translocation and use efficiency of nutrients (Baligar and Fageria, 1998). In the context agronomic nutritional efficiency refers to the ability to produce low supply of a nutrient based on standard genotype (Graham, 1984). Physiological, nutritional efficiency can be related to the efficiency of a genotype to absorb soil nutrient, distribute it and use it internally (Goddard and Hollis, 1984). The genotypic differences in nutritional efficiency occur for several reasons, which are related to the absorption, transport and utilization of nutrients by plants (Marschner, 1995). These genotypic differences involved in the mineral nutrition of plants can be explained by morphological and physiological aspects related to the absorption of nutrients (Gabelman and Gerloff, 1983). Plants can be grouped into "effective" and "ineffective" (Vose, 1987), and "responsive" or "non-responsive" in relation to converting nutrients in dry matter (Blair, 1993; Ciat, 1978; Fox, 1978; Amaral et al., 2012; Martins et al., 2013a; Christo et al., 2014). Nutritional efficiency can be expressed and calculated in five different ways (Fageria, 1998): agronomic efficiency (for example yield increase per unit of nutrient -1 applied - kg.kg ); physiological efficiency (for example biological yield obtained (grain + senescent leaves in -1 crops) per unit of nutrient accumulated - kg.kg ); efficiency in the production of grains (for example production of grain obtained by the accumulated nutrient -1 unit - kg.kg ); recovery efficiency (for example the quantity of nutrient uptake per unit of nutrient applied -1 kg.kg ); use efficiency (unit of dry matter per unit of -1 nutrients in leaf tissues - kg.kg ]. Most efficient plants in the absorption, translocation and use of nutrients are essential to crops in soils with low natural supply, since they are more adaptable and show better performance (Caldeira et al., 2002). This suggests the need to understand these concepts. The increased efficiency of nutrient absorption may be acquired by: i) adequate geometry and distribution of the root system; ii) chemical changes in the rhizosphere and exudation of substances capable of solubilizing nutrients; iii) presence of mycorrhizae; iv) tolerance to conditions of low pH or high levels of exchangeable aluminum; v) faster rate of absorption under conditions of low nutrient concentrations (Souza, 1994; Fageria, 1998; Fageria and Moreira, 2011). Factors such as root hairs, mycorrhizae and root morphology may lead to differences in the absorption efficiency of nutrient between varieties grown in soil and, consequently, differences in plants’ nutritional efficiency. The efficiency of translocation is largely dependent on the ability of absorption and movement of the ions through the roots and also the ability of the system to 730 Afr. J. Biotechnol. release the absorbed ions to xylem vessels (Taiz and Zeiger, 2012). The movement of ions through the roots and their release into the xylem involve several steps that limit the release to the shoots, probably being the basis of genotypic differences in absorption and movement of nutrients (Gerloff and Gabelman, 1983). Thus, the study of mineral nutrition of a species is related to: i) the occurrence of variations in long-distance transport; ii) the occurrence of differences in the accumulation and release of vacuolar level; and iii) the relative proportion of the metabolic and non-metabolic nutrient fractions (Furttini Neto, 1994). The use efficiency can be defined as biomass production per nutrient unit, divided into two components; (1) acquisition efficiency corresponds to the total nutrient by the plant nutrient unit supplied and (2) utilization efficiency, concerning the matter produced by total dry on the plant nutrient unit. Overall, use efficiency of nutrients has been reported as well as the ability of plants to produce maximum quantities of dry matter with minimal investment in applied nutrient unit (Swiader et al., 1994). Although the efficiency of utilization of nutrients is present in one genotype ability to produce well on nutrient-poor, results show that under suitable nutrient levels there is a tendency of not obtaining effective genotypes similar to efficient production genotypes (Gerloff, 1976). Results report that the use efficiency figures the nutritional efficiency index which shows greater variability between individuals of the same species; for example wheat genotypes exhibit wide variability in the efficiency of internal P utilization and consequent variation in biomass production (Fageria and Baligar, 1999). Similar results were also found for the efficiency of nitrogen utilization in cocoa plants (Ribeiro et al., 2008). SYSTEMATIC ANALYSIS OF THE NUTRITIONAL EFFICIENCY OF COFFEA spp. The literature is vast in relation to information on mineral nutrition of coffee, but there are few studies on the nutritional efficiency of culture. In comparative study of Arabica coffee cultivars, it was found that the Catuaí is less demanding on nutrients for variety Mundo Novo, mainly beacuse it has lower requirement for magnesium and zinc (Matiello, 1991); however, the Catuaí variety has low efficiency in the use of nitrogen and sulfur (Correa et al., 1983); but has high efficiency in utilization of copper, in relation to variety Mundo Novo. An extensive study on the nutritional efficiency of Arabica coffee plants in relation to nitrogen and potassium nutrients was able to discriminate, based on utilization efficiency of N and K, some varieties of Arabica coffee. This enabled the efficient selection and expansion of the genetic basis of culture in Brazil (Pereira, 1999). Studies on the efficiency in the production of fruits and relative allocation of nutrients in cultivars of Arabica coffee (Acaiá IAC-474/19, Icatu Amarelo IAC-3282, Rubi MG-1192 and Catuaí Vermelho IAC-99) fertilized with different amounts of fertilizer indicate that the efficiency of the use of nutrients for fruit production was different among cultivars only in scenarios that simulated the pattern of nutrient application on land and 140% of the standard recommendation. There was a trend of superiority of the Rubi MG 1192 and Catuaí Vermelho IAC 99, mainly in higher fertilization levels (140% of the standard recommendation). This better use of nutrients for fruit production may explain the better performance of these cultivars for productivity in these levels of fertilization (Amaral et al., 2010). The results report that the efficiency in the production of roots per unit of nutrient (N, P, K, Ca, Mg and S) of Acaiá (IAC 474-19) is different (lowest) from Ruby (MG 1192). This suggests a possible genetic variability for numerous variables, directly or indirectly, related to the indices of nutritional efficiency of the coffee (Amaral et al., 2011b). To be inefficient in the absorption and utilization of zinc, nutritional efficiency of coffee in relation to mineral nutrient zinc has been investigated (Souza et al., 2001; Reis and Martinez, 2002; Zabini, 2004). With the study of three varieties of Arabica coffee, it was possible to confirm that Catuaí variety uses zinc absorbed with higher efficiency compared to Icatu; and variety Mundo Novo has reduced capacity utilization of zinc, which can be a limiting factor in the production of grain soils lacking this element (Souza et al., 2001). In studies of nutritional efficiency, usually genotypes are grown in different scenarios of mineral nutrient supply. To study the selection, characterization and differential tolerance to zinc deficiency progeny of Arabica coffee, for intermediate parameters of nutritional efficiency, four progenies of Arabica coffee were subjected to different scenarios of supply of zinc. This study revealed that the progeny UFV 4066-5 showed low demand and was efficient in environment with low supply of zinc; UFV 4066-3 was demanding and efficient in the environment with a high supply of zinc; progeny Caturra Vermelho was intermediate in the requirement and nutritional efficiency of zinc; the IAC 4376-5 was undemanding and nutritionally inefficient for zinc. This leads to the conclusion that there is variability in the absorption of this micronutrient between progenies of arabica coffee (Zabini, 2004). Recently, similar experiments were developed with the aim of investigating the efficiency use of zinc for coffee genotypes (MG H-419-1, MG-1192, MG-6851, MG-1474, MG-1190, IAC 1669-33, IAC-476, IAC 785-15, IPR-102, San Ramon and São Bernardo,) grown in contrasting doses of the element in the nutrient solution (0.0 and 6.0 -1 mmol L ). The results show that the IPR-102 variety was the most efficient in the use of zinc; varieties San Ramon and São Bernardo had low efficiency. The MG-1192 (Rubi) had high and low utilization efficiency of zinc when Martins et al. -1 grown in doses 0.0 and 6.0 mmol L . The MG-6851 -1 (Oeiras) showed low efficiency of use of 6.0 mmol L . The other varieties were moderately efficient in the use of the element (Pedrosa et al., 2013). Among the macronutrients required the absence of nitrogen is the most limiting to the development of the coffee plants; for implication in expanding leaf area and growth of vegetation. Due to this importance, studies have been conducted to ascertain the nutritional efficiency of coffee in relation to nitrogen, especially the test aimed to highlight the nutritional efficiency of genotypes and genetic divergence in different scenarios of nitrogen -1 supply (adequate supply -7.5 mmol L ; reduced supply -1 1.0 mmol L ; in nutrient solution) (Cardoso, 2010). Among the 20 cultivars only four (Obatã IAC-1669/20, Araponga MG-1, Tupi IAC-1669/33 e Catucaí IAC785/15) were classified into the effective use of nitrogen and further responsive to the addition of this element; analogously cultivars San Ramon and São Bernardo were inefficient and unresponsive in relation to nitrogen supply. The results were promising evidences of the existence of genetic variability among cultivars of Arabica coffee in relation to the cultivation of nitrogen-constrained environment, highlighting the possibility of exploitation in plant breeding programs to obtain efficient cultivars to N (Cardoso, 2010). Potassium has fundamental implications for the production of coffee beans, especially in the regulation of water loss and grain filling and ripening. By this fact there are studies focusing on highlighting the implications of the nutritional efficiency of coffee plants. In this context, studies were conducted to highlight the extent of genetic diversity among cultivars of arabica coffee with nutritional efficiency for potassium in different scenarios (adequate -1 -1 supply, 4.0 mmol L ; reduced supply, 1.5 mmol L ) in nutrient solution (Soares, 2013). The cultivation in scenario with low potassium supply indicated wide genetic variability among cultivars of Arabica coffee for indices of nutritional efficiency, associated with high genotypic coefficients of determination. This indicates the possibility of obtaining successes in breeding program for environments with low potassium supply in the soil (Soares, 2013). It was possible to group the 11 cultivars of arabica coffee in five groups of genetic similarity. Scientific advancement entails the finding of a large group of cultivars with high efficiency of absorption and utilization of potassium (Paraíso MG H-419/1, IPR-102, Rubi MG-1192, Catucaí IAC-785/15, IPR 103, Catuaí Amarelo IAC-62, Obatã IAC-1669/20, Araponga MG-1, Catuaí Vermelho IAC-15, Pau Brasil and Caturra Vermelho). The result shows nine cultivars with high nutritional efficiency (Obatã IAC-1669/20, Caturra Amarelo, IPR-102, Catuaí Vermelho IAC-15, Rubi MG1192, Araponga MG-1, Tupi IAC-1669/33, Catucaí IAC785/15 and Caturra Vermelho). Furthermore, cultivars of Arabica coffee Araponga MG-1, Tupi IAC-1669/33 and Catucaí IAC-785/15 can be considered efficient and 731 responsive to addition of potassium in the crop environment (Soares, 2013). Reports of studies on nutritional efficiency of plants of the species C. canephora are scarce in the literature. The study of Reis and Martinez (2002) shows that Conilon coffee supersedes the efficiency of absorption and translocation of phosphorus and zinc compared to Arabica coffee (Catuaí). But in comparison, Conilon is more efficient in the use of P and Zn. The nutritional efficiency (absorption, translocation and utilization) of Conilon coffee for phosphorus was systematically studied in test that aimed to promote the interaction of 13 genotypes (CV-01, CV-02, CV-03, CV-04, CV-05, CV-06, CV-07, CV-08, CV-09, CV-10, CV-11, CV-12 and CV-13) at different supply levels of phosphorus (0, 50, 100 and 150% of recommended phosphorus for Conilon coffee) (Martins et al., 2013a; Martins et al., 2013b; Martins et al., 2013d). The results indicate that genotypes conilon exhibit significantly different behavior depending on the levels of supply of P2O5 in the soil. This behavior highlights the finding that the variables of vegetative growth (number of leaves, stem diameter, plant height and leaf area), of dry matter (leaves, stem and roots) and phosphorus use efficiency of genotypes increase linearly with the supply of P2O5 in the soil (Martins et al., 2013b; Martins et al., 2013d). The absorption efficiency of phosphorus in most genotypes of coffee conilon presents adjustment of the quadratic model. This implication in efficiency absorption is maximum between 75 and 100% of the nutrient supply in the soil. The translocation efficiency of phosphorus genotypes conilon coffee is differentiated with linear behavior and quadratic. The use efficiency of phosphorus increases with linear characteristic for genotypes conilon coffee depending on the supply of soil P2O5 (Martins et al., 2013b). The results show that regardless of the supply of phosphorus in the soil, conilon coffee has high efficiency in the translocation of phosphorus; occasionally about 75 to 95% of absorbed phosphorus is translocated into the leaves by conilon coffee (Martins et al., 2013b). The CV02 and CV-13 genotypes were classified as non-efficient and non-responsive, and coffee conilon CV-04, CV-05 and CV-08 are classified as efficient and responsive supplier of phosphorus in the soil (Martins et al., 2013a). Much of the differential behavior of genotypes conilon coffee in relation to vegetative vigor and nutritional efficiency was due to genetic variation (Martins et al., 2013a; Tomaz et al., 2013). Commonly vegetative growth and differentiated nutritional efficiency are under the same conditions of soil fertility, for cultivars of the same species (Fageria, 1989). In the culture of conilon, there is wide genetic (Ferrão et al., 2008) and phenotypic variability (Fonseca et al., 2004) between different materials, reinforcing the above. Studies regarding nutritional efficiency of conilon coffee in relation to the supply of N and K have preliminary results. In relation to potassium supply, there is no evidence that the conilon 732 Afr. J. Biotechnol. coffee is highly responsive to the supply of potassium in the soil, because the genotypes CV-01, CV-02, CV-03 and CV-05 presented high efficiency of absorption and utilization of potassium, independent of K in the soil (Machado et al., unpublished data). The interaction between genotypes (CV-01, CV-02, CV-03, CV-04, CV05, CV-06, CV-07, CV-08, CV-09, CV-10, CV-11, CV-12 and CV-13) and different levels of nitrogen rates (0, 50, 100 and 150% of the recommended nitrogen for conilon coffee) revealed that the absorption and translocation efficiency of nitrogen of genotypes increased with the supply of nitrogen in the soil; however, the maximum efficiency of nitrogen utilization of genotypes is linked to the supply of 50 to 75% of the recommended nitrogen supply. The results indicate that the genotypes have lower translocation efficiency of nitrogen, between 40 to 85%, when compared to translocation of phosphorus. CV-03, CV-07 and CV-08 genotypes were classified as non-efficient and non-responsive and genotypes CV-01, CV-04 and CV-09 weree classified as efficient and responsive to the supply of nitrogen in the soil. The nutritional efficiency can be changed under the influence of cultivation techniques used in coffee. So one of the issues widely investigated was the nutritional efficiency of arabica coffee plants grafted under the hypothesis that the nutritional efficiency of grafted seedlings of C. arabica grafts of C. canephora can differ from conventional seedlings. The nutritional efficiency and the use of N, P, S, Ca, and Mg by plants of coffee vary depending on the combination of scion / rootstock (Tomaz et al., 2003). Studies were directed to verify the nutritional efficiency in relation to N, P and K in the coffee, from four combined genotypes graft (Catuaí Vermelho IAC-15, Oeiras MG-6851, H 419-10-3-1-5 and H 514-5-5-3) and four rootstock (Apoatã LC-2258, Conilon coffee, Emcapa-8141 e Mundo Novo) in hydroponics. The results demonstrate the existence of distinct nutritional efficiency (absorption, translocation and use) of N, P and K in each combination of rootstock and graft (Tomaz et al., 2004). Overall, the rootstocks Apoatã LC 2258 and Mundo Novo showed excellent performance in relation to nutritional efficiency. It was observed that MG 6851 Oeiras and H 419-10-3-1-5 had no benefit by grafting, showing high efficiency in nutrient utilization (Tomaz et al., 2004). The efficiency of absorption and utilization of N, P and S has been studied in plants of C. arabica grafted on C. canephora (Tomaz et al., 2009) and evaluated at 18 months of age. It was concluded that the use efficiency of N, P and S (Tomaz et al., 2009) and K, Ca and Mg (Tomaz et al., 2008) varied depending on the combination of rootstock and graft as already evidenced (Tomaz et al., 2004). The variety Catuaí Vermelho IAC-15 combined with rootstocks ES-26 and ES-23 showed higher use efficiency of N, P and Mg than ungrafted plants of Catuaí IAC-15. Furthermore, variety Oeiras MG 6851 showed low absorption efficiency of K and Mg in relation to plant not grafted, regardless of the combination studied. In general, higher rates of translocation of nutrients, except for S, are observed in seedlings of C. arabica grafted on C. canephora (Dominghetti et al., 2010). The influence of grafting on the absorption and use of micronutrients was also studied, since small changes in foliar concentrations of drugs can be potentially limited for many metabolic processes. As observed for macronutrients (Tomaz et al., 2004; Tomaz et al., 2008; Tomaz et al., 2009), the nutritional efficiency of coffee plants to B, Zn, Cu and Mn shows variation with the combination graft and rootstock used. Combining Catuaí Vermelho IAC-15 and rootstocks ES26 and ES-23 benefited the efficiency of use of B and Zn (Tomaz et al., 2011). Another study that can be reported is the influence of increasing levels of silicon in the soil on the nutritional efficiency of arabica coffee, modifying indexes of Icatu and Mundo Novo, and maintaining the nutritional efficiency of Catuaí unchanged (Pozza et al., 2009). CONCLUSION Overall, there is consent in relation to the concept of nutritional efficiency to characterize plants in their ability to absorb and utilize nutrients. Numerous studies show the differential behavior between species or genotypes of the same species in relation to the efficiency of absorption, translocation and use of nutrients. This differential behavior is explained by genetic variability, which can be conceptualized as a hereditary trait genotype that shows significant difference compared to the other genotype (for indexes of nutritional efficiency), under ideal or adverse conditions. We present the existence of genetic variability among coffee genotypes of the same species, for absorption and use efficient of nutrients; however, it is necessary to better understand the mechanisms of absorption and utilization of nutrients, and also the nature and genetic inheritance in relation to efficiency. There are reports that enable one to point clearly that the grafting in coffee modifies indices of nutritional efficiency for some essential mineral nutrients in plant metabolism. The arabica coffee has satisfactory indexes for absorption and use efficiency of nitrogen in potassium; however, these rates may vary from those genotypes, implying that they are classified as efficient and responsive. The conilon coffee has satisfactory absorption, translocation and use efficiency of nitrogen and phosphorus, which also allows us to observe genetic differences that enable the selection of effective and responsive genotypes indices. Conflict of interests The authors have not declared any conflict of interest. Martins et al. REFERENCES Amaral JFT, Martins LD, Laviola BG, Christo LF, Tomaz MA, Rodrigues WN (2012). A differential response of physic nut genotypes regarding phosphorus absorption and utilization is evidenced by a comprehensive nutrition efficiency analysis. J. Agric. Sci. 4: 164-173. Amaral JFT, Martinez HEP, Laviola BG, Fernandes Filho EI, Cruz CD (2010) Eficiência na produção de frutos e alocação relativa de nutrientes em cultivares de cafeeiro. Revista Ceres. 57:253-262. Amaral JFT, Martinez HEP, Laviola BG, Fernandes Filho EI, Cruz CD (2011a). Eficiência de utilização de nutrientes por cultivares de cafeeiro. Ciência Rural. 41:621-629. Amaral JFT, Martinez HEP, Laviola BG, Tomaz MA, Fernandes Filho EI, Cruz CD (2011b). Produtividade e eficiência de uso de nutrientes por cultivares de cafeeiro. Coffee Sci. 6:65-74. Baligar VC, Fageria NK (1998). Plant nutrient efficiency: towards the second paradigm. In: Siqueira JO (Ed.). Inter-relação fertilidade, biologia do solo e nutrição de plantas. Lavras: Sociedade Brasileira de Ciência do Solo. pp. 183-204. Blair G (1993). Nutrient efficiency – what do we really mean. In: Randall PJ, Delhaize E, Richard RA, Munns R. Genetic aspects of plant mineral nutrition. Keuver Academic, Dordrecht, The Netherlands. pp. 205-210. Caldeira MVW, Rondon Neto RM, Schumaker MV (2002). Avaliação da eficiência nutricional de três procedências australiana de acácia negra (Acacia mearnsii de Wild.). Revista Árvore. 26(5):615-620. Cardoso PMR (2010). Análise biométrica da eficiência nutricional para Nitrogênio em café (Coffea arabica L.). 100 p. Dissertação (Mestrado Genética e Melhoramento de Plantas), Universidade Estadual do Norte Fluminense Darcy Ribeiro, Campos dos Goytacazes-RJ. Christo LF, Martins LD, Colodetti TV, Rodrigues WN, Brinate SVB, Amaral JFT, Tomaz MA, Laviola BG (2014). Differences between genotypes of Jatropha curcas L. are evidenced for absortion and use of nitrogen. Afr. J. Agric. Res. 9:2085-2094. Ciat - Centro Internacional de Agricultura Tropical (1978). Programa de frijol. Informativi Annual. Cali, Colombia, pp. 12-13. Correa JB, Garcia AWR, Costa PC (1983). Extração de nutrientes pelos cafeeiros Mundo Novo e Catuaí. In: X Congresso brasileiro de pesquisa cafeeira, Poços de Caldas. Anais. Rio de Janeiro: IBC/GERCA. pp. 117-183. DaMatta FM, Ramalho JC (2006). Impacts of drought and temperature stress on coffee physiology and production: a review. Braz. J. Plant Physiol. 18:55-81. Dominghetti AF, Mendonça AC, Guimarães NA, Gladyston RC, Botelho CE, Guedes Carvalho J (2010). Absorção, translocação e eficiência no uso dos macronutrientes em cafeiros (Coffea arabica L.) enxertados em Apoatã IAC 2258 (Coffea canephora). Interciência. 35(11):818-822. Fageria NK (1989). Solos tropicais e aspectos fisiológicos das culturas. Brasília: Embrapa/Cnpaf. 425 p. Fageria NK (1998). Otimização da eficiência nutricional na produção das culturas. Revista Brasileira de Engenharia Agrícola e Ambiental. 2(1):06-16. Fageria NK, Baligar VC (1993). Screening crop genotypes for mineral stresses. In: Workshop on Adaptation of Plants to Soil Stresses. Lincoln. Proceedings... Lincoln: University of Nebraska. pp. 142-159. Fageria NK, Baligar VC (1999). Phosphorus-use efficiency in wheat genotypes. J. Plant Nutr. 22(2):331-340. Fageria NK, Moreira A (2011). The role of mineral nutrition on root growth of crop plants. In Donald L (org): Advances in Agronomy, Burlington: Academic Press. 110:251-331. Ferrão RG, Cruz CD, Ferreira A, Cecon PR, Ferrão MAG, Fonseca AFA, Carneiro PCS, Silva MF (2008). Parâmetros genéticos em café Conilon. Pesquisa Agropecuária Brasileira. 43:61-69. Fonseca AFA, Ferrão MAG, Ferrão RG, Verdin Filho AC, Volpi OS, Zucateli F (2004). Conilon Vitória - Incaper 8142: improved Coffea canephora var. kouillou clone cultivar for the tate of Espírito Santo. Crop Breed. Appl. Biotechnol. 4:503-505. Fox RH (1978). Selection for phosphorus efficiency in corn. Communications in Soil Sci. Plant Anal. 9:13-37. Furtine Neto AE, Barros NF, Novais RF, Oliveira MFG (1998). Frações fosfatadas em mudas de Eucalypus. Revista Brasileira de Ciência do 733 Solo. 22:267-274. Gabelman WH, Gerloff GC (1983). The search for and interpretation of genetic controls that enhance plant growth under deficiency levels of a macronutrient. Plant Soil. 72:335-350. Gerloff GC (1976). Plant efficiencies in the use of nitrogen phosphorus, and potassium. In: Wright MJ (Eds.). Plant adaptation to mineral stress in problem soils. Cornell University Agriculture Experimental Station. pp. 161-173. Gerloff GC, Gabelman WH (1983). Genetic basics of inorganic plant. nutririon. In: Lauchli, A, Bieleski RL (Eds.). Inorganic Plant Nutrition. Berlin, Spring-verlag. pp. 453-480. Goddard RE, Hollis CA (1984). The genetic basics of forest tree nutrition. In: Bowen GD, Nambier EKS (Eds.). Nutrition of plantation forest. London, Academic Press. pp. 237-258. Graham RD (1984). Breeding of nutritional characteristics in cereais. In: Tinker RB, Lauchli A (Eds.) Advances in plant nutrition, New York, Praege. pp. 57-102. Marschner H (1995). Mineral nutrition of higher plant. 2 ed. London, Academic Press. 889 p. Martins LD, Lopes JC, Laviola BG, Colodetti TV, Rodrigues WN (2013c). Selection of genotypes of Jatropha curcas L. for aluminium tolerance using the solution-paper method. Idesia. 31: 81-86. Martins LD, Tomaz MA, Amaral JFT, Braganca SM, Martinez HEP (2013a). Efficiency and response of conilon coffee clones to phosphorus fertilization. Revista Ceres. 60: 406-411. Martins LD, Tomaz MA, Amaral JFT, Braganca SM, Martinez HEP, Reis EF, Rodrigues WN (2013b). Nutritional efficiency in clones of conilon coffee for phosphorus. J. Agric. Sci. 5: 130-140. Martins LD, Tomaz MA, Amaral JFT, Christo LF, Rodrigues WN, Colodetti TV, Brinate SVB (2013d). Alterações morfológicas em clones de cafeeiro conilon submetidos a níveis de fósforo. Scientia Plena. 9: 1-11. Martins LD, Tomaz MA, Lidon FJC, DaMatta FM, Ramalho JDC (2014). Combined effects of elevated [CO2] and high temperature on leaf mineral balance in Coffea spp. plants. Climatic Change. 126: 1-11. Matiello JB (1991). O café, do cultivo ao consumo. Editora Globo. 320p. Moura WM, Casali VWD, Cruz CD, Lima PC (1999). Divergência genética em linhagens de pimentão em relação à eficiência nutricional de fósforo. Pesquisa Agropecuária Brasileira. 34: 217-224. Pedrosa AW, Martinez HEP, Cruz CD, Matta FM, Clemente JM, Neto AP (2013). Characterizing zinc use efficiency in varieties of Arabica coffee. Acta Scientiarum Agronomy. 35: 343-348. Pereira JBD (1999). Eficiência nutricional de nitrogênio e de potássio em plantas de café (Coffea arabica L.). 99 p. Tese (Doutorado em Fitotecnia), Universidade Federal de Viçosa, Viçosa – MG. Pozza AAA. Carvalho JG. Guimarães PTG. Figeiredo FC. Araújo AR (2009). Suprimento do silicato de cálcio e a eficiência nutricional de variedades de cafeeiro. Revista Brasileira de Ciência do Solo. 33:1705-1714. Ramalho JDC, Rodrigues APD, Semedo JMN, Pais IMPR, Martins LD, Costa MCS, LEITAO AEB, Fortunato AS, Batista-Santos P, Palos I, Tomaz MA, Scotti-Campos P, Lidon FJC, DaMatta FM (2013). Sustained photosynthetic performance of Coffea spp. under longterm enhanced [CO2]. Plos One. 8: e82712. Reis Jr R, Martinez HEP (2002). Adição de Zn e absorção, translocação e utilização de Zn e P por cultivares de cafeeiro. Scientia agrícola. 59(3):537-542. Ribeiro MAQ, Silva JO, Aitken WM, Machado RCR, Baligar VC (2008). Nitrogen use efficiency in cacao genotypes. J. Plant Nutr. 31(2):239249. Soares YJB (2013). Análise biométrica da eficiência nutricional de potássio em café arábica. 130 p. Tese (Doutora em Produção Vegetal), Universidade Estadual do Norte Fluminense Darcy Ribeiro, Campos dos Goytacazes-RJ. Souza CAS, Guimaraes PTG, Furtini Neto AE, Nogueira FD (2001). Efeitos de doses de zinco via solo em três cultivares de cafeeiro (Coffea arabica L.). Ciência e Agrotecnologia. 25(4): 890-899. Souza ME (1994). Correlação adulto juvenil para eficiência nutricional e comportamento de clones de Eucalyptus grandis em dois níveis de fertilidade do solo. Viçosa-MG, 102p. Tese de Mestrado Universidade Federal de Viçosa. Swiader JM (1994). Genotypic differences in nitrate uptake and utilization 734 Afr. J. Biotechnol. efficiency in pumpkin hybrids. J. Plant Nutr. 17(10): 1687-1699. Taiz L, Zeiger E (2012). Plant Physiology. Artmed, Porto Alegre. Tomaz MA, Martinez HEP, Cruz CD, Ferrari RB, Zambolim L, Sakiyama NS (2008). Diferenças genéticas na eficiência de absorção, na translocação e na utilização de K, Ca e Mg em mudas enxertadas de cafeeiro. Ciência Rural. 38(6):1540-1546. Tomaz MA, Martinez HEP, Cruz CD, Freitas RS, Pereira AA, Sakiyama NS (2009). Eficiência relacionada à absorção e utilização de nitrogênio, fósforo e enxofre, em plantas de cafeeiros enxertadas, cultivadas em vasos. Ciência e Agrotecnologia. 33(4): 993-1001. Tomaz MA, Martinez HEP, Rodrigues WN, Ferrari RB, Pereira RB, Zambolim L, Sakiyama NS (2011). Eficiência de absorção e utilização de boro, zinco, cobre e manganês em mudas enxertadas de cafeeiro. Revista Ceres. 58(1):108-114. Tomaz MA, Martins LD, Amaral JFT, Rodrigues WN, Brinate SVB (2013). Adubação fosfatada no cafeeiro conilon. In: Partelli FL, Oliveira MG, Silva MB (Org.). Conilon: Qualidade, adubação e irrigação. 1ed. São Mateus: Ceunes. 1:132-142. Tomaz MA, Sakiyama NS, Martinez HEP, Cruz CD, Zambolim, L.; Pereira AA (2004). Comparison of nutritional efficiency among hydroponic grafted young coffee trees for N, P, and k. Crop Breed. Appl. Biotechnol. 4:92-99. Tomaz MA, Silva SR, Sakiyama NS, Martinez HEP (2003). Eficiência de absorção, translocação e uso de cálcio, magnésio e enxofre por mudas enxertadas de Coffea arábica. Revista Brasileira de Ciência do Solo. 27:885-892. Vose PB (1987). Genetical aspects of mineral nutrition – progress to date. In: Gabelman WH, Loughman BC (Ed.). Genetic aspects of plant mineral nutrition. Dordrecht: Martinus Nijhoff. pp. 3-13. Zabini AV (2004). Seleção, caracterização e tolerância diferencial à deficiência de zinco de progênies de cafeeiros (Coffea arabica L.). 118 p. Dissertação (Mestrado em Fitotecnia), Universidade Federal de Viçosa, Viçosa-MG. Vol. 14(9), pp. 735-744, 4 March, 2015 DOI: 10.5897/AJB2015.14409 Article Number: D5D38A950951 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Recent characterization of cowpea aphid-borne mosaic virus (CABMV) in Bahia State, Brazil, suggests potential regional isolation José Romário Fernandes de Melo1,2*, Antonia dos Reis Figueira1, Charles Neris Moreira1,2 and Antonio Carlos de Oliveira3 1 Laboratory of Virology, Department of Phytopathology, Federal University of Lavras (UFLA), Lavras, MG 37200-000, Brazil. 2 Plant Biotechnology Graduate Program, Federal University of Lavras (UFLA), Lavras, MG 37200-000, Brazil. 3 Laboratory of Plant Genetics, Department of Natural Science, Southwest Bahia State University (UESB), Vitória da Conquista, BA 45083-900, Brazil. Received 6 January, 2015; Accepted 16 February, 2015 Woodiness disease is the most important disorder of passion fruit worldwide. The causal agent in Brazil is the Cowpea aphid-borne mosaic virus (CABMV), and despite the economic relevance of passion fruit for agriculture there have been recently very few studies about this virus in Brazil and worldwide. This work reveals the phylogenetic relationships of 10 newly identified CABMV isolates from Bahia State, the region where CABMV was first identified (in that time reported as PWV) in South America before its outbreak. The coat protein of 10 CABMV isolates (CABMV-Lns1 - CABMV-Lns10) from Livramento de Nossa Senhora Country, Bahia State, were sequenced and presented very close identity between themselves (nucleotide: 97 to 99%, amino acid: 95 to 100%). They are phylogenetically closely related to Brazilian CABMV, however forming an isolated cluster within the Brazilian clade. According to previous evidences, our data demonstrate that CABMV-Lns are more closely related to isolates from Southern rather than from Northern Africa. Other two isolates from Bahia State clustered separately from CABMVLns, but together with isolates from other Brazilian regions thus suggesting that CABMV-Lns are a strain likely restricted to Bahia. The characterization of new populations of CABMV enables greater resolution of the evolution of viruses causing woodiness disease in passion fruit vines. Our data shed light on an as yet unexplored population of CABMV in Brazil and contributes to the understanding of its evolutionary history. Key words: Passion fruit, Livramento de Nossa Senhora, Bahia, phylogenetics, woodiness disease. INTRODUCTION The passion fruit is one of the most important crops in Brazil. It belongs to Passiflora genus and Passifloraceae family. Viral diseases are the most severe in terms of passion fruit yield loss (Sokhandan et al., 1997; Gibbs et al., 2008b). This is mainly due to the lack of both quick and accurate diagnosis as well as effective methods for disease control (Andrade and Pio-Ribeiro, 2001). In Brazil and Africa woodiness disease is caused by Cowpea aphid-borne mosaic virus (CABMV) (McKern et al., 1994; Nascimento et al., 2006; Maciel et al., 2009). This is in contrast to Australia where the passion fruit woodiness virus (PWV) is the most common causal agent 736 Afr. J. Biotechnol. (Sokhandan et al., 1997) and also to Asia where the same disease is caused by the East asia passiflora virus (EAPV) (Iwai et al., 2006). Its genus Potyvirus, family Potyviridae, contains more agriculturally important plant viruses than any other (Adams et al., 2005). Although in the past 15 years molecular studies about Brazilian CABMV have been carried out (Novaes and Rezende, 2003; Nascimento et al., 2004; Barros et al., 2011; Cerqueira-Silva et al., 2012; Nicolini et al., 2012), surprisingly none of them has phylogenetically investigated the virus from the region of largest passion fruit production in Brazil, the Livramento de Nossa Senhora County. Exploring the molecular variation of the coat protein (CP) in CABMV helps to better understand variability among strains, isolates and related species, to elucidate the evolutionary history of CABMV as well as assists to shed light on disease outbreaks in the course of passion fruit dispersion (Iwai et al., 2006; Gibbs et al., 2008a; Gibbs et al., 2008b). Bahia State is the place where passion fruit woodiness disease was firstly identified in Brazil during the 70’s (Chagas et al., 1981) before its dissemination to most of the countries’ fields. This led us to hypothesize whether Bahia State might host phylogenetically different isolates than the rest of Brazil that could be due to genomic mutation, recombination with other viral species, selective pressure or other evolutionary events. In this study we report a phylogenetic characterization of a population of CABMV from the State of Bahia, in comparison to other viruses causing fruit woodiness disease in passion fruit vines around the world. MATERIALS AND METHODS Virus and plant resources Ten CABMV isolates were collected from different passion fruit crop fields in the farming region of Livramento de Nossa Senhora Country, Bahia State, Brazil (13° 38′ 34″ S, 41° 50′ 27″ W). Ground extract from symptomatic leaves was used for inoculation on healthy passion fruit plants for maintenance, following the method described by Novaes and Rezende (2003). The 10 CABMV isolates here reported were named: CABMV-Lns1 to CABMV-Lns10. Several sequences from passion fruit woodiness disease-related viruses were acquired from public databases (Supplementary Table 1 and Figure 1). RNA extraction, PCR, cloning and sequencing RNA extraction was performed following the Arabidopsis Functional Genomics Consortium Trizol protocol (Arabidopsis Functional Genomics Consortium – AFGC, 2013). cDNA synthesis and PCR (Promega), DNA purification (PCR Purification Kit – NORGEN, Wizard SV Gel and PCR Clean-Up System – Promega) and cloning (pGEM-T Easy Vector – Promega, Max Efficiency DH5α Competent Cell – Invitrogen) were performed as essentially as described in the manufacturer’s protocol. Newly designed primers for both cDNA synthesis and PCR were: CABMV8364-F (5’CCTTTCCTTCTACGATG-3’), CABMV9389-R (5’CAACCGGGGTATGGCCTC-3’), CABMV8359–F (5’GGCATCCTTTCCTTCTATG-3’) and CABMV9402–R (5’GGCATCCTTTCCTTCTATG-3’). Sequencing and phylogenetic analysis Sequencing of at least three independent clones from each isolate was performed twice by Macrogen (South Korea). The sequences were manipulated using DNA Baser Sequence Assembler v2 (DNA Baser Sequence Assembler v2.x, 2010). Phylogenetic tree was constructed using MEGA5 (Tamura et al., 2011). For nucleotidebased tree, Neighbor-Joining (NJ) and BioNJ pairwise distances matrix were estimated by maximum composite likelihood (MLC), estimated under bootstrap values higher than 70% (1,000 replications). RESULTS Analysis of coat protein sequence Complete CP coding sequence containing 828 nucleotides and 275 amino acids were identified in all ten CABMV-Lns isolates, in agreement with the sequenced CABMV genomes (Mlotshwa et al., 2002; Barros et al., 2011). Very little variation was found amongst the nucleotide sequence of CABMV-Lns isolates (identity from 97 to 99%) (Table 1). Comparison of CABMV-Lns and other CABMV isolates showed sequence identity varying from 78 to 94%, where the lowest identity was found with CABMV-Mor, CABMV-Iba and CABMVMonguno isolates (78%) and the highest with CABMVBrs isolate (94%). The identity of amino acid sequences amongst CABMV-Lns isolates ranged from 95 to 100% identity (Table 1). When compared to other CABMV isolates, it ranged from 80 to 96%, when the least identity was found with CABMV-Bnt isolate (80%) and the highest with CABMV-TC1 isolate (96%). The CP conserved motifs of potyviruses were entirely conserved in nearly all CABMV-Lns isolates, with exception of CABMV-Lns6 which has a substitution of aspartic acid by an alanine residue at the DAG motif (Supplementary Figure 2). Phylogenetic profile suggests CABMV-Lns as a strain restricted to Bahia State Maximum-likelihood genealogies of nucleotide sequences *Corresponding author. E-mail: jose.fernandesdemelo@rub.de. Tel: +49 (0)234 32 24274. Fax: +49(0)234-32-14187. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Abbreviations: CABMV, Cowpea aphid-borne mosaic virus; PWV, passion fruit woodiness virus; EAPV, East asia passiflora virus. de Melo et al. Figure 1. Molecular phylogenetic tree of viral species that cause woodiness disease in Passion fruit plants. The nucleotide coding sequence for the Coat Protein was used to generate the tree. The relationships were inferred using the Maximum Likelihood method based on the General Time Reversible model (highest log likelihood 10235.3876 is shown). A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 0.8776)). The branch length is measured by number of substitutions per site. ■ CABMV-Lns, ● CABMV from Bahia State, CABMV from Brasília, ○ Other CABMV, □ EAPV and ∆ PWV. 737 738 Afr. J. Biotechnol. Table 1. Percentage identity of nucleotide (above the diagonal) and amino acid (below the diagonal) sequences of the coding CP gene from ten CABMV-Lns isolates. CABMV-Lns1 CABMV-Lns1 CABMV-Lns2 CABMV-Lns3 CABMV-Lns4 CABMV-Lns5 CABMV-Lns6 CABMV-Lns7 CABMV-Lns8 CABMV-Lns9 CABMV-Lns10 --99 99 100 98 96 98 99 99 99 CABMV- CABMV- CABMV- CABMV- CABMV- CABMV- CABMV- CABMV- CABMVLns2 Lns3 Lns4 Lns5 Lns6 Lns7 Lns8 Lns9 Lns10 99 99 99 99 97 98 99 99 99 --99 99 99 98 99 99 99 99 99 --99 99 98 99 99 99 99 99 99 --99 97 98 99 99 99 98 98 98 --97 98 99 98 98 97 97 96 96 --97 97 98 98 98 98 98 97 95 --98 98 99 98 99 99 98 96 97 --99 99 100 99 99 98 97 98 98 --99 99 100 99 98 97 98 99 99 --- of the CP demonstrate that all CABMV isolates clustered within a monophyletic clade that comprehends sequences from Brazil and Africa. CABMV-Lns isolates formed an isolated cluster inside the CABMV monophyletic clade (Figure 1). Interestingly they clustered separately from CABMV-Jgr and CABMV-Itb isolates also identified in Bahia State, which are more closely related to isolates from the States of Pernambuco and Paraíba, located around 1,200 km and 1,350 km away from Livramento de Nossa Senhora, respectively. PWV and EAPV (Iwai et al., 2006), which are well known different species from CABMV, formed a distinct clade also separately from CABMV-Lns (Figure 1). DISCUSSION The high identity of nucleotide and amino acid sequences amongst the ten CABMV-Lns isolates is strong evidence that they belong to the same strain of CABMV. This information is of great relevance for purposes of disease control, once most of the attempts to overcome woodiness disease in passion fruit such as premunization with mild strains of CABMV/PWV or pathogen-derived resistance have been hindered by variant strains of the same virus (Novaes and Rezende, 2003; Alfenas et al., 2005, Trevisan et al., 2006; Cerqueira-Silva et al., 2014). On the other hand, CABMV-Lns clustered separately from the isolates CABMV-Jgr and CABMV-Itb, which were also collected in Bahia State. As CABMV-Jgr and CABMV-Itb clustered together with isolates from rather far regions, the data suggest that CABMV-Lns are likely a strain restricted to Bahia State. This finding proposes either a single introduction of this strain to the area or a constraint in dissemination of this strain to other places by plant material, since there is no evidence that the virus is seed-transmitted in Passion fruit. According to the demarcation criteria for the Potyvirus genus (King et al., 2011), our data support the hypothesis that CABMV-Lns isolates are a different strain from CABMV-Prp, CABMVCr, CABMV-Vni, CABMV-Z, CABMV-Iba, CABMVMonguno, CABMV-Mor, CABMV-MG-Avr, CABMV-PEBnt (80 to 89% amino acid identity). Additionally, our data confirm the higher sequence identity and closer phylogenetic relationship of CABMV-Lns with Southern African CABMV rather than isolates from the North of Africa, which was also previously suggested (Nascimento et al., 2006). The slave trade between Africa and South America is the likely event for introduction of CABMV in Brazil (Gibbs et al., 2008b), by which infected biological material could have been transported from the South rather than the North of Africa. However, we are aware that the limited number of CABMV sequences currently available, associated to the little information about African CABMV infecting Passion fruit plants, significantly narrow down the possibilities of drawing more precise conclusion on this regard. With reference to the important CP conserved motifs of potyviruses, the DAG motif is related to transmissibility of potyviruses by insects (Abdullah et al., 2009). Isolate CABMV-Lns6 shows a substitution of aspartic acid by alanine it to the DAG motif (Supplementary Figure 1). Mutations in this region significantly reduced transmissibility by insects in previous studies (Abdullah et al., 2009; López-Moya et al., 1999). However, unfortunately transmissibility experiments to investigate the consequences of the mutated DAG motif on the transmissibility capacity of CABMV-Lns6 were not suitable before the submission of this work. Conclusion Our data precisely demonstrate that CABMV-Lns belong also to CABMV species. These isolates can be classified as a strain of CABMV thus far occurring only in Bahia State and phylogenetically more distant from other isolates occurring in the same region. In addition de Melo et al. and accordingly to previous reports, they are more closely related to Southern rather than Northern African CABMV. The exploitation of a larger number of viral samples from other as yet unexplored places in the promising State of Bahia will help to shed light on the events contributing to the observed regional isolation of CABMV-Lns. The whole genome sequencing of CABMVLns is ongoing and will allow us to comprehend their evolutionary history with regard to other related viral species around the world. Conflict of interests The authors did not declare any conflict of interest. ACKNOWLEDGEMENTS This study consists one chapter of the first author’s Master of Science Thesis, funded by the Coordination for the Improvement of Higher Level Personnel (CAPES) in the Graduate Program of Plant Biotechnology at the Federal University of Lavras, MG, Brazil. It was partially funded by the Research Support Foundation of Bahia State (FAPESB, 0852/2006, Undergraduate Research Program-PIC/UESB Scholarship to first author) at the Southwest Bahia State University (UESB). We acknowledge the assistance of Prof. Leandro M. de Freitas (UFBA) for phylogenetic analyses, Allan S. Pereira and Claudio Benicio C. Silva (UESB) for field work and Carlos Roberto Torres (UFLA) for plant/virus maintenance. We also thank Dr. Scott Sinclair for considerably improving the text and the anonymous reviewers for their careful reading of our manuscript and their insightful comments and suggestions. REFERENCES Abdullah N, Ismail I, Pillai V, Abdullah R, Sharifudin SA (2009). Nucleotide sequence of the coat protein of the Malasian passiflora virus and its 3’ non-coding region. Am. J. Appl. Sci. 6(9): 1633-1636. Adams MJ, Antoniw JF, Fauquet CM (2005). Molecular criteria for genus and species discrimination within the family Potyviridae. Arch. Virol. 150(3):459-479. Alfenas PF, Braz ASK, Torres LB, Santana EN, Verônica A, Nascimento S, Zerbini FM (2005). Transgenic Passionfruit expressing RNA derived from Cowpea aphid-borne mosaic virus is resistant to passionfruit woodiness disease. Fitopatol. Brasil. 30(1):33-38. Andrade GP, Pio-Ribeiro G (2001). Estratégias e métodos aplicados ao controle de fitoviroses. In Michereff SJ and Barros (Ed.) Proteção de plantas na agricultura sustentável, v. 3, R. Universidade Federal de Pernambuco, Recife, PE, Brazil, pp. 171-181. Arabidopsis Functional Genomics Consortium - AFGC (2013). Total RNA isolation. AFGC Website. http://www.arabidopsis.org/portals/masc/AFGC/RevisedAFGC/site2R naL.htm. Accessed 11 November 2013. Barros DR, Alfenas-Zerbini P, Beserra JEA, Antunes TFS, Zerbini, FM (2011). Comparative analysis of the genomes of two isolates of cowpea aphid-borne mosaic virus (CABMV) obtained from different hosts. Arch. Virol. 156(6):1085-1091. 739 Boxtel J, Thomas C, Maule AJ (2000) Phylogenetic analysis of two potyvirus pathogens of commercial cowpea lines: implications for obtaining pathogen-derived resistance. Virus Genes 20:71-77. Brand, RJ, Burger, JT & Rybicld, EP (1993) Cloning, sequencing, and expression in Escherichia coli of the coat protein gene of a new potyvirus infecting South African Passiflora. Archives of Virology128:29-41. Brand RJ, Burger JT, Rybicld EP (1993). Cloning, sequencing, and expression in Escherichia coli of the coat protein gene of a new potyvirus infecting South African Passiflora. Arch. Virol. 128(1-2): 2941. Cerqueira-Silva CBM, Conceição LDHCS, Souza AP, Corrêa RX (2014). A history of passion fruit woodiness disease with emphasis on the current situation in Brazil and prospects for Brazilian passion fruit cultivation. Eur. J. Plant Pathol. 139(2): 255-264. Cerqueira-Silva CBM, Melo JRF, Corrêa RX, Oliveira AC (2012). Selection of pathometric variables to assess resistance and infectivity in the passion fruit woodiness pathosystem. Eur. J. Plant Pathol. 134(3): 489-495. Chagas CM, Kitajima, EW, Lin, MT (1981). Grave moléstia em maracujá amarelo (Passiflora edulis f. flavicarpa) no Estado da Bahia causada por um isolado do vírus do "woodiness" do maracujá. Fitopatol. Bras. 6(2): 259-268. 1981. Coutts, BA, Kehoe, MA, Webster, CG, Wylie, SJ & Jones, RA (2011) Indigenous and introduced potyviruses of legumes and Passiflora spp. from Australia: biological properties and comparison of coat protein nucleotide sequences. Archives of Virology 156:1757-1774. DNA Baser Sequence Assembler v2.x (2010). HeracleSoftware. http://www.DnaBaser.com. Accessed 21 January 2014. Freitas DS, Maia IG, Arruda, P, Vega J (2002) Molecular characterization and evolutionary relationships of a potyvirus infecting Crotalaria in Brazil. Archives of Virology 147:411-417. Fukumoto T, Nakamura M, Ohshima K, Iwai H (2012b) Genetic structure and variability of East Asian Passiflora virus population in Amami-O-shima, Japan. J. Phytopathol. 160:404-411. Fukumoto T, Nakamura M, Rikitake M, Iwai, H (2012a) Molecular characterization and specific detection of two genetically distinguishable strains of East Asian Passiflora virus (EAPV) and their distribution in southern Japan. Virus Genes 44:141-148. Gibbs AJ, Mackenzie AM, Wei KJ, Gibbs MJ (2008a). The potyviruses of Australia. Arch. Virol. 153(8):1411-1420. Gibbs AJ, Ohshima K, Phillips MJ, Gibbs MJ (2008b). The prehistory of potyviruses: their initial radiation was during the dawn of agriculture. PloS One 3: e2523. Gioria, R (2003) Caracterização sorológica, biológica e molecular de uma estirpe do Passion fruit woodiness virus que infecta sistemicamente algumas cucurbitáceas. Dissertation, Escola Superior de Agricultura Luiz de Queiroz. Iwai H, Yamashita Y, Nishi N, Nakamura M (2006). The potyvirus associated with the dappled fruit of Passiflora edulis in Kagoshima prefecture, Japan is the third strain of the proposed new species East asian passiflora virus (EAPV) phylogenetically distinguished from strains of Passion fruit woodiness virus. Arch. Virol. 151(4): 811–818. King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ (2011). Virus Taxonomy - Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier/Academic Press; London, United Kingdom. Kitjima, EW, de Alcântara, BK, Madureira, PM, Alfenas-Zerbini, P, Rezende, JAM & Zerbini, FM (2008) A mosaic of beach bean (Canavalia rosea) caused by an isolate of Cowpea aphid-borne mosaic virus (CABMV) in Brazil. Archives of Virology 153:743-747. López-Moya JJ, Wang RY, Pirone TP (1999). Context of the coat protein DAG motif affects potyvirus transmissibility by aphids. J. Gen. Virol. 80(12): 3281-3288. Maciel SC, Nakano DH, Rezende JAM, Vieira MLC (2009). Screening of passiflora species for reaction to Cowpea aphid-borne mosaic virus reveals an immune wild species. Sci. Agric. 66(3): 414-418. McKern NM, Strike PM, Barnett OW, Dijkstra J, Shukla DD, Ward CW (1994). Cowpea aphid borne mosaic virus-Morocco and South African Passiflora virus are strains of the same potyvirus. Arch. Virol. 136(1-2):207-217. Mlotshwa S, Verver J, Sithole-Niang I, Kampen TV, Kammen AV, 740 Afr. J. Biotechnol. Wellink J (2002). The genomic sequence of Cowpea aphid-borne mosaic virus and its similarities with other potyviruses. Arch. Virol. 147(5): 1043-1052. Nascimento AVS, Santana EN, Braz ASK, Alfenas PF, Pio-Ribeiro G, Andrade GP, Carvalho MG, Zerbini, MF (2006). Cowpea aphid-borne mosaic virus (CABMV) is widespread in passion fruit in Brazil and causes passionfruit woodiness disease. Arch. Virol. 151(9):1797– 1809. Nascimento AVS, Souza ARR, Alfenas PF, Andrade GP, Carvalho MG, Pio-Ribeiro G, Zerbini, FM (2004). Análise filogenética de potyvirus causando endurecimento dos frutos do maracujazeiro no Nordeste do Brasil. Fitopatol. Bras. 29(4):378-383. Nicolini C, Rabelo Filho FAC, Resende RO, Andrade GP, Kitajima EW, Pio-Ribeiro G, Nagata T (2012). Possible host adaptation as an evolution factor of Cowpea aphid-borne mosaic virus deduced by coat protein gene analysis. J. Phytopathol. 160(2):82-87. Novaes QS, Rezende JAM (2003). Selected mild strains of Passion fruit woodiness virus (PWV) fail to protect pre-immunized vines in Brazil. Sci. Agric. 60(4):699-708. Novaes, QS, Rezende, JAM (2005) Protection between strains of Passion fruit woodiness virus in sunnhemp. Fitopatologia Brasileira, Brasília 30:307-311. Sokhandan N, Gillings M, Bowyer J (1997). Polymerase chain reaction detection and assessment of genetic variation in New South Wales isolates of Passionfruit woodiness potyvirus. Aust. Plant Pathol. 26(3):155-164. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28(10):2731-2739. Trevisan F, Mendes BMJ, Maciel SC, Vieira MLC, Meletti LMM, Rezende JAM (2006). Resistance to Passion fruit woodiness virus in transgenic Passionflower expressing the virus coat protein gene. Plant Dis. 90(8):1026-1030. Webster CG, Coutts BA, Jones RAC, Jones MGK, Wylie SJ (2007). Virus impact at the interface of an ancient ecosystem and a recent agroecosystem: studies on three legume-infecting potyviruses in the Southwest Australian floristic region. Plant Pathology 56:729-742. Wylie SJ, Jones MG (2011). The complete genome sequence of a Passion fruit woodiness virus isolate from Australia determined using deep sequencing, and its relationship to other potyviruses. Archives of Virology 156:479-482. de Melo et al. Supplementary Table 1. Accession details of all sequences analyzed in this study, available in GenBank (National Center for Biotechnology Information - NCBI, 2013). GenBank accession number KF725706 KF725707 KF725708 KF725709 KF725710 KF725711 KF725712 KF725713 KF725714 KF725715 DQ397527 DQ397528 AY253911 AY433950 AY433951 AY433952 AY434454 AY505342 DQ397530 DQ397531 EU004070 AF368424 AY253907 AY253910 DQ397529 DQ397532 AY253909 AY253906 AY253908 DQ397526 JF833415 JF833416 JF833419 JF833420 JF833421 JF833422 JF833423 JF833424 JF833426 JF833427 JF833428 JF833429 JF833431 JF833432 JF833433 JF833434 JF833417 JF833418 JF833425 DQ397525 Country of origin Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil Brazil State / area Bahia Bahia Bahia Bahia Bahia Bahia Bahia Bahia Bahia Bahia Bahia Bahia Sergipe São Paulo São Paulo São Paulo São Paulo São Paulo São Paulo São Paulo São Paulo São Paulo Paraíba Paraíba Espírito Santo Brasília-DF Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Pernambuco Rio Grande do Norte Rio Grande do Norte Rio Grande do Norte Minas Gerais Isolate CABMV-Lns1 CABMV-Lns2 CABMV-Lns3 CABMV-Lns4 CABMV-Lns5 CABMV-Lns6 CABMV-Lns7 CABMV-Lns8 CABMV-Lns9 CABMV-Lns10 CABMV-Jgr CABMV-Itb CABMV-SE1 CABMV-SP CABMV-F101 CABMV-M2 CABMV-M3 CABMV-F144 CABMV-SP-Vcz CABMV-Prp CABMV-Cr CrMV CABMV-PB1 CABMV-PB2 CABMV-Vni CABMV-Brs CABMV-PE4 CABMV-PE2 CABMV-PE3 CABMV-PE-Bnt CABMV-LMN1 CABMV-CPL3 CABMV-SLMCP1 CABMV-LMN4 CABMV-LMN3 CABMV-SLMCP2 CABMV-PPL1 CABMV-APL5 CABMV-I4-LP3 CABMV-LP7 CABMV-I12 CABMV-LP1 CABMV-LMN2 CABMV-TC1 CABMV-I11 CABMV-I5 CABMV-GSR1 CABMV-GSR3 CABMV-GSR4 CABMV-MG-Avr Source / publication This study This study This study This study This study This study This study This study This study This study Nascimento et al. (2006) Nascimento et al. (2006) Nascimento et al. (2006) Gioria et al. (2004) Gioria et al. (2004) Gioria et al. (2004) Gioria et al. (2004) Novaes e Rezende (2005) Nascimento et al. (2006) Nascimento et al. (2006) Kitjima et al. (2008) Freitas et al. (2002) Nascimento et al. (2006) Nascimento et al. (2006) Nascimento et al. (2006) Nascimento et al. (2006) Nascimento et al. (2006) Nascimento et al. (2006) Nascimento et al. (2006) Nascimento et al. (2006) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nicolini et al. (2011) Nascimento et al. (2006) 741 742 Afr. J. Biotechnol. Supplementary Table 1. Contd. GenBank accession number HQ880242 HQ880243 AJ132414 Y17822 NC_004013 Y18634 D10053 AB627437 AB627436 AB627435 AB604610 AB246773 AB690441 AB690440 Country of origin State / area Isolate Source / publication Brazil Brazil Nigeria Nigeria Zimbabwe Morocco South Africa Japan Japan Japan Japan Japan Japan Japan Minas Gerais Minas Gerais Ibadan Monguno Harare N/A N/A Kagoshima Kagoshima Kagoshima Kagoshima Kagoshima Kagoshima Kagoshima CABMV-BR1 CABMV-Avr CABMV-Iba CABMV-Moguno CABMV-Z CABMV-Mor SAPV EAPV-SY EAPV-YW EAPV-Arata EAPV-IB EAPV-AO EAPV-TG EAPV-AT2 AJ430527 Australia Queensland PWV-#299 DQ898218 DQ898215 JF427623 DQ898216 DQ898217 JF427621 HQ122652 JF427620 JF427622 JF427619 JF427618 JF427617 JF427616 U67149 U67150 U67151 Australia Australia Australia Australia Australia Australia Australia Australia Australia Australia Australia Australia Australia Australia Australia Australia Western Australia Western Australia Western Australia Western Australia Western Australia Western Australia Western Australia Western Australia Western Australia Western Australia Western Australia Western Australia Western Australia New South Wales New South Wales New South Wales PWV-Cop-1 PWV-Gld-1 PWV-BuW-1 PWV-Car-1 PWV-Ku-1 PWV-CarW-1 PWV-MU2 PWV-MuW-1 PWV-BaW-2 PWV-CP-1 PWV-BaW-1 PWV-CarW-3 PWV-CarW-2 PWV-Cul PWV-SD-1 + PWV-NB5c5 Barros et al. (2011) Barros et al. (2011) Boxtel et al. (2000) Boxtel et al. (2000) Mlotshwa et al. (2002) Boxtel et al. (2000) Brand et al. (1993) Fukumoto et al. (2012a) Fukumoto et al. (2012a) Fukumoto et al. (2012a) Fukumoto et al. (2012a) Iwai et al. (2006) Fukumoto et al. (2012b) Fukumoto et al. (2012b) Dietzgen et al. (2002 Unpublished) Webster et al. (2007) Webster et al. (2007) Coutts et al. (2011) Webster et al. (2007) Webster et al. (2007) Coutts et al. (2011) Wylie andJones (2011) Coutts et al. (2011) Coutts et al. (2011) Coutts et al. (2011) Coutts et al. (2011) Coutts et al. (2011) Coutts et al. (2011) Sokhandan et al. (1997) Sokhandan et al. (1997) Sokhandan et al. (1997) de Melo et al. Supplementary Figure 1. Location of Brazilian CABMV isolates used in this study. Number in brackets represents the amount of sequences per location. RN: Rio Grande do Norte, PB: Paraíba, PE: Pernambuco, SE: Sergipe, BA: Bahia, LNS: Livramento de Nossa Senhora, DF: Distrito Federal (Brasília), MG: Minas Gerais, ES: Espírito Santo, SP: São Paulo. Maps were adapted from original draws available in Wikimedia Commons and Free World Maps websites. 743 744 Afr. J. Biotechnol. Supplementary Figure 2. Multiple alignment of 5’ > 3’ predicted amino acid sequence that encodes CP gene flaked by NIb at 5’ end and 3’ UTR at 3’ end. Letter with green and blue backgrounds highlights amino acid substitutions. Letter with yellow background highlights conserved motifs. Letter with grey background shows recently suggested conserved motifs. Start: Start codon, Stop: stop codon, UTR: untranslated region. Vol. 14(9), pp. 745-751, 4 March, 2015 DOI: 10.5897/AJB2014.14316 Article Number: 55C839A50953 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Validation of a reference gene for transcript analysis in cassava (Manihot esculenta Crantz) and its application in analysis of linamarase and α-hydroxynitrile lyase expression at different growth stages Sukhuman Whankaew1, Supajit Sraphet1, Ratchadaporn Thaikert1, Opas Boonseng2, Duncan R. Smith1 and Kanokporn Triwitayakorn1* 1 Institute of Molecular Biosciences, Mahidol University, Nakhon Pathom 73170, Thailand. Rayong Field Crops Research Center, Ministry of Agriculture and Cooperatives, Rayong 21150, Thailand. 2 Received 12 November, 2014; Accepted 23 February, 2015 Relative real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) is a wellestablished method for the precise quantification of gene expression. For accurate relative real-time RTqPCR analysis, validation of the expression of an appropriate reference gene is required. In this study, the expression of six commonly used reference genes, namely 40S ribosomal protein (40S), actin (ACT), cyclophilin C (CYCC), EF-1 alpha (EF1), TATA box binding protein (TBP) and polyubiquitin (UBI) was investigated in leaf and root samples of cassava obtained at 6, 9 and 12 months after planting (MAP). A transcript stability analysis was undertaken in two different varieties of cassava, namely Huay Bong 60 which has high cyanogenic potential (CN) and Hanatee which has low CN. The results reveal that TBP was the most stable reference gene for expression studies. This information was applied to an analysis of linamarase and α-hydroxynitrile lyase gene expression in samples from six low and six high CN cassava plants collected at 6, 9 and 12 MAP. The results indicate that at 6 MAP, the linamarase transcript from leaf of the high CN group was significantly increased, and the α-hydroxynitrile lyase transcript was significantly increased at 12 MAP. Key words: Cassava, housekeeping gene, hydroxynitrile lyase, linamarase, real-time polymerase chain reaction (PCR). INTRODUCTION Accurate quantification of gene expression is important in a number of experimental situations, such as in determining the alteration in expression levels occurring at a defined biological stages and in detecting the response of genes to various stimuli (Fraga et al., 2008). Over the past decade, real-time reverse transcription quantitative PCR (RT-qPCR) has become the choice for high-throughput accurate and reproducible quantitation *Corresponding author. E-mail: kanokporn.tri@mahidol.ac.th. Tel: +66-2-800-3624. Ext: 1368. Fax: +66-2-441-9906. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 746 Afr. J. Biotechnol. of gene expression (Vandesompele et al., 2002). Quantification of expression in RT-qPCR experiments is generally undertaken as either an absolute or as a relative quantification. An absolute quantification entails the determination of the copy number of the transcript of interest based on a calibration curve. Using a calibration curve requires the time consuming generation of a stable and reliable calibration standard which must be precisely quantified (Pfaffl, 2001). However, in most experiments, determining the absolute transcript copy number is not essential, and determining the relative changes in gene expression or a relative quantification is sufficient (Livak and Schmittgen, 2001). For relative quantification by real-time RT-qPCR, a suitable reference gene transcript is required to normalize the target gene transcript (Pfaffl, 2001). Theoretically, the reference transcript should allow the effective normalization of different amounts of starting material (Radonić et al., 2004) and the expression levels of reference genes should be constant in all samples under investigation and under all experimental conditions evaluated (Pfaffl, 2001; Radonić et al., 2004). While there are several commonly used reference transcripts that have been reported, it is generally also accepted that no single transcript is constantly expressed in all tissues and under all experimental conditions, implying that the reference transcript should be carefully validated before each experiment for accurate quantification (Pfaffl, 2001; Radonić et al., 2004). Cassava (Manihot esculenta Crantz) is an economically important human and animal food source and industrial feedstock and world cassava production is expected to increase in order to supply the industrial demand (Food and Agriculture Organization, 2012). However, the ability of cassava to produce the toxic component, hydrogen cyanide (HCN), is of significant concern. The cyanogenesis pathway has been well characterized and CN production starts when vacuoles are ruptured, releasing linamarin which is hydrolyzed by the enzyme linamarase (LNM), also known as beta-D-glucosidase (McMahon et al., 1995). The deglycosylated product, acetone cyanohydrin is then further enzymatically broken down by αhydroxynitrile lyase (HNL) or can spontaneously decompose at pH > 5.0 to produce acetone and HCN (White et al., 1994). The recent release of draft cassava genome sequence in “Phytozome” makes it easier to design sequences to validate reference genes and to analyze the expression of genes of interest. Although, the expression study of LNM and HNL have been identified, but the gene expression study have been done only with 4 month old plants in in vitro conditions (Echeverry-Solarte et al., 2013). Since the stability of reference gene for expression study of genes affecting cyanogenic potential (CN) has not been identified elsewhere, this research therefore sought to validate potential reference transcripts across growing stages and tissues of two varieties of cassava with different endogenous CN in order to provide a transcript suitable for the accurate normalization of realtime quantitative RT-PCR data. The study utilized the most stable transcript to investigate the expression of LNM and HNL genes at 3 growing stages of cassava in vivo. Both root and leaf tissues were used and six plants each of low and high CN were analyzed, in order to understand more about transcription pattern at each stage and tissue systematically. MATERIALS AND METHODS Plant sample collection Cassava varieties Huay Bong 60 (high CN), Hanatee (low CN), and five low and five high CN plants from a previously described F1 mapping population (Whankaew et al., 2011) were grown at the Rayong Field Crops Research Center, Department of Agriculture, Thailand. Cassava leaves and roots were collected at 6, 9, and 12 month after planting (MAP), then snap frozen in liquid nitrogen until RNA isolation. The CN in all root samples was evaluated at 6, 9 and 12 MAP using the picrate paper kit method (Bradbury et al., 1999). RNA isolation and cDNA synthesis Frozen tissue samples were ground into fine powder using liquid nitrogen. Fruit-mate™ for RNA purification (Takara, Japan) was applied to remove polysaccharides and polyphenols. Total RNA was then extracted using TriReagent® (Molecular Research Center, USA) according to the supplier’s instruction. The RNA was treated with DNA free kit (Ambion, USA) to remove DNA contamination. The concentration of each RNA sample was measured by a NanoDrop 1000 Spectrophotometer (Thermoscientific, USA). First-strand cDNA was synthesized from 1 µg total RNA using ImProm-II Reverse Transcription System (Promega, USA), according to the manufacturer’s instructions. Primer design and amplification efficiency Six reference genes including 40S ribosomal protein (40S), actin (ACT), cyclophilin C (CYCC), EF-1 alpha (EF1), TATA box binding protein (TBP) and polyubiquitin (UBI) were chosen from the cassava genome database (www.phytozome.net). Specific primers were designed using the PrimerQuest software (http://sg.idtdna.com/primerquest/Home/Index). The sequences of the target genes, LNM and HNL, sourced from previous publications (Hughes et al., 1992, 1994) were also used for primer design. The criterion for amplified products ranged from 100 to 300 bp with a Tm of 60 ± 5°C. Hairpin, self-dimer and primer dimer interactions were investigated using Oligo Analyzer (https://sg.idtdna.com/analyzer/Applications/OligoAnalyzer/). Each primer was assessed for efficiency of amplification in series of 2 fold-serially diluted Hanatee cDNA with 3 technical replicates. Real-time PCR was carried out in 20 μl final volume containing 1 μl of 1:2 cDNA template, with final concentration of 0.2 μM of each primer and 1X of KAPA master mix (KAPA SYBR® FAST qPCR Kit, KAPA Biosystems, MA, USA). The conditions for real-time PCR was set as recommended by the manufacturer, with an initial 95°C Whankaew et al. for 3 min, followed by a total of 40 cycles of a denaturation step at 95°C for 5 s and an annealing temperature of 60°C for 30 s. If the amplification was not efficient, 3 step cycling was tested by using an annealing temperature of 55°C for 20 s, followed by a 1 s extension at 72°C. Specific amplification was assessed by melting curve analysis. The primer efficiency (E) was calculated from %E = (10(−1/slope)-1) x 100, according to the MIQE guidelines for qRT-PCR (Bustin et al., 2009). The efficiency of all primer between 90-105% was considered for the next step. Determination of reference genes stability Real-time PCR amplification of six reference gene transcripts (40S, ACT, CYCC, EF1, TBP and UBI) was evaluated using cDNA of Huay Bong 60 and Hanatee from both leaf and root samples obtained at 6, 9 and 12 MAP for three technical replicates. The most stable reference gene transcript was established using the NormFinder program (Andersen et al., 2004). Quantification of LNM and HNL expression LNM and HNL were chosen as genes of interest. Real-time PCR of root and leaf samples from parental Huay Bong 60 and Hanatee and five plants with low CN and five with high CN were analyzed at 6, 9 and 12 MAP with technical duplicates. The ∆CT method using the best reference gene was used for relative quantification. The expression levels of the low and high CN groups was compared using PASW Statistics 18 (SPSS Inc., 2009). RESULTS AND DISCUSSION Validation of reference gene transcripts The reference gene names, primer sequences and amplicon length are given in Table 1. The efficiency of amplification of all primer pairs ranged from 95-105% and 2 r >0.99, which is in accordance with established criteria for real-time RT-PCR (Bio-Rad Laboratories, 2006; Dhami and Kumarasinghe, 2014; Ma et al., 2013). In order to determine the most stable reference genes, expression levels of transcripts from these six reference genes were determined in Huay Bong 60 and Hanatee, which are significantly different in CN (Whankaew et al., 2011) at 6, 9 and 12 MAP. Stability of the reference genes according to the NormFinder software are shown in Figure 1. NormFinder calculates stability values based on variance estimations for identifying suitable normalizing genes amongst a set of candidates, with lower stability value indicating higher expression stability (Andersen et al., 2004). From the results, TBP was the most stable reference gene transcript evaluated with a stability value of 0.01 across samples. Similarly, TBP has been reported to be the most stable reference gene in several systems (Fujii et al., 2013; Nakao et al., 2015; Tratwal et al., 2014). TBP is not only the appropriate reference gene for a study of cyanogenic potential, but it can also be applied in expression studies of other traits 747 that show differences between Huay Bong 60 and Hanatee varieties, such as starch content, yield, first branch height, etc. However, it should be noted that no reference gene is appropriate to all tissues and under all experimental conditions, and therefore the stability evaluation should be carefully validated for other organisms or different experiments for accurate quantification (Pfaffl, 2001; Radonić et al., 2004). In this study, however TBP was used to accurately determine the relative expression levels of LNM and HNL. Expression profile of linamarase (LNM) and αhydroxynitrile lyase (HNL) LNM and HNL are two major genes involved in the hydrogen cyanide liberating cyanogenesis pathway (McMahon et al., 1995). The expression profiles of these genes were analyzed in six plants each of low and high CN, consisting of the parental Huay Bong 60 and Hanatee and an additional five plants with low CN and five with high CN from a previously described F1 mapping population (Whankaew et al., 2011). Expression of LNM and HNL was extremely low in root samples, with correspondingly high Ct values, and so expression analysis is only presented for leaf samples. Low expression of LMN and HNL in root samples has been previously reported by others (Santana et al., 2002; White et al., 1998). The CN assessed in root samples and the normalized expression profiles of LMN and HNL in leaf are shown in Figure 2, and the results of statistical comparison between groups are shown in Table 2. There was no difference in the levels of CN in the low CN plants over the three time points, while the high CN plants showed significantly higher CN levels at all time points as compared to the low CN plants as well as showing significant increase in CN levels at 9 and 12 MAP as compared to 6 MAP (Table 2). LMN expression did not vary significantly in the low CN group over the three time points, and the high CN plants expression was significantly increased as compared to all other samples only at 6 MAP (Table 2). HNL expression was significantly increased at 12 MAP in both the low and high CN plants as compared to the earlier time points and at 12 MAP, HNL expression was significantly increased in the high CN plants as compared to the same time point in the low CN plants. The significantly high level of expression of the genes LNM and HNL in the cyanogenesis pathway corresponded to the high levels of CN. Conclusion For reliable and accurate relative quantification by real 748 Afr. J. Biotechnol. Table 1. Primer sequences of reference genes and target genes. Symbol Full name Forward primer (5' -> 3') Reward primer (5' -> 3') 40S ACT CYCC EF1 TBP UBI HNL LNM 40S ribosomal protein Actin Cyclophilin C EF-1 alpha TATA box binding protein Polyubiquitin α-hydroxynitrile lyase Linamarase CCTGCTGAAATTGTTGGGAAGCGT TCCAATTGACCGCGGCTACCTTAT AGTTAGGGCTCCAAGCAGGAACAA TGGTACAAGGGCCCAACTCTTCTT ATGGCAGATCAAGGAGGCTTGGAA AGGAGGGCCACCACTGACAAATAA CTGGGCTTCGTACTTCTGAG GGAGACTCAGCCACAGAACC AACACAACATCTTTGCCCGAGAGC ACGCTGGATTGAAGGGAGAGTGAA AACCACGCCCTCTTCTGATACGTT TCACAACCATTCCAGGCTTCAGGA GCAGCGAAACGCTTAGGGTTGTAT TTCCATCTAGACGCTTCCCTGCAA TGAACTTCGGTCTCTGAGCC GCACATCAACTTTACTGTCGG Annealing temperature (°C) Product size (bp) 60 60 60 60 55 and 60 60 60 55 155 145 149 172 179 152 127 169 Figure 1. Stability of 6 reference genes for cyanogenic potential study for leaf and root at 6, 9, 12 MAP calculated using NormFinder. A lower stability value corresponds to a higher stability of transcript expression. Whankaew et al. 749 Figure 2. Expression level of LNM and HNL in cassava leaf at 6, 9 and 12 MAP. Cyanogenic potential, LNM transcript and HNL transcript of low and high groups are shown in panels A, B and C, respectively. Mean values + standard deviation are represented. time PCR, validation of reference gene transcripts is an important first step. From the evaluation of two cassava varieties that have phenotypic differences in CN levels at 6, 9 and 12 MAP in both leaf and root, TBP was found to be the most stable gene transcript amongst the six gene transcripts evaluated. Utilizing expression of TBP to 750 Afr. J. Biotechnol. Table 2. Tabulation of tests of significance for levels of cyanogenic potential (CN) and normalized expression of linamarase (LNM) and αhydroxynitrile lyase (HNL). Samples were taken from cassava leaf and root at 6, 9 and 12 months after planting (MAP) of low and high CN groups. CN data is from root samples, while expression data is from leaf samples. 6 MAP 9 MAP 12 MAP 6 MAP 9 MAP 12 MAP Low CN group 6 MAP 9 MAP 12 MAP 0.072 0.221 0.543 0.019* 0.548 0.231 0.000** 0.000** 0.000** 0.000** 0.005** 0.001** 0.001** 0.020* 0.269 - 6 MAP 9 MAP 12 MAP 6 MAP 9 MAP 12 MAP 0.776 0.429 0.000** 0.651 0.806 0.619 0.000** 0.473 0.596 0.000** 0.230 0.298 0.000** 0.000** 0.825 - 6 MAP 9 MAP 12 MAP 6 MAP 9 MAP 12 MAP 0.905 0.046* 0.126 0.335 0.000** 0.035* 0.100 0.278 0.000** 0.594 0.254 0.002** 0.536 0.001** 0.000** - Parameter Low CN group Cyanogenic potential (ppm) High CN group Low CN group Expression level of LNM High CN group Low CN group Expression level of HNL High CN group normalize gene expression levels of LNM and HNL showed that at an early stage of post planting (6 MAP), leaves of the high CN group expressed higher levels of LNM than leaves in the low CN group, whereas HNL expression was significantly increase at the latest stage examined (12 MAP) in leaves of both low and high CN plants, although expression of HNL was significantly higher in the high CN plants than the low CH plants at 12 MAP. The results of this study will have future application on the analysis of gene expression of other important traits in cassava. Conflict of interest The authors declared they have no conflict of interest. ACKNOWLEDGEMENTS This project was supported by Thailand Research Fund and Mahidol University (Grant no. TRG5580002). Rayong Field Crops Research Center, Department of Agriculture, Thailand is acknowledged for kindly providing plant materials. High CN group 6 MAP 9 MAP 12 MAP REFERENCES Andersen CL, Jensen JL, Ørntoft TF (2004). Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 64:5245-5250. Bio-Rad Laboratories I (2006). Real-Time PCR Applications Guide. BioRad Laboratories, Inc. Bradbury M, Egan S, Bradbury J (1999). Picrate paper kits for determination of total cyanogens in cassava roots and all forms of cyanogens in cassava products. J. Sci. Food Agri. 79:593 - 601. Bustin S, Benes V, Garson J, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl M, Shipley G, Vandesompele J, Wittwer C (2009). The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 55:611-622. Dhami MK, Kumarasinghe L (2014). A HRM Real-Time PCR Assay for Rapid and Specific Identification of the Emerging Pest Spotted-Wing Drosophila (Drosophila suzukii). PLoS ONE. doi:10.1371/journal.pone.0098934. Echeverry-Solarte M, Ocasio-Ramirez V, Figueroa A, González E, Siritunga D (2013). Expression Profiling of Genes Associated with Cyanogenesis in Three Cassava Cultivars Containing Varying Levels of Toxic Cyanogens. Am. J. Plant Sci. 4:1533-1545. Food and Agriculture Organization (2012). Food outlook. Global information and early warning system on food and agriculture. Fraga D, Meulia T, Fenster S (2008). Real-Time PCR. In: Current Protocols Essential Laboratory Techniques. John Wiley & Sons, Inc. doi:10.1002/9780470089941.et1003s00. Fujii Y, Kitaura K, Matsutani T, Shirai K, Suzuki S, Takasaki T, Kumagai K, Kametani Y, Shiina T, Takabayashi S, Katoh H, Hamada Y, Kurane I, Suzuki R (2013). Immune-related gene expression profile in Whankaew et al. laboratory common marmosets assessed by an accurate quantitative Real-Time PCR using selected reference genes. PLoS ONE. doi:10.1371/journal.pone.0056296. Hughes J, Carvalho FJ, Hughes MA (1994). Purification, characterization, and cloning of alpha-hydroxynitrile lyase from cassava (Manihot esculenta Crantz). Arch. Biochem. Biophys. 311:496502. Hughes MA, Brown K, Pancoro A, Murray BS, Oxtoby E, Hughes J (1992). A molecular and biochemical analysis of the structure of the cyanogenic beta-glucosidase (linamarase) from cassava (Manihot esculenta Cranz). Arch. Biochem. Biophys. 295:273-279. Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using Real-Time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402-408. Ma S, Niu H, Liu C, Zhang J, Hou C, Wang D (2013). Expression stabilities of candidate reference genes for RT-qPCR under different stress conditions in soybean. PLoS ONE. doi:10.1371/journal.pone.0075271. McMahon J, White WLB, Sayre RT (1995). Cyanogenesis in cassava (Manihot esculenta Crantz). J. Exp. Bot. 46:731 - 741. Nakao R, Yamamoto S, Yasumoto Y, Kadota K, Oishi K (2015). Impact of denervation-induced muscle atrophy on housekeeping gene expression in mice. Muscl. Nerve. 51:276-281. Pfaffl MW (2001). A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. doi:10.1093/nar/29.9.e45. Radonić A, Thulke S, Mackay IM, Landt O, Siegert W, Nitsche A (2004). Guideline to reference gene selection for quantitative real-time PCR. Biochem. Biophys. Res. Commun. 313:856-862 Santana MA, Vásquez V, Matehus J, Aldao RR (2002). Linamarase expression in cassava cultivars with roots of low- and high-cyanide content. Plant Physiol. 129:1686-1694. SPSS Inc. (2009). PASW Statistics 18, Release version 18.0.0 SPSS Inc., Chicaco, IL. www.spss.com Tratwal J, Follin B, Ekblond A, Kastrup J, Haack-Sorensen M (2014). Identification of a common reference gene pair for qPCR in human mesenchymal stromal cells from different tissue sources treated with VEGF. BMC Mol. Biol. 15:11 751 Vandesompele J, De Paepe A, Speleman F (2002). Elimination of primer-dimer artifacts and genomic coamplification using a two-step SYBR Green I real-time RT-PCR. Anal. Biochem. 303:95 - 98. Whankaew S, Poopear S, Kanjanawattanawong S, Tangphatsornruang S, Boonseng O, Lightfoot DA, Triwitayakorn K (2011). A genome scan for quantitative trait loci affecting cyanogenic potential of cassava root in an outbred population. BMC Genomics. 12:266 White WLB, Arias-Garzon DI, McMahon JM, Sayre RT (1998). Cyanogenesis in Cassava . The Role of Hydroxynitrile Lyase in Root Cyanide Production. Plant Physiol. 116:1219-1225. White WLB, McMahon JM, Sayre RT (1994). Regulation of cyanogenesis in cassava. Acta Hort. 375:69-77. Vol. 14(9), pp. 752-757, 4 March, 2015 DOI: 10.5897/AJB2014.14374 Article Number: BC6F11D50954 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Detection of MspI polymorphism and the single nucleotide polymorphism (SNP) of GH gene in camel breeds reared in Egypt Sekena H. Abd El-Aziem, Heba A.M. Abd El-Kader, Sally S. Alam and Othman E. Othman* Cell Biology Department, National Research Centre, Dokki - Giza – Egypt. Received 15 December, 2014; Accepted 16 February, 2015 Growth hormone (GH) is an anabolic hormone synthesized and secreted by the somatotroph cells of the anterior lobe of the pituitary gland in a circadian and pulsatile manner, the pattern of which plays an important role in postnatal longitudinal growth and development, tissue growth, lactation, reproduction as well as protein, lipid and carbohydrate metabolism. The aim of this study was to detect the genetic polymorphism of GH gene in five camel breeds reared in Egypt which are Sudany, Somali, Mowaled, Maghrabi and Falahy, using polymerase chain reaction- restriction fragment length polymorphism (PCRRFLP) technique. Also, this work aimed to identify the single nucleotide polymorphism (SNP) between different genotypes detected in these camel breeds. The amplified fragment of camel GH at 613-bp was digested with the restriction enzyme MspI and the result reveals the presence of three different genotypes; CC, CT and TT in tested breeds. Significant differences were recorded in the genotype frequencies between these camel breeds. The result shows that the Maghrabi breed that is classified as a dual purpose camels had higher frequency for allele C (0.75) than those in the other tested four breeds. The sequence analysis declared the presence of a SNP (C264T) in the amplified fragment which is responsible for the elimination of the restriction site C^CGG and consequently the appearance of two different alleles C and T. The nucleotide sequences of camel GH alleles T and C were submitted to nucleotide sequences database NCBI/Bankit/GenBank and have accession numbers: KP143517 and KP143518, respectively. It is concluded that only one SNP C→T was detected in GH gene among the five tested camel breeds reared in Egypt and this nucleotide substitution can be used as a marker for the genetic biodiversity between these camel breeds. Also, due to the possible association between allele C and higher growth rate, we can used it in marker assisted selection (MAS) for camels in breeding program as a way for enhancement of growth trait in camel breeds reared in Egypt. Key words: Camel breeds in Egypt, GH, PCR, RFLP, SNPs. INTRODUCTION The population of old world camelidae in the world is estimated to be 18.5 million heads. Dromedary camels comprise 95% of them while the remaining 5% are Bactrian camel. Bactrian camels are found mainly in the cold high altitudes of Asia. The Near East, North Africa and the Sahel region have about 70% (12.6 million) of the world's Dromedary camels. Somalia and Sudan together own about half of this number (Kesseba et al., 1991). In Egypt, the camel population was about 120 thousand head, (SADS, 2009). It was reported that many camel El-Aziem et al. breeds are reared in Egypt but the main camel breeds are Maghrabi (a dual purpose animal; (meat and milk) and Falahy, Sudany, Somali and Mowaled (meat type animal) (Mahrous et al., 2005). Camels are economically important animals in Egypt where they are dual purpose animals. In the Nile Valley and Delta, they are mainly raised for meat production and for some agricultural labors. In the desert, they are raised equally for meat and milk production, while some for labors and transport, and some especially for camel racing. The main biological role of growth hormone is to control postnatal growth, although it also has effects on metabolic regulation, lactation and reproduction (Louveau and Gondret, 2004; Daverio et al., 2012). Growth hormone gene, with its functional and positional potential role in the regulation of growth and metabolism in animals, has been widely used for marker in several livestock species, including the cattle (Dybus, 2002; Ge et al., 2003; Beauchemin et al., 2006; Katoh et al., 2008), sheep (Marques et al., 2006) and goat (Malveiro et al., 2001; Boutinaud et al., 2003). The camel growth hormone gene extends over about 1900 bp, and as other mammalian GH genes, it is organized in five exons separated by four introns (Maniou et al., 2004). It is a 22 KDa single chain polypeptide primarily produced and secreted by the somatotrophs of the anterior pituitary gland in circadian and pulsatile manner (Dybus, 2002). Genetic polymorphism can be identified by several techniques; one of the most commonly used methods is PCR-RFLP. It is a powerful method for identifying nucleotide sequence variation in amplified DNA and can detect single base substitutions in enzymatic restriction sites (Amie Marini et al., 2012). The present study aimed to detect the genetic polymorphism of GH gene in some camel breeds reared in Egypt using PCR-RFLP technique and identify SNPs between different genotypes detected in these breeds. 653 Thereafter, it was diluted to the working concentration of 50 ng/μl to be used for polymerase chain reaction. Polymerase chain reaction (PCR) A PCR cocktail containing 1.0 mM forward and reverse primers specific for growth hormone gene, 0.2 mM dNTPs, 10 mM Tris (pH 9), 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin (w/v), 0.1% Triton X100 and 1.25 units of Taq polymerase was used. The cocktail was aliquot into PCR tubes with 100 ng of camel DNA. The reaction was run at 94°C for 5 min, 35 cycles of 94°C for 1 min, 55°C for 30 s, 72°C for 45 s and a final extension at 72°C for 5 min. The PCR products were electrophoresed on 2% agarose gel and stained with ethidium bromide to check amplification product. The primers used in this study were designed on the basis of DNA sequence of the camel GH gene (Ishag et al., 2010). The primer sequences are: F: 5′-GTCCTGTGGACAGCTCAC-3′ and R: 5′TGTCCTCCTCACTGCTTTA-3′ RFLP Genotyping In order to detect variants of GH gene in different camel breeds, the PCR products were digested using restriction enzyme; MspI (Fermentas). 10 µl of PCR product was digested with 1 µl of FastDigest restriction enzymes for 5 min at 37°C. The restriction fragments were subjected to electrophoresis in 2% agarose/ ethidium bromide gel (GIBCO, BRL, England) in 1x TBE buffer (0.09 M Tris-boric acid and 0.002 M EDTA). Gels were visualized under UV light and documented in FX Molecular Imager apparatus (BIO-RAD). DNA sequencing The PCR products representing each detected genotype of GH gene in different camel breeds, were purified and sequenced by Macrogen Incorporation (Seoul, Korea). Sequence analysis and alignment were carried out using NCBI/BLAST/blastn suite to detect each single nucleotide substitution between different detected genotypes. Results of endonuclease restriction were carried out using FastPCR. The nucleotide sequences of different alleles for camel GH gene were submitted to GenBank (NCBI, BankIt). MATERIALS AND METHODS RESULTS AND DISCUSSION Blood samples and DNA extraction Blood samples were collected from jugular vein of 15 individual camels from each tested breed; Fallahi, Maghrabi, Mowalled, Sudany and Somali. Genomic DNA was extracted from the whole blood according to the method described by Miller et al. (1988) with minor modifications. Briefly, blood samples were mixed with cold 2x sucrose-triton x-100 and centrifuged at 5000 rpm for 15 min at 4°C. The nuclear pellet was suspended in lysis buffer, sodium dodecyl sulfate and proteinase K and incubated overnight in a shaking water bath at 37°C. Nucleic acids were extracted with saturated NaCl solution and then washed with 70% ethanol. The DNA pellet was dissolved in 1x TE buffer and its concentration was determined by using NanoDrop1000 (Thermo Scientific) Spectrophotometer. Growth hormone has proven to be the major regulator of postnatal growth and metabolism in mammals and thus affects growth rate, body composition, health, milk production and aging by modulating the expression of many genes (Carnicella et al., 2003; Ge et al., 2003). Growth hormone has also been suggested as responsible for more important and prolonged cell proliferation in hypertrophied animals (Schoenfeld, 2010). The growth hormone gene in mammals was comprised of five exons and four introns (Maniou et al., 2004). The coding region of GH consisted of five exons, *Corresponding author. E-mail: othmanmah@yahoo.com. Fax: 202 33370931. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 754 Afr. J. Biotechnol. Figure 1. Electrophoretic pattern of PCR-amplified fragment from GH gene in camels. M: 100-bp ladder marker. Lanes 1-6: 613-bp PCR product amplified from camel DNA. covering a total transcribed area of about 1.7 kb in sheep and humans (Byrne el al., 1987; Vize and Wells,1987), 2.7 kb in cattle (Yao et al.,1996) and 1.9 kb in camel (Maniou, 2003) and horse (Zhang et al., 2004). Camels provide mankind with a range of products and services; like wool, meat, milk and draught power. They have been domesticated about 3000 years ago and are present in high numbers in the arid parts of Africa, particularly in the arid lowlands of Eastern Africa (Somalia, Sudan, Ethiopia, Kenya and Djibouti) (Schwartz and Dioli, 1992). The dromedary camel contributes significantly to family food security in semi dry and dry climates, and is a major component of the agropastoral systems in vast pastoral areas in Asia and Africa (Ishag et al., 2010). Camels are economically important animals in Egypt where they are dual purpose animals (meat and milk). Improvement of camel productivity and detection of biodiversity between different camel breeds has necessitated the genotyping of the productivity trait genes in these breeds. The development in molecular genetics techniques has made it possible to identify differences between individuals at the DNA level. Recently, genetic polymorphisms at candidate genes affecting economic traits have stimulated substantial research interest because of their impending utilization as an aid to genetic selection and to demarcate evolutionary relationships in different livestock breeds (Sodhi et al., 2007). We aimed in this work to detect the genetic polymorphism of GH gene in some camel breeds reared in Egypt using PCR-RFLP technique and identify SNPs between different genotypes detected in these breeds. The primers used in this study flanked 613-bp fragments consist of 36 base pairs from exon 1, 243 base pairs from intron 1, 161 base pair from exon 2 and 173 base pairs Figure 2. Different genotypes obtained after digestion of PCR products of camel GH gene with MspI; TT: homozygous genotype with one undigested fragment at 613-bp, TC: heterozygous genotype with three fragments at 613-, 349- and 264-bp and CC: homozygous genotype with two digested fragments at 349- and 264-bp. M: 100-bp ladder marker. from intron 2 of camel GH gene. The amplified fragments obtained from all tested camels were of 613-bp (Figure 1). These PCR amplified fragments (613-bp) were digested with MspI endonuclease. Depending on the presence or absence of the restriction site (C^CGG) at position 264^265, we can easily differentiate between three different genotypes: CC with two digested fragments at 349-and 264-bp, TT with undigested one fragment at 613-bp and CT with three fragments at 613-, 349- and 264-bp (Figure 2). El-Aziem et al. 755 Table 1. Genotype and allele frequencies of the GH gene in different camel breeds. Camel breed Falahy Maghrabi Mowaled Somali Sudany Total CC 0.20 0.50 0.10 0.09 0.23 0.22 Genotype frequencies CT 0.40 0.50 0.40 0.18 0.62 0.42 TT 0.40 0.00 0.50 0.73 0.15 0.36 Allele frequencies C T 0.40 0.60 0.75 0.25 0.30 0.70 0.18 0.82 0.54 0.46 0.43 0.57 GTCCTGTGGACAGCTCACCAGCTGTGATGGCTGCAGGTAAGTGCCCTAAAATCCCCTTAGGCTTGATGTGTACG GAAGGGTGATGTGGGGGCCCTGCAGATGGATGGGGCACTAACCTTGGTCTTTGGGGCTTCTGAATGTGAGCGT GGATATCTATGCCCACACATTTGGCTACATTTTAGAAAGGAAGGGCCCCTGGAGCACAGAGAGGGCTGGCAGG AGACGAGGCCTCTGGCTCTCCAGGCCCCTTCCTCGCTGGCCCTCCGGTTCTCTCTCTAGGCCCTCGGACCTCC GTGCTCCTGGCTTTCACCCTGCTCTGCCTGCCCTGGCCTCAGGAGGCGGGTGCCTTCCCAGCCATGCCTCTGT CCAGCCTGTTTGCCAACGCTGTGCTCCGCGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTT GTAAGCTCCTCAGGGATGGGTGCTAGTGGGGGGTGGCAGTAAGGGGTGAACCCACCCCCCTCTGCATAATGGG AGGAAACTAACAAGTTCAGGGGTATCTTATCCAAGTGAAGATGCTGTCAGGTGAGCATAAACTGAGGGGGGCTG TTCTGCATAAAGCAGTGAGGAGGACA Figure 3. Nucleotide sequence of allele C with nucleotide C at position 264 in the amplified fragment. GTCCTGTGGACAGCTCACCAGCTGTGATGGCTGCAGGTAAGTGCCCTAAAATCCCCTTAGGCTTGATGTGTACG GAAGGGTGATGTGGGGGCCCTGCAGATGGATGGGGCACTAACCTTGGTCTTTGGGGCTTCTGAATGTGAGCGT GGATATCTATGCCCACACATTTGGCTACATTTTAGAAAGGAAGGGCCCCTGGAGCACAGAGAGGGCTGGCAGG AGACGAGGCCTCTGGCTCTCCAGGCCCCTTCCTCGCTGGCCCTTCGGTTCTCTCTCTAGGCCCTCGGACCTCC GTGCTCCTGGCTTTCACCCTGCTCTGCCTGCCCTGGCCTCAGGAGGCGGGTGCCTTCCCAGCCATGCCTCTGT CCAGCCTGTTTGCCAACGCTGTGCTCCGCGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTT GTAAGCTCCTCAGGGATGGGTGCTAGTGGGGGGTGGCAGTAAGGGGTGAACCCACCCCCCTCTGCATAATGGG AGGAAACTAACAAGTTCAGGGGTATCTTATCCAAGTGAAGATGCTGTCAGGTGAGCATAAACTGAGGGGGGCTG TTCTGCATAAAGCAGTGAGGAGGACA Figure 4. Nucleotide sequence of allele T with nucleotide T at position 264 in the amplified fragment. The result shows that all tested camel breeds have the three genotypes with different frequencies with the exception of Maghrabi breed which carries only CC and CT genotypes with absence of TT genotype (Table 1). The highest frequencies of three genotypes were present in Maghrabi breed for CC homozygous genotypes (0.50), Sudany breed for CT heterozygous genotype (0.62) and Somali breed for TT homozygous genotype (0.73). The frequencies for alleles C and T ranged from 0.18 to 0.75 and from 0.25 to 0.82, respectively, in tested camel breeds. These three detected genotypes are resulted from the presence of two different alleles; C (Figure 3) and T (Figure 4) in tested camel animals. The sequence analysis of the purified PCR products representing these three detecting genotypes CC, CT and TT declared the presence of a single nucleotide polymorphism (C→T) at position 264 which is responsible for the elimination of restriction site C^CGG and consequently the differen- tiation between these three different genotypes C/C (Figure 5), C/T (Figure 6) and T/T (Figure 7). The nucleotide sequences of camel GH alleles T and C were submitted to nucleotide sequences database NCBI/ Bankit/GenBank and have accession numbers: KP143517 and KP143518, respectively. In the present study, sequence analysis revealed a single nucleotide polymorphism C→T, where nucleotide "C" furnished cutting site for MspI restriction enzyme. Restriction reaction resulted three different genotypes; homozygous without restriction (TT), homozygous with restriction (CC) and heterozygous animals (T/C). The results show significant differences in the allele frequencies between the breeds. This finding agrees with the results of Shah (2006) which explained the significant differences in allele frequencies among Pakistani camel breeds and also the similar results were reported by Ishag et al. (2010) in Sudanese camel breeds where they 756 Afr. J. Biotechnol. Figure 5. Genotype C/C. Figure 6. Genotype C/T. Figure 7. Genotype T/T. studied the RFLP and SNP of GH gene in six Sudanese camel breeds; Kenani, Lahwee, Rashaidi, Anafi, Bishari and Kabbashi. The sequence comparison of Sudanese camel GH sequences with the GenBank sequence identified one SNP 419C>T in intron 1. The Bishari and Anafi breeds that are classified as riding camels with relatively light weight had slightly higher T allele frequencies (0.57 and 0.48, respectively) than those of the other four breeds which are classified as pack camels. On the other hand, other breeds (Kenani, Lahwee, Rashaidi and Kabbashi) have higher body weights with low T allele frequencies (0.30 to 0.33) and El-Aziem et al. high C allele frequencies (0.67 to 0.70). The relationship between GH polymorphism and body weight was evaluated in four Arabian camel breeds (Majaheem, Saheli, Waddah and Homor) by Afifi et al. (2014). Thirteen (13) SNPs (two insertion and 11 substitution) were detected in the Majahem breed and one was detected in the Waddah and Homor breeds each at position 419 (C419T). Two SNPs (C419T and T450C) were detected in the Saheli breed and T450C SNP was associated with increased estimated body weight. Both male and female Saheli camels with the CC genotype had higher body weights than the CT and TT genotypes (P≤0.05). The SNP T450C, which was detected only in camels of the Saheli breed, was correlated with greater body weight. In our study, the frequency of allele C in the Maghrabi breed that is classified as a dual purpose camels was higher (0.75) than those in the other tested four breeds. This allele may be associated with body weight as reported by Shah (2006), Ishag et al. (2010) and Afifi et al. (2014). Consequently, this allele may be considered as a useful marker in the selection of camels for higher growth rate and meat production. It is concluded that only one SNP C→T was detected in GH gene among the five tested camel breeds reared in Egypt and this nucleotide substitution can be used as a marker in different genetic studies including the detection of genetic biodiversity and establishment of phylogenic tree for different camel breeds reared in Egypt. Also, due to the possible association between allele C and higher growth rate, this can be used in marker assisted selection (MAS) for camels and enter the camels possess this allele in breeding program as a way for enhancement of growth trait in camel breeds reared in Egypt. Conflict of interests The authors did not declare any conflict of interest. REFERENCES Afifi M, Metwali EMR, Brooks PH (2014). Association between growth hormone single nucleotide polymorphism and body weight in four Saudi camel (Camelus dromedarius) breeds. Pak. Vet. J. 34(4):494498. Amie Marini AB, Aslinda K, Mohd Hifzan R, Muhd Faisal AB, Musaddin K (2012). HaeIII-RFLP polymorphism of growth hormone gene in Savanna and Kalahari goats. Malays. J. Anim. Sci. 15:13-19. Beauchemin VR, Thomas MG, Franke DE, Silver GA (2006). Evaluation of DNA polymorphisms involving growth hormone relative to growth and carcass characteristics in Brahman steers. Genet. Mol. Res. 5(3):438-447. Boutinaud M, Rousseau C, Keisler DH, Jammes H (2003). Growth hormone and milking frequency act differently on goat mammary gland in late lactation. J. Dairy Sci. 86(2):509-520. Byrne C, Wilson B, Ward K (1987). The isolation and characterization of the ovine growth hormone gene. J. Biol. Sci. 40:459-468. Carnicella D, Dario C, Bufano G (2003). Polimorfismo del gene GH performance productive. Large Anim. Rev. 3:3-7. Daverio S, Di Rocco F, Vidal-Rioja L (2012). The llama (Lama glama) 757 growth hormone gene:Sequence, organization and SNP identification. Small Rumin. Res. 103: 108- 111. Dybus A (2002). Associations of growth hormone (GH) and prolactin (PRL) genes polymorphism with milk production traits in Polish Black and White cattle. J. Anim. Sci. 20:203-212 Ge W, Davis M, Hines H, Irvin K, Simmen R (2003). Association of single nucleotide polymorphisms in the growth hormone and growth hormone receptor genes with blood serum insulin-likegrowth factor I concentration and growth traits in Angus cattle. J. Anim. Sci. 81:641648. Ishag IA, Reissmann M, Peters KJ, Musa LM, Ahmed MK (2010). Phenotypic and molecular characterization of six Sudanese camel breeds. South Afr. J. Anim. Sci. 40:319-326. Katoh K, Kouno S, Okazaki A, Suzuki K, Obara Y (2008). Interaction of GH polymorphism with body weight and endocrine functions in Japanese black calves. Domest. Anim. Endocrinol. 34(1):25-30. Kesseba AM, Wardeh FM, Wilson RT, Zaied AA (1991). Camel applied research and development network. Proceedings of International conference on camel production and improvement, 10-13 December, Tobruk, Libya, 21-36. Louveau I, Gondret F (2004). Regulation of development and metabolism of adipose tissue by growth hormone and the insulin-like growth factor system. Domest. Anim. Endocrinol. 27:241-255. Mahrous KF, Abd-El Mordy M, Abd El-Aziem SH, Hemdan DM (2005). Genetic variations in one-humped camels present in Egypt. J. Genet. Eng. Biotechnol. (NRC) 3(1):15-29. Malveiro E, Pereira M, Marques PX, Santos IC, Belo C, Renaville R (2001). Polymorphisms at the five exons of the growth hormone gene in the algarvia goat: Possible association with milk traits. Small Rumin. Res. 41(2):163-170. Maniou Z (2003). Molecular evaluation of pituitary growth hormone (AJ575419). PhD Thesis, Biological Sciences, University of Sussex, Brighton, UK. Maniou Z, Wallis OC, Wallis M (2004). Episodic molecular evolution of pituitary growth hormone in Cetartidactyla. J. Mol. Evol. 58(6):743753. Marques MR, Santos IC, Carolino N, Belo CC, Renaville R, Cravador A (2006). Effects of genetic polymorphisms at the growth hormone gene on milk yield in Serra da Estrela sheep. J. Dairy Res. 73(4):394405. Miller SM, Dykes DD, Polesky HF (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16(3):1215. Schoenfeld BJ (2010). The mechanism of muscle hypertrophy and their application to resistance training. J. Strength Cond. Res. 24(10):2857-2872 Schwartz H, Dioli M (1992). The one humped camel in eastern Africa: A pictorial guide to diseases, health care and management. Verlag Josef Margraf, Weikersheim, FR Germany. Shah MG (2006). Differentiation of six Pakistani camel breed by phenotype and molecular genetics analysis. University of Agriculture, Faisalabad, Ph.D. Thesis. Sodhi M, Mukesh M, Prakash B, Mishra B, Sobti R, Karn S, Singhand S, Ahlawat S (2007). MspI allelic pattern of bovine growth hormone gene in Indian Zebu cattle (Bosindicus) breeds. Biochem. Genet. 45:145-153 Sustainable Agricultural Development Strategy Towards 2030 (SADS) (2009). Agricultural Research and Development Council. Arab Republic of Egypt, Ministry of Agriculture and Land Reclamation. Oct. 2009. Vize P, Wells J (1987). Spacer alterations, which increase the expression of porcine growth hormone in E. coli. FEBS Lett. 213: 155-158. Yao J, Aggrey SE, Zadworny D, Flan Hayes J, Kiihnlein U (1996). Sequence variations in the bovine growth hormone gene characterized by single-strand conformation polymorphism (SSCP) analysis and their association with milk production traits in Holsteins. Genetics 144:1809-1816 Zhang Y, Xiraigol U, Dugarjav M (2004). Equuscaballus growth hormone gene, complete CDs (AY837571). Department of Biology, Inner Mongolia Agric Univ, Huhhot, Inner Mongolia, PR, China. Vol. 14(9), pp. 758-763, 4 March, 2015 DOI: 10.5897/AJB2013.13518 Article Number: 56CBC4450955 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Characterization of cathelicidin gene from buffalo (Bubalus bubalis) Dhruba Jyoti Kalita Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar-Pradesh, India. Received 29 November, 2013; Accepted 2 February, 2015 Wide spread and indiscriminate use of antibiotics is accompanied by the emergence of microorganism that are resistant to these agents. Therefore, new approaches are required to address the problem of antimicrobial resistance. Epithelial linings of living organisms are the source of various antimicrobial peptides. Keeping this in view, the present experiment was designed to characterize one of the important natural antimicrobial peptide gene, that is, cathelicidin gene from the buffalo (Bubalus bubalis) uterine epithelium and explored its potency for use as template for synthesis of novel antimicrobial agents. Total RNA was isolated from epithelial layer of buffalo uterus and reverse transcribed using designed primers. The amplified PCR product was purified and cloned. Positive clone was sequenced and result was analysed using laser gene software (DNA Star, USA). The cDNA of uterus cathelicidin had 516 bases with complete ORF from 6-452 bp. The predicted pre-propeptide comprised of 148 amino acids. Mature active peptide had 18 amino acids and had five each of arginine and tryptophan and four proline residues. From this study, it can be concluded that the buffalo (Bubalus bubalis) uterus expressed a potent antimicrobial peptide and amino acid sequence of mature peptide can be used as template for synthesis of novel antimicrobial agents. Key words: Antimicrobial peptide, buffalo, cationic peptide and cathelicidin. INTRODUCTION The availability of complete genome sequences and development of information technology have provided a greater opportunity for peptide based drug designing. The field of structure based drug designing is a rapidly growing area and the exposition of genomic, proteomic and structural information has provided new targets and opportunities for drug lead discovery. In the meat industry, the use of antibiotics as growth enhancers is a common practice and extensive use of antibiotic in meat industry causes an alarming increase of antibiotic resistance microbes across the world (Gorbach, 2001). Antibiotic resistance has been posing increasingly serious concern to the public, health specialist and animal food producers. Therefore, there is a need of alternative group of drugs which are active in vivo and are able to act fast and has broad-spectrum activity, do not induce bacterial resistance and have limited or no side effects. Antimicrobial peptides are prevalent throughout the nature as part of the intrinsic defenses of most organisms. These peptides represent ancient host defense E-mail: djkalita@rediffmail.com, kalitadj@vetbifguwahati.ernet.in. Tel: 91-3622337700. Fax: 91-3622337700. Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Kalita molecules and act as key elements in non-specific immunity (Ganz and Lehrer, 1989). Their wide spread distribution throughout the animal and plant kingdoms, suggest that antimicrobial peptides have served a fundamental role in the successful evolution of complex multicellular organisms (Bals, 2000). New strategies are required for synthesis of novel antimicrobial agents to deal with the threat of bacterial resistance (Ravi et al., 2011). Antimicrobial peptides hold promise as broad-spectrum alternatives to conventional antibiotics (Gee et al., 2013). Mamalian defensin and cathelicidin are the two broad classes of natural antimicrobial peptides constitute a large family of endogenous peptide antibiotics with broad spectrum activity against various bacteria, fungi and viruses. Expression of human cathelicidin namely hCAP18 and LL-37 is reported respectively in the reproductive tract (Malm et al., 2000) and skin epithelial cell (Markus et al., 2012). Several β-defensin namely, human β-defensin-4 from testis (Garica et al., 2001), cryptidin from mouse sertoli cells (Grandjean et al., 1997); Bin1b from rat epididymis (Li et al., 2001) has been isolated. Antimicrobial peptide gene from buffalo tongue has been sequenced and characterized (Kalita and Kumar, 2009). Synthesis of different length of natural analogue of buffalo lingual antimicrobial peptide and functional study revealed its potency against both gram positive and negative bacteria (Kalita et al., 2009). However till date, antimicrobial peptide gene in the uterine tract has not been characterized. Keeping this in view, the present study was carried out to characterize the cathelicidin from buffalo (Bubalus bubalis) uterine epithelia to elucidate its potency to use as blue print for novel antimicrobial agents. MATERIALS AND METHODS Sample collection, RNA extraction and RT-PCR A total of five numbers of uteri was collected from apparently healthy buffalo based on the observation and pre rectal clinical examination before slaughter from local abattoir in ice after washing by chilled phosphate buffer saline (pH 7.4). RNA was isolated using TRI Reagent TM (Sigma-Aldrich, USA) following manufacturer protocol. The purity and integrity of RNA was checked spectrophotometrecally (A260/A280) and 1% agarose gel electrophoresis, respectively. Reverse transcription of uterus RNA was done with specific primer designed from published conserve sequences (Accession No.NM_174001, Accession No. NM_174150, Accession No. NM_174831, Accession No.174827) and oligonucleotide sequences for forward 5/GGACCATGCAGACCCAGA 3/ and reverse primers were 5/TGTCCAGAAGCCCGAATC3/). One-Step RT-PCR kit (Qiagen Inc., Chatsworth, CA) was used to carry out the reverse transcription as well as amplification in a single step. The reaction mixture was prepared by adding 5x RT-PCR buffer 10 µl, 10 mM dNTP mixture 2 µl, primer both forward and reverse (20 pmoles/µl) 2 µl each, RT- PCR master enzyme mix 2 µl, template RNA (50 ng/µl) 5 µl and nuclease free water 27 µl. The different cycle condition in PCR was: reverse transcription for 30 min at 759 50°C, initial PCR activation for 15 min at 95°C, denaturation for 1 min at 94°C, annealing for 1 min at 52°C and extension for 45 s at 72°C (35 cycles) and final extension was done at 72°C for 5 min. 1.0% agarose gel electrophoresis was performed for confirmation of amplified PCR product and specific product was purified by ‘DNA Elution Kit’ (Sigma - Aldrich, USA. Cloning, sequencing and in silico analysis The purified PCR product was ligated to pGEM-T Easy (Promega, Madison, USA) cloning vector and transformed into freshly prepared E. coli DH5 competent cells (Chung et al., 1989). Plating was done on LB agar containing ampicillin (50mg/ml), IPTG and X-gal (25 mg/ml). The plates were incubated for overnight at 37°C and white recombinant colonies were picked up after completion of incubation period. Plasmids were isolated (Sambrook and Russel, 2001) from the overnight grown culture and insert release was confirmed by EcoR1 digestion. The positive recombinant plasmids of five clones were sequenced and analyzed using Lasergene Software (DNA Star, USA) with other published sequences. The amino acid sequence was predicted and the amino acid distribution in different domain was analyzed using clustal W analysis programme (DNA Star, USA). RESULTS The yield of isolated total RNA from epithelial layer of uterus was 24.6 µg per mg of tissue and A 260/A280 was 11.87. All the three bands (28S, 18S and 5S) of RNA was revealed in 1% agarose gel electrophoresis. RT-PCR product of total RNA gave a specific product of approximately 516 bp of cathelicidin gene. The purified product was cloned in pGEM-T Easy (Promega, Madison, USA) cloning vector (Figure 1). The sequence result of uterus cathelicidin has been submitted to NCBI gene data bank and Accession No. EF 050433 has been offered for the sequence). Buffalo uterus cathelicidin cDNA have full length ORF region from 6-452 and code pre-propeptide of 148 amino acids (Figure 2). The ORF region of buffalo uterus and testis (Accession No. DQ832665) cathelicidin differs by 18 nucleotides at 8, 20, 25, 26, 28, 84, 108, 147, 179, 183, 186, 203, 276, 277, 284, 377, 416 and 436. The buffalo myeloid indolicidin (AJ812216) was varied by 32 nucleotides with buffalo uterus cathelicidin sequence. At nucleotide level, uterine cathelicidin showed similarity of 95.7% and 91.0% with testis cathelicidin and indolicidin, respectively (Figure 3). Similarly, buffalo uterine cathelicidin shared 70.7, 79.2, 89.9, 71.8, 69.1, 72.3 and 81.0% of identity with Bos taurus CATHL1, 2, 4, 5, 6, 7 and CAMP, respectively (Figure 3). The predicted pre-propeptide of buffalo uterus cathelicidin precursor peptide contain 20 strongly basic, 19 strongly acidic, 48 hydrophobic and 42 polar amino acids. The amino acid alignment with different buffalo cathelicidin congeners revealed 120 conserved amino acids (Figure 4). Four additional amino acids (132 to 135) were observed in both uterine cathelicidin as compared to buffalo indolicidin. The deduced amino acid sequences 760 Afr. J. Biotechnol. Figure 1. 1.0% Agarose gel electrophoresis of cloned uterus cathelicidin cDNA. M, 100 bp ladder; L1, 516 bp RTPCR product; L2, Purified RT-PCR product; L3, Undigested recombinant plasmid; L4, EcoR1 Digested Recombinant Plasmid showing the release of insert of 516 bp. atg cag acc cag agg gcc agc ctc tcg ttg ggg cgg tgg tca ccg tgg ctt ctg ctg ctg ggg ctt M Q T Q R A S L S L G R W S P W L L L L G gtg tcc tcg acc agt gcc cag gac ctc agc tac agg gag gcc gtg ctt cgt gct gtg gat cag V S S T S A ↑ Q D L S Y R E A V L R A V D Q L gtg 69 V 23 ctc aat 138 L N 46 gag cgg tcc tca gaa gct aat ctc tac cgc ctc ctg gag cta gac ccg cct ccc aag gat gat gca gat 207 E R S S E A N L Y R L L E L D P P P K D D A D 69 ctg ggc act cga aag cct gtg agc ttc acg gtg aag gag act gtg tgc ccc agg acg act cag cag ccc 276 L G T R K P V S F T V K E T V C P R T T Q Q P 92 acg gag cgg tgt gac ttc aag gag gaa ggg cgg gtg aag cag tgt gtg ggg aca gtc acc ctg gac ccg 345 T E R C D F K E E G R V K Q C V G T V T L D P 115 tcc aat gac cag ttt gac cta aac tgt aat gag ctc cag agt gtc agg ata cgc ttt cca tgg cca tgg 414 S N D Q F D L N C N E L Q S V ↓ R I R F P W P W 138 cca tgg cca tgg tgg cgc aga ttc cga ggt tga 447 P W P W W R R F R G * 148 Figure 2. Nucleotide and amino acid sequence of buffalo uterus cathelicidin (Accession No. EF 050453). Single under line indicates the nucleotide sequence of cathelicidin and double underline of single letter indicates the corresponding amino acid sequence. Numbering in the left shows the numbers of nucleotide (bold) and amino acids (italic) respectively. The putatitive cleavage site of the signal sequence (↑) and prosequence (↓) is indicated by an arrow, the stop codon by an asterisk. The mature peptide is shown on boldface. Kalita 761 Figure 3. Percent divergence and similarity of buffalo uterine cathelicidin at nucleotide level with different published cathelicidin sequences. Figure 4. Alignment of amino acid sequence of buffalo uterus cathelicidin with buffalo testis and indolicidin. The consensus residues were included within the same box. of cathelicidin showed 31 conserved amino acids with different species of animals. The percentage similarity and divergence of uterine cathelicidin with publish sequences at amino acid level is depicted in the Figure 5. The uterine cathelicidin had 91.9% amino acid similar with testis and 85.5% with buffalo indolicidin. Similarly, the amino acid sequence of uterine cathelicidin shared a similarity of 65.1, 76.5, 85.5, 63.8, 65.1, 65.8 and 75.2% 762 Afr. J. Biotechnol. Figure 5. Percent divergence and similarity of buffalo uterine cathelicidin at amino acid level with different published cathelicidin sequences. with Bos taurus CATHL 1, 2, 4, 5, 6, 7 and CAMP, respectively. DISCUSSION The nucleotide sequence of uterine cathelicidin showed a highly conserve 5' nucleotides region and a limited similarity in 3' region with other published sequences, which is the common structural features of the cathelicidin gene (Ganz et al., 1989; Storici and Zanetti, 1993). The deduced pre-propeptides of uterus cathelicidin cDNA had conserved N-terminal and diverse heterogeneous C-terminal was in agreement with other cathelicidin congeners (Popsueva et al., 1996; Wu et al., 1999). Alanine at 29 was conserved in most of the congeners and it might be the probable site of elastase mediated proteolytic cleavage to separate the signal sequence from the prosequence. The signal sequence of uterine cathelicidin comprised of 1-29 hydrophobic stretch of amino acid residues and corroborated with other congeners (Storici et al., 1992; Das et al., 2006). Valine at 130 was common to all most all pre-propeptide including uterine cathelicidin indicating the common processing sites to yield the mature carboxyl terminal peptides (Storici and Zanetti, 1993; Skerlavaj et al., 1996). The prosequence of uterine cathelicidin comprised of 101 amino acid residues from 30 to 130 residues, which are highly identical to the cathelin motif, an inhibitor of thiol proteases (Ritonja et al., 1989). The cathelin like prosequence is the hallmark for all cathelicidin as it prevents the tissue injury and inflammation by neutralizing the high cationic charge of mature peptides by the presence of clusters of negatively charged amino acids (Storici et al., 1992; Selested et al., 1992; Ganz, 1989). The cathelin domains also have anti-protease activity and thus confer stability during storage (Ganz, 1989). Uterine cathelicidin had 18 amino acid residues in the mature peptide from 131 to 148. The glycine was the last residues in most of the congeners along with the uterine cathelicidin and it might probably act as amide donor in post translation amidation of the C-terminus (Skerlavaj et al., 1996; Bradbury, 1991). The C-terminal amidation is essential for its optimum antimicrobial activity which increases the lipolysaccharide binding ability and enhances the outer membrane permeabilization (Sitaram and Nagaraj, 1999; Timothy and Roberte, 1997, Peters et al., 2010). The C-terminal amidation of peptides provides an additional hydrogen bond for α-helix stabilization (Dennison et al., 2005). The amino acid sequence of uterine cathelicidin had 4 extra stretch of amino acids namely arginine, phenylalanine, proline and tryptophan from 133 to 136, respectively. Thus, the mature peptide of uterine cathelicidin had 5 arginine, 5 tryptophan and 4 proline. The positively charged arginine is essential to initiate interaction with negatively charged outer bacterial surface (Timothy and Roberte, 1997; Boman, 1991). The tryptophan influences the localization of these peptides in to membrane interfaces (Schiffer et al., 1992). Proline is an important amino acid that enhances the microbicidal activity by forming flexible helical kink and more ordered structure, which increases membrane permeability (Park et al., 2002). Besides, prolines also provide Kalita some protection against nonspecific proteolytic degradation of proteases secreted by microorganisms (Vanhoof et al., 1995). Peptide rich in arginine, trypto-phan and proline are shown to have strong microbicidal activity against gram positive and gram negative bacteria (Selested et al., 1992), fungi (Subbalakshmi and Sitaram, 1998) and virus (Robinson(jr) et al., 1998). Expression of antimicrobial peptide with high number of arginine along with tryptophan and proline by buffalo uterine epithelium help this species to be free from several infectious reproductive disorders as compared to cattle and other species. The mature peptide domain had more variation compared to other region and it is attributed as, genes involved in immunity and host defense is rapidly diverged and had undergo positive selection to fight competently in antigerm war (Emes et al., 2003; Crovella et al., 2005). Conclusion From the present study it can be concluded that, mature amino acids sequence of uterine cathelicidin is comprise of 5 arginine, 5 tryptophan and 4 proline residues and the domain can serve as blue print for synthesis of a novel antimicrobial agent. Conflict of interest The authors have not declared any conflict of interest. REFERENCES Bals R (2000). Epithelial antibacterial peptides in host defense against infection. Resp. Res. 1:141-150. Boman HG (1991). Antibacterial peptides: Key components needed in immunity. Cell, 65: 205-207. Bradbury AF, Smyth DG (1991). Peptide amidation. Trend. Biochem. Sci. 16:112-115. Chung CT, Niamela SL, Miller RH (1989). One-step preparation of competent Eschericia coli: transformation and storage of bacterial cells in the same solution. Proced. Natur. Acad. Sci. 86:2172-2175. Crovella S, Antcheva N, Zelezetsky I, Boniotto M, Pacor S, Vittoria M, Tossi A (2005). Primate β-defensins structure-function and evolution. Curr. Pro. Pept. Sci. 6:7-21. Das H, Sharma B, Kumar A (2006). Cloning and characterization of novel cathelicidin cDNA sequence of Bubalus bubalis homologus to Bos taurus cathelicidins- 4. DNA Seq. 17:407-414. Dennison SR, Wallace J, Harris F, Phoenix D (2005). Amphiphilic αHelical Antimicrobial Peptides and Their Structure/ Function Relationships. Pro. Pept let. 12:31-39. Emes RD, Goodstadt L, Winter E, Ponting CP (2003). Comparison of genomes of human and mouse lays the foundation of genome zoology. Hum. Mol. Gen. 12:701-709. Ganz T, Lehrer R (1989). Antibiotics peptides from higher eukaryotes: biology and applications. Mol. Med. Today. 5:292-297. Ganz T, Rayner JR, Valore EV, Tumolo A, Talmadge K, Fuller F (1989). The structure of the rabbit macrophage defensin genes and their organ-specific expression. J. Immunol. 143:1358-1365. Garica JR, Krause A, Scchulz S (2001). Fimpong-Boateng A. Human beta defensin 4: a novel inducible peptide with a specific saltsensitive spectrum of antimicrobial activity. Feder. Americ. Soc. Exp. Biol. Lett. 15:1819-1821. Gee ML , James, AG , Hossain MA, McArthur S, Palombo EA, Wade JD, Clayton AH (2013). Imaging the action of antimicrobial peptides on living bacterial cells. Sci. Reports. 3:1557 763 Gorbach SL (2001). Antimicrobial use in animal feed: ime to stop. N. Engl. J. Med. 345:1202-1203. Grandjean V, Vincent S, Martin L, Rassoulzadegan M, Cuzin F (1997). Antimicrobial protection of the mouse testis : Synthesis of defensin of the cryptdin family. Biol. Reprod. 57:1115-1122. Li P, Chang Chan H, He Bin, Cheung SOS, Chung YW, Shang Q, Zhang Y, Zhang Y (2001). An antimicrobial peptide gene found in the male reproductive system of rats. Sci. 291:1783-1785. Malm J, Sorenson O, Persson T, Nilsson F, Johansson B, Bjartell A, Lilja H, Borregard M, Engstein AQ (2000). The human cationic Antimicrobial protein (h CAP-18) is expressed in the epithelium of human epididymis, is present in the seminal plasma at high concentration and is attached to spermatozoa. Infec. Immun. 68:4297-4302. Markus Reinholz MD, Thomas Ruzicka MD, Jürgen Schauber MD (2012). Cathelicidin LL-37: An Antimicrobial Peptide with a Role in Inflammatory Skin Disease. Ann. Drmato. 24:126-135. Park S, Kim H, Kim C, Yun H, Choi E, Lee B (2002). Role of proline, cysteine and disulphide bridge in the structure and activity of the antimicrobial peptide gaegurin5. Biochem. J. 368:171-182. Peters BM, Shirtliff, EM, Jabra-Rizk MA (2010). Antimicrobial Peptides: Primeval molecules or future Drugs? Pathogens 6:1-4. Popsueva A, Zinovjeva M, Visser J, Zijilmans J, Fibbe W, Belyavsky A (1996). A novel murine cathelin-like protein expressed in bone marrow. Feder. Am. Soci. Exp. Biol. Lett. 391:5-8. Ravi C, Jeyashree AR, Devi K (2011). Antimicrobial Peptides from Insects: An Overview. Res. Biotech. 2:1-7. Ritonja A, Kopiter M, Jerala R, Turk V (1989). Primary structure of a new cysteine proteinase inhibitor from pig leucocytes. Feder. Am. Soci. Exp. Biol. Lett. 255:211-214. Robinson WE (Jr), McDougall B, Tran D, Selested ME (1998). Anti-HIV1 activity of indolicidin, an antimicrobial peptide from neutrophils. J. Leuk. Biol. 63:94-100. Sambrook J, Russel T (2001). Preparation of plasmid DNA by alkaline lysis with SDS :Minipreparation.Molecular Cloning:A Laboratory Manual. 3rd Edition. (Cold Spring Harbor, NY). pp. 1.32-1.34. Schiffer MCH, Chang CH, Stevens J (1992). The functions of tryptophan residues in membrane proteins. Pro. Eng. 5:213-214. Selested ME, Novotny MJ, Morris WL, Tang YQ, Smith W, Cullor JS (1992). Indolicidin, a novel bactericidal tridecapeptide amide from neutrophils. J. Biol. Chem. 267:4292-4295. Sitaram N, Nagaraj R (1999). Interaction of antimicrobial peptides with biological and model membranes: structural and charge requirements for activity. Biochem. Biophys. Acta. 1462:29-54. Skerlavaj B, Gennaro R, Bagella L, Merluzzi L, Risso A, Zanetti M (1996). Biological characterization of two novel cathelicidin-derived peptides and identification of structural requirements for their antimicrobial and cell lytic activities. J. Biol. Chem. 271:28375-28381. Storici P, Schneider C, Zanetti M (1992). cDNA sequence analysis of an antibiotic dodecapeptide from neutrophils. Feder. Ameri. Soci. Exp. Biol. Lett. 314:187-190. Storici P, Zanetti M (1993). A cDNA derived from pig bone marrow cells predicts a sequence identical to the intestinal antibacterial peptide, pR-39. Biochem Biophy. Res. Commun. Sci. 196:1058-1065. Subbalakshmi C, Sitaram N (1998). Mechanism of antimicrobial action of Indolicidin FEMS Microbiol. Lett. 160: 91-96. Timothy J, Robert EWH (1997). Improved Activity of a Synthetic Indolicidin Analog. Antimicrob. Agent. Chemo. 41: 771-775. Vanhoof G, Goossens F, Meester ID, Hendriks D, Scharpe S (1995). Proline motifs in peptides and their biological processing. Feder. Am. Soci. Exp. Biol. J. 9:736-744. Wu M, Maier E, Benz R, Hancock RE (1999). Mechanism of different classes of cationic antimicrobial peptides with planer bilayers and with the cytoplasmic membrane of Escherichia coli. Biochem. J. 38:7235-7248. Vol. 14(9), pp. 764-773, 4 March, 2015 DOI: 10.5897/AJB2015.14405 Article Number: CBEFAFC50957 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Bacterial mediated amelioration of drought stress in drought tolerant and susceptible cultivars of rice (Oryza sativa L.) Yogendra Singh Gusain1*, U. S. Singh2 and A. K. Sharma1 1 Department of Biological Sciences, G. B. Pant University of Agriculture and Technology, Pantnagar, Uttarakhand, 263145, India. 2 International Rice Research Institute (IRRI) Office NASC Complex, Pusa New Delhi, 110012, India. Received 5 January 2015; Accepted 23 February, 2015 In the present study, plant growth promoting rhizobacterial (PGPR) strains Pseudomonas fluorescence strain P2, Pseudomonas jessenii R62, Pseudomonas synxantha R81, Bacillus cereus BSB 38 (14B), Arthrobacter nitroguajacolicus strainYB3 and strain YB5 were tested for their role in enhancing plant growth and induction of stress related enzymes in Sahbhagi (drought tolerance) and IR-64 (drought sensitive) cultivars of rice (Oryza sativa L.) under different level of drought stress. PGPRs, P. jessenii, R62, P. synxantha, R81 were used as one consortium similarly A. nitroguajacolicus strainYB3 and strain YB5 were used as other consortia. Most of the PGPR inoculated plants showed enhanced growth as compared to uninoculated plants under all the level of drought stress. Quantitative analyses of antioxidant enzymes indicated that majority of the PGPRs inoculated plants in both varieties showed higher proline content, higher activity of superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), ascorbate peroxidase (APX) and lower level of hydrogen peroxide (H 2O2), malondialdehyde (MDA) in leaves at all the level of drought stress. The study suggests that PGPRs alleviates oxidative damage in rice plants grown under drought by improving plant growth and activating antioxidant defense systems, thereby improving stability of membranes in plant cells. This study provides evidence for a beneficial effect of PGPRs application in enhancing drought tolerance of rice under water deficit conditions. Key words: Plant growth promoting rhizobacterial (PGPR), plant growth promotion, drought stress, antioxidant, rice. INTRODUCTION Rice (Oryza sativa L.) is the staple food consumed by more than half of the world population and fulfills 23% of their caloric demands (Khush, 2003). Rice has semi- aquatic nature and grown under flooded condition conventionally to provide nutrient supply and bulky amounts of water. However due to insufficient water, *Corresponding author. E-mail: ygusain99@gmail.com. Tel: +919456532064. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Gusain et al. half of the rice areas in the world do not maintained flooded condition and thus reduced yield, to some extent, as a result of drought (Bernier et al., 2008). Rice with little adaptation under water limited condition is remarkably sensitive to drought stress (Kamoshita et al., 2008). Under varieties of environmental stress including drought, plants showed increased level of reactive oxygen species (ROS) (Sgherri et al., 1996), which includes superoxide ._ radical (O2 ), hydroxyl free radical (OH), hydrogen peroxide (H2O2) and singlet oxygen resulting in peroxidation of lipids, denaturation of proteins, mutation of DNA and various types of cellular oxidative damage (Smirnoff, 1993). Enhanced membrane lipid peroxide-tion takes place in both cellular and organelle membranes when ROS reaches above threshold level, which, in turn affect normal cellular functioning and act as an indicator of ROS mediated damage to cell membranes under stressful conditions (Mishra et al., 2011) and can be measured by malondialdehyde (MDA) content, one of the final products of peroxide-tion of unsaturated fatty acids in phospholipids of membrane (Halliwell and Gutteridge, 1989). Plant cells are protected against damaging effect of ROS by antioxidant defense system comprising enzymatic and non enzymatic component. In enzymatic component superoxide dismutase (SOD) catalyses the conversion of superoxide radical into H 2O2 through their varietal isoforms; catalase (CAT) removes the bulk of H2O2 generated by photorespiration in peroxysomes; peroxidase (POD) acts on H2O2 for substrate oxidation in vacuole, cell wall and cytosol; ascorbate peroxidase (APX) is localized in cytosol and various organelles and catalyses the conversion of H 2O2 into H2O and thus protected plants against detrimental effect of ROS (Noctor and Foyer, 1998). Usually, higher antioxidant activity in plants correlated with enhance resistant against stress (Sairam and Srivastava, 2001). Plant growth promoting Rhizobacteria (PGPR) is well known for their growth-promoting properties like production of phytohormones, ability to solubilize mineral phosphate and to antagonize plant pathogens, etc. (Glick, 1995). PGPR like Pseudomonas fluorescens and Bacillus subtilis, recently have obtained attention as inoculants to withstand plants under varied biotic and abiotic stress conditions because of their excellent root colonizing ability, versatility in their catabolic activity, and their capacity to produce a wide range of metabolites and enzymes (Mayak et al., 2004; Saravanakumar and Samiyappan, 2007). Several authors have suggested the possible role of PGPRs to alleviate the oxidative damage elicited by abiotic stress through the manipulation of antioxidant enzymes in different crops (Kohler et al., 2008; Sandhya et al., 2010; Saravanakumar et al., 2011). In present study we selected the Pseudomonas strain R62 and R81 because of their importance as a biofertilizer 765 under field condition (Mader et al., 2011; Roesti et al., 2006). The Arthrobacter nitroguajacolicus were used as the ability of Arthrobacter species to showed resistance against desiccation, starvation and other stresses (Mongodin et al., 2006); and Bacillus and Pseudomonas has their importance in previous study to withstand plants under varied biotic and abiotic stress conditions (Mayak et al., 2004; Saravanakumar and Samiyappan, 2007). All the selected PGPRs were tested for their plant-growth promoting ability as well as their role in stress related enzymatic adaptive mechanisms in terms of antioxidant enzymes in tolerant and susceptible varieties of rice under drought stress. MATERIALS AND METHODS Bacterial inoculants For the study, plant growth promoting bacterial strains Pseudomonas jessenii (R62), Pseudomonas synxantha (R81) (Mader et al., 2011; Roesti et al., 2006), two strains of Arthrobacter nitroguajacolicus, strainYB3 and YB5 (Gusain et al., 2015), Bacillus cereus BSB 38 (14B), and Pseudomonas fluorescence strain P2 were kindly provided by Rhizosphere biology lab of the Department of Biological Sciences of G. B. Pant University of Agriculture and Technology Pantnagar. In this study R62 and R81 were used as consortium (R62+R81), similarly both the strains of A. nitroguajacolicus YB3 and YB5 were used as consortium (A3+A5). All these strains grow separately in nutrient broth medium (Himedia, India) in flasks incubated at 28°C at 120 rpm until the late exponential phase. The final culture cfu was maintained at 10 7 to 108 cfu ml−1 level. Rice varieties Seeds of two genotype of rice, drought tolerant Sahbhagi (Mackill et al., 2010) and drought susceptible IR-64 (Singh and Ghosh, 2013) were kindly provided by the IRRI, Pusa New Delhi, India. Pot experiment Rice growth promotion by these bacterial strains under drought stress was performed in greenhouse condition (temperature: 27±2°C, photo period: 16/8 h day/night cycle, light intensity: 400 Em-2s-1, (400-700 nm), and relative humidity: 60%, respectively). Rice seeds were surface disinfected by immersion in 70% ethanol and 3% (v/v) sodium hypochlorite for 1 and 5 min. Seeds were washed thoroughly many times with sterile distilled water then germinated on sterilized Petri dish. The soil used for the experiment had pH 8.31, organic carbon of 1.2%, nitrogen of 186.7 kg/h, phosphorus of 34.91 kg/h, and potassium of 145.6 kg/h. Five hundred grams of the sterilized soil was filled in pots and watered to field capacity before sowing the seeds. At the time of sowing seeds in pots the bacterial inocula were given to 1 ml/pot. Two seedlings per pot were maintained. After 30 days of sowing, 10 ml of nutrient solution (Hoagland and Arnon, 1950) were given weekly to each pot to fulfill the nutrients requirements of the plants. The nine replicate of each treatment (including control) were arranged according to the complete randomized design. After 55 days of sowing, the pots were irrigated up to water holding capacity of soil and left for drought 766 Afr. J. Biotechnol. stress by withholding the irrigation. Leaf rolling in drought stress was determined based on rice standard evaluation system developed by International Rice Research Institute (IRRI). A visual score was taken of the degree of leaf rolling using a 0 to 9 scale (leaf rolling at vegetative stage) with 0 leaves for healthy while 9 for leaves tightly rolled V-shape. The plants were subjected to harvest at 0, 5 and 9 stages of leaf rolling (0, 8 and 10 days of drought) with three replicate, out of nine replicate, at each stage randomly selected for the measurement of growth promoting trait and antioxidant enzyme activities. After harvesting, fresh weight were taken immediately and sample were placed in -80°C for determination of antioxidant activity. Soil water content (SWC) for each harvesting was calculated using the weight fraction: SWC (%) = [(FW-DW)/DW] × 100, where FW was the fresh weight of a soil portion of the middle part of each pot and DW was the dry weight of the soil portion after drying in a hot air oven at 80°C for 48 h or till the complete drying of soil (Cha-um et al., 2012). Estimation of chlorophyll and carotenoid content Concentration of total chlorophyll and carotenoid was analysed following the method of Arnon (1949). Estimation of H2O2, MDA and proline For estimation of H2O2 and MDA content, leaf material (0.3 g) was homogenized in 4 ml of 0.1% trichloroacetic acid (TCA). Homogenate was centrifuged at 10,000 x g for 10 min at 4°C. MDA content was determined according to procedure of Heath and Packer (1968). The concentration of MDA was calculated by using an extinction coefficient of 155 mM-1 cm-1. Hydrogen peroxide was measured according to Alexieva et al. (2001). The amount of H 2O2 was calculated using standard curve prepared with different dilutions of a working standard of 100 M of H2O2. Free proline was determined by the method of Bates et al. (1973). Estimation of anti-oxidative enzyme For assays of SOD, CAT and POD, 0.5 g leaf samples (fresh weight) was homogenized with a pestle in an ice-cold mortar in 5 ml cold buffer containing: 50 mM potassium phosphate buffer (PH 7.0), 1 mM ethylene diamine tetra acetic acid (EDTA) and 1% (w/v) polyvinylpyrolidone (PVP). Whole extraction procedure was carried out at 4°C. The homogenate was centrifuged at 10,000 x g for 30 min at 4°C and the supernatant collected was used to assay enzymatic activity. For determination of APX activity 0.4 g leaf sample were homogenised in 4 ml of of ice-cold 25 mM phosphate buffer (pH 7-8) containing 1% PVP and 0.2 mM EDTA. The homogenates were filtered, and then centrifuged at 4°C for 15 min at 18000 g. All the antioxidant enzymes were determined as described by Zhang and Kirkham (1996). Protein concentration in the enzyme extract was determined by the method of Bradford (1976) using bovine serum albumin as a standard. Statistical analysis The data presented here are mean values ± SD. The data of individual stress level has three replicate (n=3) for each treatments of individual variety. The data were subjected to factorial analysis of variance (ANOVA), with varieties, stress level and treatments used for analysis and the differences between the means were compared using least significant differences at p<0.05. Different letters denote significant differences among treatments (including control) in two varieties. RESULTS AND DISCUSSION The plants were harvested at 0 days, 8 days and 10 days of drought and all these stages the soil moisture content of pot were measured as 640 ± 17.83, 62 ± 03.09 and 37 ± 03.30% respectively. Plant growth parameters The treatments showed varied effect on the shoot length, root length, shoot fresh weight and root fresh weight under all the level of drought stress. However, in majority of the inoculated plants showed higher effect on growth parameters as compare to uninoculated plants, although most of the differences are not significant. Irrespective of bacterial inoculation and stress level Sahbhagi showed enhanced effect on growth parameters as compared to IR-64 (Table 1). The PGPR can show the various kind of the plant growth promoting (PGP) activities which may be the mechanism through which they influence the plant growth promotion (Glick, 1995). The inoculation effect of our bacterial isolates had remarkable positive effect on plant fresh weight under non stress and stress condition. The higher growth enhancement effect of Sahbhagi as compared to IR-64 under drought stress might be related with better stress tolerance characteristics of the variety. Various study indicated that PGPRs inoculated plants can take up a higher volume of water and nutrients from rhizosphere soil; the attributes could be useful for the growth of plants under drought stress (Alami et al., 2000). However, the highest benefits of the PGPRs as bioinoculants can occur when crops faced prolonged stressful condition (Egamberdiyeva and Hoflich, 2004). Chlorophyll and carotenoid content In the present study, a gradual decrease in chlorophyll and caretenoid content was found with stress in both varieties. Similar to the growth parameters, majority of the treatments showed enhanced chlorophyll and carotenoid contents over control under all the level of stress (Table 2). The enhanced chlorophyll content may increase the photosynthetic efficiency of inoculated plants, and thus may be a reason for the tolerance of abiotic stress. Increased chlorophyll and caretenoid content in plants inoculated with PGPR is supported by previous study (Gururani et al., 2013) where authors found improved photosynthetic performance in Solanum Gusain et al. 767 Table 1. Growth promoting effect of PGPRs on two cultivars of rice under 0, 8 and 10 days of drought stress. Rice cultivar Inoculants Sahbhagi Control P2 R62+R81 14B A3+A5 Shoot length (cm) 0 days 8 days 10 days ab ab a 70.87 67.33 65.17 b bc bc 71.92 73.5 74.67 bc c c 76.43 79.83 79.17 bc bc bc 77.63 76.00 73.17 bc bc b 75.47 72.83 71.83 IR-64 Control P2 R62+R81 14B A3+A5 69.62 ab 71.20 ab 70.70 ab 70.63 ab 70.20 ab ab 65.83 ab 67.50 a 64.83 ab 68.17 ab 65.67 ab 67.67 ab 68.67 ab 70.00 ab 69.83 ab 68.17 Root length (cm) 0 days 8 days 10 days ab a ab 22.83 20.17 20.67 b ab ab 24.67 21.67 22.97 b ab ab 24.87 21.60 23.30 b ab ab 24.00 21.20 21.63 ab b ab 23.37 21.33 23.63 ab 21.50 ab 25.53 b 24.17 b 24.07 ab 21.60 ab 20.70 ab 23.03 ab 21.13 ab 22.30 ab 21.23 ab 20.63 ab 22.97 ab 21.53 ab 20.87 ab 22.30 Shoot Fresh wt (g/pot) 0 days 8 days 10 days f d ab 10.45 6.33 3.53 g e bc 12.32 7.46 4.41 g e c 12.86 7.60 4.67 g e bc 12.78 7.49 4.10 g e bc 12.34 7.07 4.32 f bc 10.25 g 12.43 g 12.85 g 12.57 g 12.97 4.26 cd 5.42 cd 5.54 c 5.01 c 5.13 a 2.69 b 3.66 b 3.68 ab 3.21 ab 3.24 Root fresh wt (g/pot) 0 days 8 days 10 days ef c ab 6.67 2.68 1.07 gh d b 8.24 3.68 1.35 h d b 8.37 3.64 1.56 g cd b 7.67 3.14 1.23 g cd b 7.68 3.07 1.31 e 6.01 fg 7.14 gh 7.79 fg 7.40 f 6.93 Mean followed by same letter are not significantly different (P<0.05) for a particular trait in two cultivars at all the level of stress. Table 2. Effect of PGPRs on total chlorophyll and carotenoids content of two cultivars of rice under 0, 8 and 10 days of drought stress. Rice cultivar Inoculants Sahbhagi control P2 R62+R81 14B A3+A5 IR-64 control P2 R62+R81 14B A3+A5 Total chlorophyll (mg/g fresh weight) 0 days 8 days 10 days f d ab 4.81 3.17 1.74 f e bc 5.11 3.62 1.90 h e bc 5.96 3.73 2.04 i e c 6.13 3.78 2.26 j e c 6.59 3.89 2.35 g 5.54 g 5.21 g 5.22 i 6.14 i 6.15 d 3.12 e 3.58 e 3.60 de 3.40 e 3.62 a 1.41 ab 1.59 ab 1.77 ab 1.76 b 1.88 Carotenoids (mg/g fresh weight) 0 days 8 days 10 days g d a 11.75 8.51 6.11 gh ef bc 12.02 9.91 6.88 h e bc 12.27 9.55 6.97 h ef c 12.37 10.05 7.16 gh ef bc 12.22 9.86 6.92 h 12.55 gh 12.00 gh 12.07 h 12.49 h 12.49 f 10.35 f 10.15 f 10.35 f 10.53 f 10.39 a 6.07 b 6.63 bc 6.99 c 7.59 ab 6.41 Mean followed by same letter are not significantly different (P<0.05) for a particular trait in two cultivars at all the level of stress. ab 1.07 b 1.26 b 1.42 b 1.17 ab 1.07 a 0.46 ab 0.63 ab 0.71 ab 0.53 ab 0.63 768 Afr. J. Biotechnol. Figure 1. (a) H2O2 (b) MDA and (c) Proline content of two genotype of rice inoculated with PGPRs under 0, 8 and 10 days of drought stress. Mean followed by same letter are not significantly different (P<0.05) for a particular trait in two cultivars at all the level of stress. tuberosum when inoculated with Bacillus sp. under abiotic stress. Hydrogen peroxide content Among all the treatments, P2 treated plants in Sahbhagi and IR-64 showed maximum reduction in H2O2 level with th 1.17 and 1.59 fold respectively, over control in 8 days of th drought. In 10 days of drought, only R62+R81 treated plants in Sahbhagi with 1.15 fold reduction showed significant effect on H2O2 level, while in IR-64, all the PGPRs treated plants significantly reduced the H 2O2 level over control plants (Figure 1a). Under drought, increased level of H2O2 was well documented which may be due to the formation of superoxide ion by electron transport Gusain et al. chains which dismutase to form H2O2 in chloroplast and mitochondria (Elstner, 1991). However H2O2 may also be involved for the formation of highly reactive hydroxyl radicals by reacting with superoxide radicals in plants cells (Prousek, 2007) which can initiate self- replicating reactions leading to peroxidation of membrane lipids and destruction of proteins, and ultimately cell death (Jaw and Ching, 1998). Here the level of H2O2 in plants gradually increased with increase in stress level, however the results indicated that treated plants of both varieties showed the reduced level of H2O2 as compared to their respective control, although the difference were not significant in all the treatments. In this study, irrespective of treatments and stress level, Sahbhagi showed the reduced (35.27%) level of H2O2 as compared to IR-64, which might be an attribute of a tolerance variety to cope with drought stress. It is believed that under drought stress, PGPRs treated plants showed the high amount of reactive oxygen species (ROS) scavenging agent which may help plants to maintain the reduced level of H 2O2 (Moslemi et al., 2011). Malondialdehyde content th In 0 and 8 days of stress there was non-significant effect th of the treatments over the control while at 10 days of stress all the bacterial treatment significantly reduced the MDA content when compared with control in both varieties (Figure 1b). MDA is one of the byproducts of lipid peroxidation, which is one of the consequences of higher accumulation of ROS such as H2O2, superoxide radical and hydroxyl radical in plant cell and could reflect the degree of peroxidation of membrane lipids (Gill and Tuteja, 2010). Here under severe drought both varieties showed higher MDA content in leaves which may be associated with higher accumulation of H2O2 in stressed plants. However the PGPRs treated plants in both varieties showed remarkably lesser amount of MDA content as compared to their respective control, suggesting the involvement of PGPRs in ROS metabolism in rice plants. In overall, irrespective of treatments and stress level sahbhagi performed better with 81.53% lesser MDA content as compared to IR-64. This might be an attribute of tolerant variety that helps to sustain it under prolonged environmental stress condition. Less MDA content in drought tolerance Phaseolus acutifolius as compared to sensitive ones have also been obtained by El-Tayeb (2006). Proline accumulation In plants with 0 days of stress, bacterial inoculation was non-significant over the control while in stressed, all the 769 PGPRs treated plants except R62+R81 treated plants of th Sahbhagi in 8 days of drought, showed the significant increase in proline contents in both of the varieties of rice th at both the level of stress. In 10 days of stress, a maximum increase of 1.08 fold in proline content was observed in R62+R81 treated plants of Sahbhagi while in IR-64, a maximum increase in 1.09 fold was observed in 14B treated plants over control (Figure 1c). High proline contents in plant cells may be due to higher induction of proline biosynthesis which may help cells to maintain their water status and protects their vital function against the consequences of drought stress (Yoshiba et al., 1997). Higher proline accumulation in inoculated plants may indicate higher plant tolerance to water stress. Irrespective of treatments, proline accumulation was higher (105.43%) in IR-64 as compare to Sahbhagi in th early drought stress (in 8 days of drought), while in severe drought stress both the varieties accumulate proline in almost similar ways, the attribute might differentiate the tolerance and sensitive varieties of rice and suggesting the vital role of proline as an osmoregulatory solute in plants (Kumar et al., 2011). Similarly in various studies on abiotic stresses, plants showed the varietal differences in proline accumulation (Yadav et al., 2004; Liu et al., 2011). Superoxide dismutase activity The SOD activity were continued to increase till the last th th day of drought (10 days of drought). On the 8 day of drought, P2 showed 1.76 fold increased SOD over control in Sahbhagi, followed by A3+A5 with 1.36 fold increase. In IR-64, Arthrobacter A3+A5 increased the 1.78 fold SOD activity over control followed by R62+R81 th with 1.65 fold. On the 10 days of drought, A3+A5 with 1.93 fold followed by P2 with 1.65 fold maximally increased the SOD activity over control in Sahbhagi. In IR-64 all the treated plants showed significantly higher th activity of SOD as compared to control plants in 10 days of drought. Among the treatments, R62+R81 with 1.75 fold followed by Arthrobacter A3+A5 with 1.72 fold maximally increased the SOD activity over control (Figure 2a). It is suppose that SOD catalyses the dismutation of superoxide radical into H2O2, which is further obliterate by CAT and POD activity (Scandalios, 1993). Here the increased SOD activity in stressed plants may be either due to increased production of ROS or could be a protective mechanism adopted by rice plants against ROS and oxidative damage. The higher level of SOD activity in inoculated plants could be related with the enhanced protective mechanism induced by PGPRs in plants to reduce the level of H2O2. An earlier study demonstrated that mechanisms that reduce oxidative stress indirectly play an important role in drought 770 Afr. J. Biotechnol. Figure 2. (a) SOD, (b) POD, (c) CAT and (d) APX activity of two genotype of rice, inoculated with PGPRs, under 0, 8 and 10 days of drought stress. Mean followed by same letter are not significantly different (P<0.05) for a particular trait in two cultivars at all the level of stress. Gusain et al. 771 Ascorbate peroxidase activity tolerance (Bowler et al., 1992). th Peroxidase activity Sahbhagi strain P2 with 1.39 fold maximally increased the POD activity followed by 14B with 1.34 fold which th increased activity under 8 days of drought. Similarly in IR-64 with 1.25 fold, Pseudomonas strain P2 maximally increased the POD activity followed by R62+R81 with 1.2 th fold. In 10 days of drought Arthrobacter (with 1.81 fold), 14B (with 1.71 fold) and P2 (with 1.26 fold) significantly increased the POD activity over control in Sahbhagi, while IR-64 Pseudomonas strain P2 (with 1.27 fold) and R62+R81(with 1.27 fold) showed significant effect on POD activity over control (Figure 2b). Irrespective of the treatments, IR-64 showed 25.72% higher POD activity as compared to Sahbhagi. Under stress condition, increased level of peroxidase in plants can be correlated with an increased level of ROS in plants cells (Radotic et al., 2000). Similar to the present study, PGPRs mediated increased POD activity under drought stress has also been reported in green gram plants by Saravanakumar et al. (2011). Catalase activity th The catalase activity increased in the 8 day of drought th and then decreased under severe drought stress in 10 day. A non significant effect was observed in all the treatments with control plants under 0 days of stress. In th 8 days of drought 14B and A3+A5 significantly increased the CAT activity in Sahbhagi, while IR-64, P2, 14B and A3+A5 significantly increased the catalase th activity over control. In the 10 days of drought, 14B with 1.67 fold maximally increased the catalase activity over control in Sahbhagi. In IR-64, P2 with 1.64 fold significantly increased the CAT activity as compared to uninoculated plants (Figure 2c). Irrespective of treatments and stress level 91.25% increased CAT activity was reported in IR-64 as compared to Sahbhagi. Here th the catalase activity increased at the 8 day of drought th and decreased under severe stress condition after 10 days of drought which either suggest catalase poor affinity for H2O2 or it may have undergone subsequent degradation of H2O2 due to photoinactivation in the presence of light (Hertwig et al., 1992). Similar decline in catalase activity in plants has also been observed in varieties under stressful condition (Hertwig et al., 1992; Radotic et al., 2000). However, all the inoculated plants showed higher catalase activity as compared to their respective control which suggests the PGPR mediated reduction of oxidative stress in plants (Saravanakumar et al., 2011). In the 8 day of drought 14B (with 1.8 fold), A3+A5 (with 1.58 fold) and pseudomonas strain P2 (with1.41 fold) significantly increased the APX activity over control in Sahbhagi. In IR-64, Arthrobacter (with 1.79 fold) and pseudomonas strain P2 (with 1.69 fold) showed significant effect on APX activity over control. Similarly in th the 10 day of drought 14B (with 1.23 fold) Arthrobacter (with 1.54 fold) and pseudomonas strain P2 (with1.19 fold) significantly increased the APX activity over control in Sahbhagi. In IR-64 all the treated plants showed significantly increased level of APX activity over control (Figure 2d). Overall (irrespective of treatments and stress level), Sahbhagi showed 12.25% higher APX activity as compared to IR-64. APX acted on H2O2 and prevents its accumulation in cells via ascorbate-glutathione pathway (Foyer and Halliwell, 1976). An increased activity of APX in PGPRs treated plants as observed here could be related with the decreased concentration of H2O2 in rice under drought stress suggesting a key role of APX in detoxification of H2O2 under drought stress and appear to constitute a basic antioxidative defense mechanism in plants (Madhusudhan et al., 2003). However, in the overall antioxidant study, higher activity of CAT, POD and APX could interrelate with lower activities of H2O2 in all the treated plants as compared to their respective control, as all these antioxidant acted as an scavenger on H2O2 (Gill and Tuteza, 2010). Conclusion It was observed from the present study that PGPRs inoculation induced plants to produce the higher amount of antioxidant under drought stress which might be a basis for the lower accumulation of H2O2 in inoculated plants as compared to their respective control. Both the genotype differs in their response to different growth and biochemical parameters under drought stress condition, however, lower accumulation of H2O2 in Sahbhagi indicated that this cultivar might have an efficient ROS quenching system at cellular level, which might help it to withstand prolonged drought. Overall, the study shows the significance of PGPRs as the alleviation of drought stress in rice and suggest the further utilization of selected PGPRs as biofertilizer under drought prone environment. Conflict of interest The authors declared they have no conflict of interest. ACKNOWLEDGEMENTS The first author is very thankful to the International Rice 772 Afr. J. Biotechnol. Research Institute (IRRI), Philippine for financial support through the STRASA project. providing REFERENCES Alami Y, Achouak W, Marol C, Heulin T (2000). Rhizosphere soil aggregation and plant growth promotion of sunflowers by exopolysaccharide producing Rhizobium sp. strain isolated from sunflower roots. Appl. Environ. Microbiol.66:3393-3398. Alexieva V, Sergiev I, Mapelli S, Karanov E (2001). The effect of drought and ultraviolet radiation on growth and stress markers in pea and wheat. Plant Cell Environ. 24:1337-1344. Arnon DI (1949). Copper enzymes in isolated chloroplast polyphenol oxidase in Beta vulgaris. Plant physiol. 24:1-15. Bates LS, Waldren RP, Teare ID (1973). Rapid determination of free proline for water–stress studies. Plant Soil.39:205-207. Bernier J, Atlin GN, Serraj R, Kumar A, Spaner D (2008). Breeding upland rice for drought resistance. J. Sci. Food Agric.88: 927-39. Bowler C, Vanmontagu M, Inze D (1992). Superoxide-dismutase and stress tolerance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43:83116. Bradford MM (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:246–254. Cha-um S, Yooyongwech S, Supaibulwatana K (2012). Water-deficit tolerant classification in mutant lines of indica rice. Sci. Agric. 69(2):135-141. Egamberdiyeva D, Hoflich G (2004). Effect of plant growthpromoting bacteria on growth and nutrient uptake of cotton and pea in a semiarid region of Uzbekistan. J. Arid. Environ. 56:293-301. Elstner EF (1991). Mechanism of oxygen activation in different compartments. in: Pell EJ, Steffen KL (Eds.), Active Oxygen/Oxidative Stress and Plant Metabolism. American Society of Plant Physiologists, Roseville. pp. 13-25. El-Tayeb MA (2006). Differential responses of pigments, lipid peroxidation, organic solutes, catalase and per-oxidase activity in the leaves of two Vicia faba L. cultivars to drought. J. Agri. Biol. 8(1): 116-122. Foyer CH, Halliwell B (1976). The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism. Planta. 133:21-25. Gill SS, Tuteja N (2010). Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48:909-930. Glick BR (1995). The enhancement of plant growth by free living bacteria. Can. J. Microbiol. 41:109-114. Gururani MA, Upadhyaya CP, Venkatesh J, Baskar V, Park SW (2013). Plant growth promoting rhizobacteria enhance abiotic stress tolerance in Solanum tuberosum through inducing changes in the expression of ROS scavenging enzymes and improved photosynthetic performance. J. Plant Growth Regul. 32(2): 245-258. Gusain YS, Kamal R, Mehta CM, Singh US, Sharma AK (2015). Phosphate solubilizing and indole-3-acetic acid producing bacteria from the soil of Garhwal Himalaya aimed to improve the growth of rice. J. Environ. Biol. 36:301-307. Halliwell B, Gutteridge JMC (1989). Free Radicals in Biology and Medicine (2nd ed) Clarendon Press, Oxford. Heath RL, Packer L (1968). Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophysic. 125(1):189-198. Hertwig B, Streb P, Feierabend J (1992). Light dependency of catalase synthesis and degradation in leaves and the influence of interfering stress conditions. Plant Physiol. 100:1547-1553. Hoagland DR, Arnon DI (1950). The water-culture method for growing plants without soil. Calif. Agr .Expt. Sta. Circ. 347:1-32. Jaw NL, Ching HK (1998). Effect of oxidative stress caused by Hydrogen peroxide on senescence of rice leaves. Bot. Bull. Acad. Sin. 39:161-165. Kamoshita A, Babu RC, Boopathi NM, Fukai S (2008). Phenotypic and genotypic analysis of drought-resistance traits for development of rice cultivars adapted to rainfed environments. Field Crops Res. 109:1-23. Khush G (2003). Productivity improvements in rice. Nutr. Rev. 61:S114S116. Kohler J, Hernandez JA, Caravaca F, Roldàn A (2008). Plant-growthpromoting rhizobacteria and abuscular mycorrhizal fungi modify alleviation biochemical mechanisms in water-stressed plants. Funct. Plant Biol. 35:141-151. Kumar RR, Karajol K, Naik GR (2011). Effect of polyethylene glycol induced water stress on physiological and biochemical responses in pigeonpea (Cajanus cajan L. Millsp.). Recent Res. Sci. Tech. 3:148152. Liu C, Liu Y, Guo K, Dayong Fan D, Li G, Zheng Y, Yu L, Yang R (2011). Effect of drought on pigments, osmotic djustment and antioxidant enzymes in six woody plant species in karst habitats of south western China. Environ. Exp. Bot. 71:174-183. Mackill DJ, Ismail AM, Pamplona AM, Sanchez DL, Carandang JJ, Septiningsih EM (2010). Stress Tolerant Rice Varieties for Adaptation to a Changing Climate. Crop Environment & Bioinformatics.7:250259. Mader P, Kaiser F, Adholeya A, Singh R, Uppal HS, Sharma AK, Srivastava R, Sahai V, Aragno M, Wiemken A, Johri BN, Fried PM (2011). Inoculation of root microorganisms for sustainable wheat-rice and wheat black gram rotations in India. Soil Biol. Biochem. 43:609619. Madhusudhan R, Ishikawa T, Sawa Y, Shiqeoka S, Shibata H (2003). Characterization of an ascorbate peroxidase in plastids of tobacco BY-2 cells. Physiol. Plant. 117:550-557. Mayak S, Tirosh T, Glick BR (2004). Plant growth promoting bacteria that confer resistance to water stress in tomato and pepper. Plant Sci. 166:525-530. Mishra S, Jha AB, Dubey RS (2011). Arsenite treatment induces oxidative stress, upregulates antioxidant system, and causes phytochelatin synthesis in rice seedlings. Protoplasma 248(3): 565– 577. Mongodin EF, Shapir N, Daugherty SC, De Boy RT, Emerson JB, Shvartzbeyn A, Raduneet D, Vamathevan J, Riggs F, Grinberg V, Khouri H, Wackett LP, Nelson KE, Sadowsky MJ (2006). Secrets of soil survival revealed by the genome sequence of Arthrobacter aurescens TC1. PLoS Genetics 2(12):2094-2106. Moslemi Z, habibi D, Asgharezadeh A, Ardakani MR, Mohammadi A, Mohammadi M (2011). Response of phytohormones and biochemical markers of maize to super absorbent polymer and plant growth promoting rhizobacteria under drought stress. American Eurasian J. Agric.& Environ. Sci. 10 (5):787-796. Noctor G, Foyer CH (1998). Ascorbate and glutathione: keeping active oxygen under control. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49:249-279. Prousek J (2007). Fenton chemistry in biology and medicine. Pure Appl. Chem. 79(12):2325-2338. Radotic K, Ducic T, Mutavdzic D (2000). Changes in peroxidase activity and isozymes in spruce needles after exposure to different concentrations of cadmium. Environ. Exp. Bot. 44:105-113. Roesti D, Gaur R, Johri BN, Imfeld G, Sharma S, Kawaljeet K, Aragno M(2006). Plant growth stage, fertiliser management and bioinoculation of arbuscular mycorrhizal fungi and plant growth promoting rhizobacteria affect the rhizobacterial community structure in rain-fed wheat fields. . Soil Biol. Biochem. 38:1111-1120. Sairam RK, Srivastava GS (2001). Water stress tolerance of wheat (Triticum aestivum L.): Variations in hydrogen peroxide accumulation and antioxidant activity in tolerant and susceptible genotypes. J. Agron. Crop Sci. 186:63-70. Sandhya V, Ali SKZ, Grover M, Reddy G, Venkateswarlu B (2010). Effect of plant growth promoting Pseudomonas spp. on compatible solutes, antioxidant status and plant growth of maize under drought stress. Plant Growth. Regul. 62:21-30. Saravanakumar D, Kavino M, Raguchander T, Subbian P, Samiyappan Gusain et al. R (2011). Plant growth promoting bacteria enhance water stress resistance in green gram plants. Acta Physiol. Plant. 33:203-209. Saravanakumar D, Samiyappan R (2007). ACC deaminase from Pseudomonas fluorescens mediated saline resistance in groundnut (Arachis hypogea) plants. J. Appl. Microbiol. 102:1283-1292. Scandalios JG (1993). Oxygen stress and superoxide dismutases. Plant Physiol. 101:7-12. Sgherri CLM, Pinzino C, Navari-Izzo F (1996). Sunflowers seedlings subjected to stress by water deficit: changes in O2 production related to the composition of thylakoid membranes. Physiol. Plant. 96:446452. Singh KK, Ghosh S (2013). Regulation of glutamine synthetase isoforms in two differentially drought-tolerant rice (Oryza sativa L.) cultivars under water deficit conditions. Plant Cell Reports 32(2):183193. Smirnoff N (1993). The role of active oxygen in the response of plants to water deficit and desiccation. New Phytol. 125:27-58. 773 Yadav RS, Sharma RK, Yadav RM (2004). Effect of simulated drought on free proline accumulation in some wheat (Triticum aestivum L.) genotypes. Indian J. Agric. Biochem. 17:43-44. Yoshiba Y, Kiyosue T, Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K(1997). Regulation of levels of proline as an osmolyte in plants under water stress. Plant Cell Physiol. 38:1095-1102. Zhang J, Kirkham MB (1996). Antioxidant responses to drought in sunflower and sorghum seedlings. New Phytologist 132:361-373. Vol. 14(9), pp. 774-780, 4 March, 2015 DOI: 10.5897/AJB2014.14376 Article Number: DDC6D4B50958 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper The efficacy of four gametocides for induction of pollen sterility in Eragrostis tef (Zucc.) Trotter Habteab Ghebrehiwot1*, Richard Burgdorf2, Shimelis Hussein1 and Mark Laing1,2 1 African Centre for Crop Improvement, University of KwaZulu-Natal, Private Bag X01, Scottsville 3209, Pietermaritzburg, South Africa. 2 Department of Plant Pathology University of KwaZulu-Natal, Private Bag X01, Scottsville 3209, Pietermaritzburg, South Africa. Received 17 December, 2014; Accepted 19 February, 2015 Effective chemical hybridizing agents (CHAs) or male gametocides enhance cross pollination in plant breeding and genetic analysis of traits. The present study examined the efficacy and optimum concentration of four CHAs, namely: 2-chloroethyl phosphonic acid (Ethrel), ethyl 4'-fluorooxanilate ® (E4FO), 2, 4-dichlorphenoxy acetic acid (2, 4-D) and Promalin (1.8% GA47 – gibberellins A4+A7 and 1.8% 6-BA–benzyladenine) on pollen sterility and seeding of a tef line (DZ-01-3186). Seed-derived and individually grown tef plants were treated with foliar applications of the four CHAs (at four levels each) sprayed once at the early booting stage, and bagged to control cross pollination. Female fertility was assessed by recording seed set following controlled pollinations. Although all the CHAs caused some pollen sterility, their efficacy levels varied from 9.77 to 99.50% in treated plants compared to the control (6.68 +/- 1.04%). Pollen sterility increased with increasing CHA concentration. Near-complete pollen sterility (99.50 ± 0.50%) was achieved by the application of E4FO at rates of 1500 to 3000 ppm, and Ethrel ® at 5000 ppm. All the CHAs significantly reduced seed yield, with E4FO, Ethrel and Promalin at 5000 ppm causing the highest reduction, essentially yielding no seed. In the period following the application of the CHAs, plants treated with E4FO (1000 – 1500 ppm) exhibited stigmas that remained fertile. Hence, it is recommended that E4FO (at 1000 – 1500 ppm) can be used as a chemical emasculation agent for tef, with the least phytotoxicity and the highest female fertility. Key words: Eragrostis tef, Ethrel, ethyl4-florooxanilate, female fertility, gametocides, pollen sterility. INTRODUCTION Tef [Eragrostis tef (Zucc.) Trotter] is an autogamous cereal food crop that has been cultivated in the Horn of Africa (Eritrea and Ethiopia) for over 2000 years (Ingram and Doyle, 2003). The grain is used to make a variety of food products, including a spongy fermented pancake called “Enjera” that regionally serves as a staple food. In Ethiopia, tef is considered the most important crop covering the greatest land area under cereal cultivation (Ketema, 1997). Despite a long history of cultivation, grain production is hampered by the low yield levels of *Corresponding author. E-mail: Ghebrehiwoth@ukzn.ac.za. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Ghebrehiwot et al. the available cultivars, and vulnerability of the crop to lodging, which routinely causes yield reductions of 17 to 25% (Ketema, 1983). At the moment, the mean national -1 -1 grain yield of tef stands at 1.46 t ha or 1465 kg.ha (Central Statistics Authority, 2014). Improved varieties of -1 tef provide grain yields of 1700-2200 kg.ha on farmers’ -1 fields and 2200-2800 kg.ha under research-managed situations. Estimates are that the crop could yield as -1 much as 6000 kg.ha , had it received adequate research attention (Ketema, 1997; Teklu and Tefera, 2005). Research on tef improvement began in the late 1950s in Ethiopia. This genetic improvement programme utilized mass and/or pure-line selection directly from the existing germplasm, hybridization, as well as the initiation of induced mutations (Belay et al., 2006). The major breeding objectives were to improve grain yield and to develop drought and lodging-resistant varieties of tef. Attempts to improve grain yield have resulted in a number of improved varieties. However, breeding efforts to develop lodging-resistant tef varieties have not yet succeeded due to the tedious and meticulous crossing technique of tef, attributed to its pollination process (Gugsa and Loerz, 2013). In tef, pollination occurs only during the early hours of the morning and requires the employment of an appropriate artificial hybridization technique. Under Ethiopian climatic conditions, tef flowers open and are fertilised only between 6:45 and 7:45 a.m. (Berhe, 1976; Ketema, 1997). In addition to this, the small size of its reproductive structures and its autogamous nature has made microscopic emasculation and cross pollination obligatory, which requires appropriate equipment and skilled personnel (Berhe and Miller, 1976; Ketema, 1997; Gugsa and Loerz, 2013). In a selfpollinated crop such as tef, with the male and female organs in the same flower (monoecious), the application of chemical hybridizing agents (CHAs) that selectively impair the male gamete would be of a great value in plant breeding or genetic analysis of traits, reducing the time invested in the laborious procedure of hand emasculation. Male sterility is defined as the failure of a plant to produce functional anthers, pollen and/or male gametes during its reproductive stage. It can be triggered by multiple factors including adverse growth conditions such as temperature (Endo et al., 2009), diseases, inheritance, mutations or chemical agents (McRae, 1985; Budar and Pelletier, 2001). The deliberate elimination of the male gamete using CHAs has been established as a potentially viable approach in commercial hybrid seed production (Van Der Kley, 1954; Tu and Banga, 1998). It would solve many problems, such as the elimination of tedious hand emasculation, allowing for combinations of suitable parents, eliminating the need for expensive, complex and limiting cytoplasmic male sterility systems, increasing crossing choices in plant breeding and simplifying genetic analysis of self-pollinating crops. An effective CHA should induce an acceptable level of male sterility while retaining a high degree of female fertility 775 (Cross and Ladyman, 1991). The major groups of chemicals screened so far for their possible CHA potential include auxins, antiauxins, growth regulators, arsenicals, ethylene-releasing compounds, halogenated aliphatic acids and several other patented chemicals (Batch et al., 1980). Several derivatives of oxalinates (Ali et al., 1999; Chakraborty and Devakumar, 2006a) and growth regulators (Badino, 1981; Praba and Thangaraj, 2005) were effective in inducing pollen sterility in various crops without negative effects on female fertility. The effectiveness of some CHAs (e.g. Ethrel) is genotype, dose and stage specific which limits their value (Bennet and Hughes, 1972). Ali et al. (1999) examined the relative efficacy of three CHAs, including E4FO, on male sterility of rice (Oryza sativa). They reported that E4FO applied @1500 ppm at meiosis was the most effective CHA, causing the most pollen and spikelet sterility, the widest spectrum of action on multiple varieties and the least phytotoxicity. Foliar applications of Ethrel at rates ranging between 1000 and 4000 ppm also induced useful levels of male sterility in barley (Hordeum vulgare) (Kumar et al., 1976; Verma and Kuman, 1978), spring wheat (Triticum aestivu) (Rowell and Miller, 1971; Dotlacil and Apltauerova, 1978; Jan and Rowell, 1981), rice (Oryza sativa) (Parmar et al., 1979) and tef (Berhe and Miller, 1978). However, studies have also demonstrated that Ethrel induces significant levels of female sterility at the rates of application required for male sterility (Hughes et al., 1974; Berhe and Miller, 1978; Dotlacil and Apltauerova, 1978). There are also reports that Ethrel may cause defoliation in certain species (Morgan, 1969; Pedersen et al., 2006). As a selective CHA, 2, 4-dichlorphenoxy acetic acid (2, 4-D) is also one of the most widely studied CHAs (Helal and Zaiki, 1981). Foliar applications of 2, 4-D on tomato (Rehm, 1952), rice (Helal and Zaiki, 1981) and sesame (Prakash et al., 2001) induced high levels of male sterility. By contrast, the application of 0.4% 2, 4-D did not induce acceptable levels of pollen sterility in rice (Praba and Thangaraj, 2005). The gametocidal property of gibberellic acid in inducing male sterility is also well studied in many corps including maize (Nelson and Rossman, 1958), common Onion (Van Der Meer and Van Bennekom, 1976; Badino, 1981), coriander (Kalidasu et al., 2009) and many other flowering plants (Sawhney and Shukula, 1994). Despite the volume of research on CHAs, there are no reports of male sterilizing CHAs being used for tef breeding (Berhe and Miller, 1976, 1978). In pursuit of a potential alternative for hand emasculation, the present study examined the efficacy and determined the optimum concentration of four CHAs on male sterility and subsequent seed set in tef. The chief objectives were 1) to identify an effective and suitable CHA for use in tef without adverse effects; 2) to standardize the concentration of the CHA for inducing an acceptable level of male sterility; 3) to investigate the morphological and physiological 776 Afr. J. Biotechnol. changes induced by the CHA and; 4) to investigate posttreatment female fertility/sterility through the assessments of seed set after controlled pollination. MATERIALS AND METHODS The CHAs and plant material The tef variety - DZ-01-3186 was used for this particular study. Four CHAs were used in the study, Ethrel, ethyl 4'-fluorooxanilate (E4FO), Promalin® and 2, 4-D. The concentration levels tested were: Ethrel at 1000, 2000, 3000 and 5000 ppm; E4FO at 1000, 1500, 2000, 3000 ppm, Promalin® at 50, 100, 150 and 300 ppm; 2, 4-D at 10, 50, 100 and 500 ppm. At all concentration levels, 5% of Tween 80® (0.2%) was added as a wetting agent. Growing conditions, treatments and experimental design Experiments were conducted in an environmentally controlled glasshouse maintained at an air temperature of 28 ± 2.5°C. The tef plants were grown from seeds sown directly into plastic pots (250 mm in diameter and 210 mm in height) filled with 75% composted pine bark and 25% river sand. Ten seeds per pot were sown, thinned-out to one plant per pot at the trifoliate stage. All lateral tillers were constantly clipped off, allowing only one dominant tiller to grow to flowering. The tef plants received an optimal fertigation, scheduled twice a day and weeds were hand controlled. The CHA solutions were applied on once at the panicle initiation stage when the flower head (panicle) was 10-12 mm long and panicles were then bagged to avoid cross pollination. The sprays were applied with a small power sprayer and hand gun to thoroughly wet the inflorescence, leaf and stem surfaces. The quantity of liquid sprayed per plant was approximately 4 to 5 ml. The control plants were sprayed with same amount of tap-water. To test the effect of the wetter, a blank solution of Tween-80® (0.2% v/v) without CHA, was also applied. The four CHAs, with four concentration levels each, the water control (n=4) and the Tween 80® control (n= 4), were arranged in a completely randomized design with 18 treatments in four replications. Within the glasshouse, the pots were randomly rotated on a weekly basis to minimize positional effects. One week after the application of CHAs, pollen grains were sampled from each plant and analysed for viability/sterility. After screening the potency of the CHAs, to study the effect of the CHAs (that is, E4FO and Ethrel) on female fertility, four additional potted tef plants were sprayed with E4FO and Ethrel at 4 concentration levels each and the plants were subsequently hand cross pollinated, and left unbagged. At the end of the trial season, seeds produced from the mother plants were manually collected, counted and recorded. Difference in seed yield from panicles treated with CHAs followed by bagging to avoid cross pollination (SYPP) and seed set from panicles treated CHAs followed by artificial pollination (SSPP) would indicate the number of viable female organs (stigmas) remaining in the period following the CHAs treatment. Pollen sterility test A range of techniques were tested to visualise pollen grains (data not presented). The best technique for differentiating between viable and non-viable pollen grains of tef was achieved using an aniline blue lactophenol staining technique. The aniline blue lactophenol solution was prepared by mixing 5 ml of 1% aqueous aniline blue, 20 g phenol crystals (C6H5O4), 40 ml glycerol, 20 ml lactic acid and 20 ml of distilled water (Kearms and Inouye, 1993). A week after the application of the CHAs, plant inflorescences (spikes) were collected and stored in 70% ethanol until slide prepara- ration. Pollen grains from newly dehisced florets were released onto a droplet of aniline blue lactophenol solution on a glass microscope slide. The droplet was covered with a cover slip and the pollen grains were allowed to stain for 3 h at 21°C before scoring. The preparation was then examined under a Zeiss Axio Scope A1 brightfield light microscope (Carl Zeiss, Ltd., Canada) equipped with an AxioCam camera and image captured using Axio Vision 2.05 software (Carl Zeiss Ltd., Canada). It was possible to vividly visualise the pollen grains at 40X magnification, with viable pollen grains appearing solid-blue and non-viable pollen grains appearing turquoise in colour (Figure 1a). A minimum of 300 pollen grains were counted from each sample by selecting random fields of view. Pollen grains from the control plants were also investigated to detect differences in pollen sterility/viability. Statistical analysis Levels of pollen sterility were computed by dividing the number of unstained (sterile pollen grains) by the total number of pollen grains (stained plus unstained) per field of view, expressed as a percentage. Data was normalised by square root transformation. The seed yield per panicle (SYPP) was estimated through approximation of the 1000-seed weight following the procedures described by Wiliam (1985). In variety DZ-01-3186, the 1000-seeds weight was found to be 294 mg. To obtain an estimate of SYPP, total harvested seed yield per panicle (weight) was divided by 294 and then multiplied by 1000. Data was subjected to one-way analysis of variance (ANOVA) using GenStat 14th edition Inc. (GenStat, 2011). Duncan’s multiple range test procedure was used at P < 0.05 to compare the significance of differences among treatment means. RESULTS The effects of the four CHAs on levels of pollen sterility and subsequent SYPP are presented in Tables 1 and 2. A low level of pollen sterility (6.68 ± 1.04%) was observed ® in the untreated control plants. The wetter, Tween 80 had no significant effect on pollen sterility (5.05%). The treatments had a highly significant (P< 0.001) effect on pollen sterility (Table 1). Levels of pollen sterility increased with increases in CHA concentration (Table 3). Compared to the control, all the CHAs and at all concentration levels except 2, 4-D at 10 ppm to 50 ppm induced significant increases in pollen sterility, which ranged between 19.03 ± 1.00% to 99.50 ± 0.50%. Near complete male sterility percentage was achieved by the application of E4FO at rates ranging between 1500 to 3000 ppm and Ethrel at 5000 ppm. The CHAs also had a highly significant effect on SYPP (Table 2). Compared to the control (5564.28 ± 181.88), plants treated with the ® wetter, Tween 80 , did not exhibit any significant reduction in SYPP. In contrast, plants treated with all ® levels of E4FO, all levels of Ethrel, and Promalin at 300 ppm, exhibited the greatest reduction in SYPP, essentially yielding no seed (Table 3). In CHA treated plants, relatively more SYPP was obtained from plants ® treated with 2, 4-D. Promalin at rates ranging between 50 to 150 ppm showed a greater reduction in SYPP than ® those treated with 2, 4-D. Promalin treated plants showed some phytotoxicity symptoms such as growth Ghebrehiwot et al. 777 Figure 1. A) Pollen grains of Eragrostis tef visualised under light microscope 40X magnification. Non-viable pollen grains (black arrow) and viable pollens (yellow arrows). B) Anther of Eragrostis tef filled with non-viable pollen grains. C) Growth deformity (coiling) caused by Promalin® treatment of tef. D) Premature senescence and floret collapse caused by Ethrel and Promalin ® treatment. Table 1. One-way analysis of variance (ANOVA) of the effect of the CHAs on percentage of pollen sterility in Eragrostis tef. Source of variation Treatments Residual Total d.f. 17 54 71 s.s. 83002.24 1167.97 84170.21 m.s. 4882.48 21.63 v.r. 225.74 F pr. <0.001 Table 2. One-way analysis of variance (ANOVA) of the effect of the CHAs on seed yield per panicle (SYPP) of non-pollinated Eragrostis tef plants. Source of variation Treatments Residual Total d.f. 17 54 71 s.s. 345579304 29603056 375182360 deformity (coiling) and frequent dryness of inflorescences ® (Table 3 and Figure 1b). Promalin at a rate of 5000 ppm caused an extreme reduction in seed set, due to floret collapse (Table 3 and Figure 1). At higher doses of 100 and 500 ppm, 2, 4-D treated plants exhibited excessive elongation of the inflorescence and drooping (Table 3). By contrast, treating the tef plants with all rates of Ethrel, and E4FO at a rate of 3000 ppm, led to early premature desiccation and ultimately to floret collapse. t-test m.s. 20328194 548205 v.r. 37.08 F pr. <.001 comparison between the CHAs-treated-pollinated vs CHAs-treated-non-pollinated tef plants showed a highly significant (t = 5.496; P < 0.00) difference in seed set per panicle (SSPP). Artificial pollination of the plants previously treated with E4FO at rates of 1000 to 1500 ppm, showed a significant improvement in SSPP. By contrast, artificial pollination of the plants previously treated with all rates of Ethrel did not show any significant improvement in SSPP (Table 3). 778 Afr. J. Biotechnol. Table 3. The effect of four different chemical hybridizing agents (CHAs) applied at four different concentration levels on pollen sterility, seed yield per panicle (SYPP) and seed set per panicle (SSPP) of Eragrostis tef (Zucc.) Trotter, cultivar Etsub (Var: DZ-01-3186). Phytotoxicity symptoms observed on CHA treated plants compared to untreated controls. CHAs concentration (ppm) 1000 1500 2000 3000 Pollen sterility (%) Ethrel 1000 2000 3000 5000 79.00 ± 2.68 bc 82.00 ± 6.38 bc 83.00 ± 1.47 a 94.12 ± 0.58 2, 4-D 10 50 100 500 9.77 ± 0.47 hi 13.53 ± 1.31 h 19.03 ± 1.00 g 29.94 ± 1.76 50 54.83 ± 0.73 f 218.40 ± 23.78 100 57.19 ± 0.94 f 197.95 ± 26.99 150 64.58 ± 1.20 e 1390.00 ± 348.24 300 74.40 ± 2.98 d 0.00 ± 0.00 0 6.86 ± 1.04 i 5572.64 ± 170.34 a 5572.64 ± 170.34 a No phytotoxicity symptoms observed (0.02% v/v) 6.05 ± 1.64 i 5564.28 ± 181.88 a 5664.28 ± 181.88 a No phytotoxicity symptoms observed CHAs E4FO Promalin SYPP+SE of selfpollinated plants 86.41 ± 2.86 a 95.83 ± 4.17 a 98.61 ± 1.39 a 99.50 ± 0.50 b 0.00 ± 0.00 f 0.00 ± 0.00 f 0.00 ± 0.00 f 0.00 ± 0.00 cd 0.00 ± 0.00 f 0.00 ± 0.00 f 0.00 ± 0.00 f 0.00 ± 0.00 i SSPP+SE of artificially pollinated plants f 569.7 ± 39.97 c 281.00 ± 27.41 cd 241.20 ± 17.17 d 34.20 ± 5.49 b f 9.50 ± 3.88 d 3.00 ± 1.91 d 00.00 ± 0.00 d 00.00 ± 0.00 No phytotoxicity symptoms observed No phytotoxicity symptoms observed No phytotoxicity symptoms observed Floret dryness and early premature senescence d a 5592.17 ± 749.69 b 4377.45 ± 976.26 b 4031.60 ± 308.38 c 2933.87 ± 673.58 Observations Floret dryness and early premature senescence Floret dryness and early premature senescence Floret dryness and early premature senescence Floret dryness and early premature senescence * * * * Panicle elongation and drooping Panicle elongation and drooping Panicle elongation and lightly seeded panicle Panicle elongation and lightly seeded panicle e * Twisting inflorescence and leaves, week and premature senescence e * Twisting inflorescence and leaves week and premature senescence * Twisting inflorescence and leaves week and premature senescence * Twisting inflorescence and leaves week and premature senescence ® Control I (Tap water spray) ® Control II (Tween 80 ) d f Values in the same column with shared letter(s) are not statistically different according to Duncan’s multiple range test at the 5% level of significance. Ghebrehiwot et al. DISCUSSION Hybridization in tef is a tedious and difficult undertaking that relies on hand emasculation. Hand emasculated tef often fail to yield any seed (Berhe and Miller, 1978). Currently, a large number of CHAs are being developed to induce mass emasculation in a number of crops for the purpose of hybrid seed production, or as a substitute for hand emasculation (Tu and Banga, 1998; Praba and Thangaraj, 2005; Chakraborty and Devakumar, 2006b). Results of the present study cast some light on the possibility of using CHAs for tef breeding. It is interesting that E4FO and Ethrel induced the highest levels of male (pollen) sterility in tef. These two CHAs also induced the greatest reduction in the SYPP of the non-pollinated (bagged) plants. The lack of seed production, together with the high levels of pollen sterility found in plants treated with E4FO and Ethrel indicates the effectiveness of these CHAs in mass emasculation of the male gametes in tef. However, it is not sufficient that a CHA should cause a high level of male sterility, but it should not cause any adverse side effects to the rest of the plant (Chakraborty and Devakumar, 2006a). Therefore, determining the effects of the CHAs on phytotoxicity and female fertility were equally important. Artificial pollination of the plants previously treated with E4FO (at a rate of 1000 – 1500 ppm) resulted in significant increases in seed set per panicle (SSPP). By contrast, Ethrel sprayed plants did not show significant increases in SSPP after artificial pollination. Tef is a predominantly self-pollinating, monogamous plant and the degree of natural outcrossing is less than 1% (Ketema, 1997). These results indicated that the plants sprayed with E4FO at 1000 to 1500 ppm had female organs (stigmas) that remained fertile to alien pollination, but all rates of Ethrel diminished the female fertility in the period following the application of the CHAs. In the phytotoxicity study the tef plants treated with E4FO at 1000 to 2000 ppm had no detectable adverse effects on growth of tef. By contrast, all levels of Ethrel and E4FO at the highest level of 3000 ppm led to early premature desiccation and ultimately floret collapse. Similar deleterious effects of Ethrel on tef were reported by Berhe and Miller (1978). These authors examined the gametocidal effect of Ethrel on two varieties of tef. In this study, foliar applications of 600, 900, and 1,200 ppm were applied three times during heading and all the treatments were effective in reducing seed set with no signs of phytotoxicity. However, ovary and ovular tissue in sterilized florets underwent premature desiccation and ultimately lead to female sterility. Due to its deleterious effects on female fertility, Ethrel was not recommended as a useful CHA for tef (Berhe and Miller, 1978). The tef plants treated with all levels of 2, 4-D exhibited low levels of male sterility and only a slight reduction in SYPP. This treatment also caused certain undesirable phytotoxic symptoms including panicle elongation and drooping. The ® tef plants sprayed with all levels of Promalin showed 779 more pollen sterility and reduction in seed yield, but there were also detectable growth deformities such as stem weakness, coiling and low plant vigour. Therefore, these two CHAs cannot be recommended as viable CHAs for tef breeding. The lactophenol cotton blue staining technique provided an excellent technique for the visualisation of pollen sterility/viability in tef. E4FO was the most effective CHA, inducing the highest levels of pollen sterility, with the least phytotoxicity. The good seed set in artificially pollinated plants previously treated with E4FO (at 1000 – 2000 ppm) indicates that the plants had viable female reproductive structures that remained receptive to pollen in the period following the application of the CHAs. Hence, it can be recommended that E4FO applied once at a booting stage, and at rates of 1000 to 1500 ppm (a relatively wide application window), can be used as an efficient CHA for inducing high levels of male sterility without adverse effects on female fertility in tef. Further studies are needed to determine the potential application of E4FO in commercial hybrid seed production of tef and for its use in breeding programmes and fine-tune concentrations of E4FO. Given that the effect of CHAs on plant development, growth, morphology and female fertility often shows a characteristic of genotype specificity (Kaul, 1988), further studies are required to screen responses of multiple tef varieties and gametocides at a gradient of concentration levels. Conclusion Amongst all the Chemical Hybridizing Agents tested, a single spray of E4FO (1000 - 1500 ppm) induced the highest level of pollen sterility in tef without significant damage on female fertility and least phytotoxicity. Hence, it is recommended that E4FO (at 1000 - 2000 ppm) can be used as a potent chemical emasculation agent for tef. Given that CHAs are genotype specific; the results are applicable for this particular tef variety only. Conflict of interest The authors have not declared any conflict of interest. REFERENCES Ali AJ, Devakumar C, Zaman FU, Siddiq EA (1999). Identification of potent gametocides for selective induction of male sterility in rice. Indian J. Genet. Plant. Breed. 59:429-436. Badino M (1981). Gametocidal effects of gibberellic acid (GA3, GA4+ 7) on common onion (Allium cepa L.).[Conference paper]. Acta Hort (Netherlands) 111:79-88. Batch JJ, Parry KP, Rowe CF, Lawerence DK, Brown MJ (1980). Method of controlling pollen formation in monoecious and hermaphrodite plants using oxanilates and their derivatives. In: Johnson JC (Ed) Plant Growth Regulators and Herbicides, Antagonists-Recent Advances. Noyes Data Corporation, New Jersey, 82-89. Belay G, Tefera H, Tadesse B, Metaferia G, Jarra D, Tadesse T (2006). Participatory variety selection in the Ethiopian cereal tef (Eragrostis tef). Exp. Agri. 42:91-101. 780 Afr. J. Biotechnol. Bennet MD, Hughes WG (1972). Additional mitosis in wheat pollen induced by Ethrel. Nature 240:260-268. Berhe T (1976). A breakthrough in tef breeding technique. FAO Inf. Bull. Cereal Imp. and Prod. Near East Project 12:11-13. Berhe T, Miller DG (1976). Sensitivity of tef [Eragrostis tef (Zucc.) Trotter] to removal of floral parts. Crop Sci. 16:307-308. Berhe T, Miller DG (1978). Studies of ethephon as a possible selective male gametocide on tef. Crop Sci. 18:35-38. Budar F, Pelletier G (2001). Male sterility in plants: occurrence, determinism, significance and use. Comptes Rendus de l'Académie des Sciences-Series III-Sciences de la Vie 324:543-550. Central Statistics Authority (2014). Agricultural sample survey, 2013/2014, Volume 1. Report on area and production of major crops (private peasant holdings, meher season). Statistical Bulletin. 532, Addis Ababa, Ethiopia. Chakraborty K, Devakumar C (2006a). Ethyloxanilates as specific male gametocides for wheat (Triticum aestivum L.). Plant Breed. 125:441447. Chakraborty K, Devakumar C (2006b). Evaluation of chemical compounds for induction of male sterility in wheat (Triticum aestivum L.). Euphytica 147:329-335. Cross JW, Ladyman JAR (1991). Chemical agents that inhibit pollen development: tools for research. Sex Plant Reprod. 4:235-243. Dotlacil L, Apltauerová M (1978). Pollen sterility induced by Ethrel and its utilization in hybridization of wheat. Euphytica 27:353-360. Endo M, Tsuchiya T, Hamada K, Kawamura S, Yano K, Ohshima M, Kawagishi-Kobayashi M (2009). High temperatures cause male sterility in rice plants with transcriptional alterations during pollen development. Plant Cell Physiol. 50:1911-1922. GenStat (2011). GENSTAT® 14th edition for windows. ©VSN International Ltd., Hemel Hempstead, UK. Gugsa L, Loerz H (2013). Male sterility and gametoclonal variations from gynogenically derived polyploids of tef (Eragrostis tef), Zucc. Trotter. Afr. J. Plant Sci. 7:53-60. Helal RM, Zaiki ME (1981). Effect of 2, 4-D and ethephon foliar sprays on induction of male sterility in egg plant. Egypt J. Hortic. 8:101-108. Hughes WG, Bennett MD, Bodden JJ, Galanopoulou S (1974). Effects of time of application of ethrel on male sterility and ear emergence in wheat Triticum aestivum. Annals Appl. Biol. 76:243-252. Ingram AL, Doyle JJ (2003). The origin and evolution of Eragrostis tef (Poaceae) and related polyploids: evidence from nuclear waxy and plastid rps16. Am. J. Bot. 90:116-122. Jan CC, Rowell PL (1981). Response of wheat tillers at different growing stages to gametocide treatment. Euphytica 30:501-504. Kalidasu G, Sarada C, Reddy PV, Yellam T (2009). Use of male gametocide: An alternative to cumbersome emasculation in coriander (Coriandrum sativum L.). J. Hortic. For. 1:126-132. Kaul MLH (1988). Male sterility in higher plants. Monogr. Theor. Appl. Genet. 10:193-220. Kearns CA, Inouye DW (1993). Techniques for Pollination Biologists. University Press of Colorado, Niwot, CO. pp. 77-151. Ketema S (1983). Studies of Lodging. Floral Biology and Breeding Techniques in Tef (Eragrostis tef (Zucc.) Trotter). PhD Thesis, University of London, London, UK. Ketema S (1997). Tef [Eragrostis tef (Zucc.) Trotter.]. Promoting the Conservation and Use of Underutilized and Neglected Crops, Vol. 12. Institute of Plant Genetics and Crop Plant Research, Gatersleben/International Plant Genetic Resources Institute, Rome, Italy. Kumar J, Verma MM, Singh K, Gagneja MR (1976). Effectiveness of Ethrel as an androcide in barley. Crop Improv. 3:39-42. McRae DH (1985). Advances in chemical hybridization. Plant Breeding Rev. 3:169-191 Morgan PW (1969). Stimulation of ethylene evolution and abscission in cotton by 2 chloroethanephosphonic acid. Plant Physiol. 44: 337-341. Nelson PM, Rossman EC (1958). Chemical induction of male sterility in inbred maize by use of gibberellins. Science 27:1500-1501. Parmar KS, Siddiq EA, Swaminathan MS (1979). Chemical induction of male sterility in rice. Indian J. Genet. Pl. Br. 39:529-541. Pedersen MK, Burton JD, Coble HD (2006). Effect of cyclanilide, ethephon, auxin transport inhibitors, and temperature on whole plant defoliation. Crop Sci. 46:1666-1672. Praba ML, Thangaraj M (2005). Effect of growth regulators and chemicals on pollen sterility in TGMS lines of rice. Plant Growth Regul. 46:117-124 Prakash M, Veeramani BB, Kannan K, Vasline YA, Ganesan J (2001). Effect of 2, 4-D and Ethrel on induction of pollen sterility in sesame. Sesame and Safflower Newsletter 16:39-41. Rehm S (1952). Male sterile plants by chemical treatment. Nature 170:38-39. Rowell PL, Miller DG (1971). Induction of male sterility in wheat with 2chloroethylphosphonic acid (Ethrel). Crop Sci. 11:629-631. Sawhney VK, Shukla A (1994). Male sterility in flowering plants: are plant growth substances involved? Am. J. Bot. 81:1640-1647. Teklu Y, Tefera H (2005). Genetic improvement in grain yield potential and associated agronomic traits of tef (Eragrostis tef). Euphytica 141:247-254. Tu ZP, Banga SK (1998). Chemical hybridizing agents. Hybrid Cultivar Development. Narosa Publishing House, New Dehli, India. pp. 160180. Van der Kley FK (1954). Male sterility and its importance in breeding heterosis varieties. Euphytica 3:117-124. Van der Meer QP, Van Bennekom JL (1976). Gibberellic acid as a gametocide for the common onion (Allium cepa L.). II. The effect of GA 4/7. Euphytica 25:293-296 Verma MM, Kumar J (1978). Ethrel-a male gametocide that can replace the male sterility genes in barley. Euphytica 27:865-868. Willan RL (1985). A guide to forest seed handling with special reference to the tropics (No. 20/2). Vol. 14(9), pp. 781-793, 4 March, 2015 DOI: 10.5897/AJB2014.14067 Article Number: 8A6D1B550960 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Genetic diversity of sweet yam “Dioscorea dumetorum “(Kunth) Pax revealed by morphological traits in two agro-ecological zones of Cameroon Christian Siadjeu1, Gabriel MahbouSomoToukam1,2*, Joseph Martin Bell1 and S. Nkwate3 1 Department of Plant Biology, Faculty of Science, University of Yaounde 1, PO Box 812, Yaounde, Cameroon. 2 Institute of Agricultural Research for Development (IRAD), PO Box 2067, Yaounde, Cameroon. 3 Appropriate Development for Africa Foundation (ADAF), “FermeEcole de Baham” (FEBO). PO Box 11646, Yaounde, Cameroon Received 23 July, 2014; Accepted 22 January, 2015 Genetic diversity of 43 Dioscorea dumetorum accessions and two of Dioscorea cayenensis Lam as outgroup species was evaluated for qualitative and quantitative traits in two different agro-climatic zones Baham (05°20.040' N/010°22.572’ E and 1634±3 masl, agro-ecological zone III with rainfall of 1500 to 2000 mm, and mean annual temperature of 19°C) and Ekona (04°12.773'N/009°19.425'E and 445±3 masl, agroecological zone IV with rainfall of 2500 to 4000 mm and mean annual temperature of 26°C). Forty one (41) morphological characters according to International Plant Genetic Resources Institute (IPGRI) descriptor, including nine quantitative and 32 qualitative characters were analyzed for multivariate analysis using cluster analysis, principal component analysis (PCA), and analysis of variance. For quantitative characters, cluster analysis revealed three major clusters. The first three components with eigen values > 1 contributed 83% of the variability. The PCA results indicate that traits which largely contributed to the variability within and between the accessions were stem length, leaf length, internode number, leaf width, harvest index, leaf number and internode length. Traits such as harvest index, internode number and stem length showed high heritability and high genetic advance. For qualitative traits, cluster and principal component analysis revealed two major clusters in Baham as well as in Ekona. The traits such as spines on stem base, spines on stem above base, spines length contributed to the variability within and between the accessions. However, the limits of morphological characters in the study of diversity have been detected. Key words: Dioscorea dumetorum, morphological traits, characterization, agro-climatic zone, Cameroon. INTRODUCTION Yams constitute a staple food crop for over 100 million people in the humid and sub humid tropics (Mignouna et al., 2003). Yams (Dioscorea spp.) belong to the family of Dioscoreaceae and are widely distributed throughout the humid and sub humid tropics with about 600 described species (Coursey, 1976). Among the eight yam species *Corresponding author. E-mail address: mahbousomo@yahoo.fr. Tel: +237 99 55 0111, +237 78 34 28 84. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 782 Afr. J. Biotechnol. commonly grown and consumed in West Africa, Dioscorea dumetorum is the most nutritious (Sefa-Deheh and Afoakwa, 2002). D. dumetorum, which belongs to the family Dioscoreaceae, originated in tropical Africa and occurs in both wild and cultivated forms but its cultivation is still restricted in West and Central Africa (Degras, 1993). Cultivation of D. dumetorum, reported especially in West Africa, is widespread in Western Cameroon (Treche and Delpeuch, 1979). Tubers of D. dumetorum are rich in protein (9.6%), fairly balanced in essential amino acids (chemical score of 0.94) and its starch is easily digestible (Mbome Lape and Trèche, 1994; Afoakwa and SefaDedeh, 2001). The use of D. dumetorum as famine food is therefore recommended with caution. D. dumetorum is not only used for human consumption but also for pharmaceutical purposes. Thus, a novel bio-active compound dioscoretine in D. dumetorum has been detected (Iwu et al., 1990), which is acceptable pharmaceutically and which can be used advantageously as a hypoglycemic agent to reduce the blood glucose level in situations of acute stress such as experienced by patients with hyperthermia, trauma, sepsis and burns and those undergoing general anesthesia (Sonibare et al., 2010). In the practice of folk medicine in West Africa, D. dumetorum has been used by herbalists and traditional medical practitioners for the treatment of diabetes and as a topical anesthetic while others have used it as an arrow poison and as bait for monkeys (Corley et al., 1985). Agronomically, D. dumetorum is high-yielding, with yields of 10 and 40 tones/hectare recorded under traditional farming conditions and in agricultural stations, respectively (Lyonga and Ayuk-takem, 1979; NgongNasah et al., 1980; Treche, 1989). It is one of the only two species in which high level of resistance to two major nematode parasites of yam has been reported (Kwoseh, 2000). Unlike the other yams, staking is not necessary to maintain yield (Agbor-Egbe and Treche, 1995) and the tubers grow near the surface of the soil. This saves labour and allows for mechanization of harvest (SefaDedeh and Afoakwa, 2002). Despite these qualities, in general little information is available on D. dumetorum diversity but in the case of Cameroon no information is available. Genetic diversity is the prerequisite for any plant breeding program. Furthermore, the key to success for any genetic improvement programme lies in the availability and measure of genetic variability of desired traits. Morphological characterization is an important first step in description and classification of crop germplasm because a breeding program mainly depends upon the magnitude of genetic variability. However, morphological traits have been widely used in the study of yam germplasm and other yam species, specifically to determine the relationships between the various species and landraces, as well as to develop identification keys (Dansi et al., 1999; Mignouna et al., 2002; Norman et al., 2011; Tamiru et al., 2011). Such studies have not been conducted on D. dumetorum species. The aim of this study was to assess the genetic diversity of D. dumetorum in two different agro-ecological zones of Cameroon in order to show the influence of environmental conditions on morphological characters. MATERIALS AND METHOD Plant materials A total of 43 accessions of D. dumetorum with 2 accessions of Dioscorea cayenensis as out-group species are considered in this study (Table 1). 42 are collected from various localities in the main yam growing regions (West, South-West and Nord-west) in Cameroon, 3 from Nigeria. Two accessions of D. cayenensis were chosen as out-group species. The accessions were planted in the same period (April 2013) in two experimental fields, one in the West region at „‟Ferme Ecole Boukue‟‟ (FEBO) in Baham and the other in the South-West region at „‟Institue de Recherche Agricole pour le Developpement‟‟ (IRAD) of Ekona. There was no control over environmental conditions. FEBO is located at latitude 05°20.040' N, longitude 010°22.572 E and an elevation of 1634±3 m asl. FEBO belongs to agro-ecological zone III (Western highlands) characterized by rainfall of 1500 to 2000 mm, with mean annual temperature of 19°C (Anonymous, 2008) whereas, IRAD of Ekona is located at latitude 04°12.773'N, longitude 009°19.425'E, and elevation of 445±3 m and belongs to agro-ecological zone IV (Humid forest with monomodal rainfall) with rainfall of 2500 to 4000 mm and mean annual temperature of 26°C (Figure 1). Field planting The tubers were planted in the field at 1 m spacing in each row, and 1 m between rows. The tubers were planted in an arranged randomized complete block with a replicate plot of ten plants per accession. Each plant was supported by an independent stake of Phyllostachys to induce good canopy development (Figure 2). Morphological characterization The morphological description was done according to International Plant Genetic Resources Institute (IPGRI) and International Institute of Tropical Agriculture (IITA) descriptors for yam (IPGRI/IITA, 1997). These descriptors for yam have been previously used for characterizing cultivated yam (Dansi et al., 1999; Mignouna et al., 2002; Tamiru et al., 2011). Data collection and analysis Data was recorded on different types of qualitative and quantitative morphological characters with varying scales of measurements (Table 2). The characters were measured on all the plants in each replication, and mean values from the two replications were used for analysis. Data was analyzed for simple statistic (mean, standard deviation, and variance). Variance components (genotypic δ 2g and phenotypic δ2p) were estimated using Wricke and Weber (1986) formula. Phenotypic (PCV) and genotypic (GCV) coefficient of variation were evaluated as suggested by Singh and Chaudhry (1985). Heritability (broad sense h2) and genetic advance as percentage of mean were calculated as per Hanson et al. (1956) and Johnson et al. (1955), respectively. Cluster analysis was performed using single linkage with the Euclidean distance. The analyses were made using the computer program IBM/SPSS Siadjeu et al. 783 Table 1. Accessions of D. dumetorum used in this study. Accessions code Alou 1 Babadjou1 Babungo 1 Bafut 1 Baham cayenensis 1 Bambalang 1 Bambui 1 Bamendjou1 Bamendjou2 Bamokonbou1 Bana1 Bandjoun cayenensis 2 Banga bakundu sweet 1 Bangang 1 Bangang 2 Bangangté1 Bangou1 Batibo 1 Bayangam1 Bayangam 2 Bekora 1 Bekora 2 Buea sweet 1 Buea sweet white yam 1 Dschang1 Ekona Muyuka sweet white 1 Fenkam-Foto1 Fongo-Tongo1 Fonkouankem1 Fundong 1 Guzang 1 Ibo sweet 1 Ibo sweet 2 Ibo sweet 3* Kumbo 1 Lysoka sweet 1 Mabondji sweet white 1 Mabondji sweet yellow 1 Mankon 1 Mbongue sweet 1 Muyuka 1 Muyuka 2 Muyuka 3 Nkwen 1 Penda-boko sweet 1 Local name Meleuh Neliola Leueh Nelegha Leng Leueh Neleghe-ndongbeu Chechio Torguem Nelio Chinchi Leng Sweet yam Neliola Nelio Peule Torgai Aysoh Chechio Torguem Sweet yam Sweet yam Sweet yam Sweet yam Lilio Sweet yam Chechio Nloh-nelek Torga Alim Ndong-mbeck Ibo sweet Ibo sweet Ibo sweet Reeg Lysoka sweet yam Sweet yam mabondji Sweet yam mabondji Ndong-nebengha Sweet yam Sweet yam Sweet yam Sweet yam Zolik Penda-boko sweet 1 Area of Altitude collection (±3 masl.) Alou 1606 Mbouda 1395 Babungo 1182 Bafut 1123 Baham 1647 Bambalang 1185 Bambui 1262 Baham 1647 Baham 1647 Bafoussam 1414 Bafang 1167 Bandjoun 1509 Muyuka 62 Bangang 1776 Bangang 1776 Bangangté 1350 Bangangté 1350 Batibo 1127 Bayamgan 1560 Bayamgan 1560 Bekora 60 Bekora 60 Muea 554 Muea 438 Dschang 1337 Muea 401 Bafoussam 1414 Fongo-Tongo 1460 Bafang 1167 Fundong 1554 Guzang 1233 Banga Bakondu 56 Banga Bakondu 56 Banga Bakondu 56 Kumbo 1722 Lysoka 60 Mabondji 80 Mabondji 80 Mankon 1253 Muyuka 62 Muea 554 Muea 554 Muyuka 62 Nkwen 1251 Muea 554 Latitude (N) 05°31.240‟ 05°37.488‟ 06°03.984‟ 06°05.187‟ 05°20.063‟ 05°53.644‟ 06°00.797‟ 05°20.063‟ 05°20.063‟ 05°28.781‟ 05°09.365‟ 05°22.392‟ 04°17.314‟ 05°34.303‟ 05°34.303‟ 05°08.379‟ 05°08.379‟ 05°50.144‟ 05°17.930‟ 05°17.930‟ 04°36.114‟ 04°36.114‟ 04°10.149‟ 04°12.295‟ 05°26.637‟ 04°12.740‟ 05°28.781‟ 05°30.118‟ 05°09.365‟ 06°16.790‟ 05°49.983‟ 04°24.103‟ 04°24.103‟ 04°24.103‟ 06°12.386‟ 04°11.306‟ 04°33.745‟ 04°33.745‟ 05°58.172‟ 04°17.314‟ 04°10.149‟ 04°10.149‟ 04°17.314‟ 05°57.717‟ 04°10.149‟ Longitude (E) 009°56.479‟ 010°15.668‟ 010°26.823‟ 010°07.094‟ 010°22.118‟ 010°30.814‟ 010°13.635‟ 010°22.118‟ 010°22.118‟ 010°25.197‟ 010°10.147‟ 010°24.960‟ 009°24.451‟ 010°09.133‟ 010°09.133‟ 010°31.406‟ 010°31.406‟ 009°53.467‟ 010°26.446‟ 010°26.446‟ 009°05.704‟ 009°05.704‟ 009°18.149‟ 009°19.912‟ 010°03.404‟ 009°19.554‟ 010°25.197‟ 009°59.976‟ 010°10.147‟ 010°17.075‟ 009°55.278‟ 009°26.522‟ 009°26.522‟ 009°26.522‟ 010°40.478‟ 009°18.745‟ 009°11.806‟ 009°11.806‟ 010°08.541‟ 009°24.451‟ 009°18.149‟ 009°18.149‟ 009°24.451‟ 010°10.078‟ 009°18.149‟ * These accessions collected in Cameroon come from Nigeria. statistics 20. Quantitative and qualitative characters were analyzed separately to avoid the effect due to the difference in scale. Thus, for quantitative characters, cluster analysis was conducted on the basis of average distance of k-means whereas for qualitative characters, it was on the basis of average linkage. Out-group species was used to give a root to the tree in hierarchical cluster 784 Afr. J. Biotechnol. 0 30 60 90 120 150 km North-West Region AEZ 3 Fudong Bafut Kumbo Bamenda Batibo Santa Mbouda South West Region AEZ 4 Nkambe Alou Dschang Baham Bafang Banguem West Region AE Z 3 Galim Foumbot Bafoussam Bandjoun Bayangam Bangangté Bazou Kumba Ekondo-Titi MBongue Muyuka Ekona Buea Douala Figure 1. Map of the sample collection areas including the two experimental sites (Baham and Ekona) and some locations where accessions have been collected. analysis. Principal component analysis was used for variables reduction. Multivariate analyses are a valid system to deal with germplasm collections (Falcinelli et al., 2008). RESULTS The estimates of genotypic and phenotypic variance, broad sense heritability and genetic advance in percentages of means and genotypic and phenotypic coefficients of variation are given in Table 3. Variance analysis for characters revealed highly significant differences among genotypes for all the traits evaluated. Genetic advance as percentage of the mean was highest for harvest index (86.84%, P=0.05), internode number (59.03%, P=0.05), and stem length (53.45%, P=0.05) (Table 3). Broad sense heritability estimates was high for all the characters. The magnitude of phenotypic coefficient of variation (PCV) values for all the traits was higher than the corresponding genotypic coefficient of variation. The highest values of genetic advance as percentage of mean were for harvest index (86.84%), internode number (59.03%) and stem length (53.45%). The first three components with eigen values > 1 contributed 83.26% of the variability, while the first component (PC1) alone accounted for 60% of the total of the variation amongst 45 accessions evaluated for nine Siadjeu et al. 785 A A B Figure 2. Experimental fields. A: IRAD (Ekona); B: FEBO (Baham). quantitative traits (Table 4). The first principal component (PC1) was more related to stem length, leaf length, internode number and leaf width. The second principal component (PC2), explaining 18.49% of total variation was associated with harvest index, leaf number and internode length. The third principal component (PC3), explaining 14% of total variation was correlated with day to emergence and stem diameter. Based on the average distance of k-means, quantitative traits accessions were grouped into three. Group I consisted of five accessions, group II of 10, and group III of 30 accessions. Cluster I was constituted by one accession from the North-West (30), three from South-West (1, 24, 26) and one accession of D. cayenensis (12). Cluster II, included three accessions from the West region (8, 15, and 20), two accessions from Nigeria (32, 34), four from South-West region (13, 37, 43, and 45) and one accession from out-group species (5). Cluster II included all the D. dumetorum accessions form West, North-West, South-West regions and Nigeria. Mean values along S.D. for each cluster (Table 5) showed that accessions in Cluster II were highest mean performance for most of the characters studied. Accessions of this cluster gave high yielding and medium number of days to emergence, whereas accessions in cluster I was high yielding but more days to emergence. The first two principal components were plotted to observe relationships between the clusters (Figure 3). Cluster I and III were clearly separated, whereas cluster II was not clearly separated. Morphology diversity qualitative characters assessed by cluster for Cluster analysis using single linkage of 32 morphological qualitative characters gave two major groups in Baham (Figure 4) and two major groups in Ekona (Figure 5). Cluster I in Baham was constituted of 34 accessions. It included all the accessions from West and North-West region with six accessions from South-West region (1, 13, 23, 24, 43 and 37) and three from Nigeria (32, 33 and 34). This cluster is characterized by low spines on and 786 Afr. J. Biotechnol. Table 2.Morphological descriptors used for characterization. Characters Young stem Days to emerge* Stem length (cm) * Internode number* Adult stem Internode length (cm)* Presence/absence of spines Spine length** Spines on stem base** Spines on stem above base** Vigour of entire plant** Twining habit** Twining direction** Adult stem colour** Stem diameter* State 0 absent, 1present 3= short, 5= intermediate,7= long 3= few, 7= many 3= few, 7= many 3=low, 5=intermediate, 7=high 2= no, 1= yes 1= clockwise, 2= anticlockwise 1= green, 2= purplish green, 3= brownish green, 4= dark brown, 5= purple Young leaves Leaf number at 20 days after emergence* Adult leaves Petiole length (cm)** Leaf lenght (cm)* Leaf width (cm)* Leaf tip (mm)** Leaf type* Leaf colour** Leaf base shape** Leaf density** Leaf margin** Position of leaves** Leaf lobation** Leaf Apex shape** Flowering Flowering** Fructification** Tuber Presence/absence of aerial tuber** Number of tubers per seedbed** Tuber length (cm)** Tuber skin colour** Tuber skin thickness** Tuber shape** Tendency of tuber to branch** Place where tuber branched** Root on the tuber surface** Place of roots on the tuber** Presence/absence of cracks on the tuber surface** Tuber skin thickness** Flesh colour of lower part of tuber** 1= ≤5 cm, 2= 6-9 cm, 3= ≥10 cm 1= <2 mm, 2= 2-5 mm, 3= >5 mm 1= Simple, 2= Compound 1= green, 2= purple 1= ovate, 2= cordate, 3= cordate long, 4= cordate broad, 5=sagittate long, 6= sagittate broad, 7= hastate 3= low, 5= intermediate, 7= high 1=entire, 2= serrate 1= alternate, 2= opposite, 3= alternate at base/opposite above 1= shallowly lobed, 2= deeply lobed 1 Obtuse, 2 Acute, 3 Emarginate 0 no, 1 yes 0 no, 1 yes 0 absent, 1 present 1= one, 2= few (2-5), 3=several (>5) 1= ≤20 cm, 2= 21 - 40 cm, 3 ≥41 cm 1=Light maroon, 2= dark maroon, 3=greyish 1= <1 mm, 2= ≥1 mm 1= round,2= oval, 3= oval-oblong,4= cylindrical,5= flattened,6= irregular 3= slightly branched, 5= branched,7= highly branched 1= upper third, 2= middle, 3= lower third 3= few, 7= many 1= lower, 2= middle, 3= upper, 4= entire tuber 0= absence, 1= present 1= <1mm, 2 ≥1mm 1= white,2= yellowish white or off-white,3= yellow,4= orange,5= light purple,6= purple 7= purple with white,8= white with purple,9= outer purple/inner yellowish Harvest index* *State not specified in IPGRI/IITA, ** Characters used for clustering and principal component analysis. Siadjeu et al. 787 Table 3. Basic statistics, variance components (δ2g, δ2p), genotypic (GCV) and phenotypic (PCV) coefficient of variations, broad sense of heritability (h 2) and genetic advance (GA %, P=0.05) for 43 accessions of D. dumetorum and 2 accessions of D. cayenensis 2 2 2 Character Mean ± S.E. δg δp h GCV PCV GA (%) Day to emergence 20.15±0.33 654.74 688.48 0.95 0.53 0.54 44.18 Stem length (cm) 90.47 ±1.22 4751.57 5364.35 0.89 0.50 0.53 53.45 Internode number 10.58±0.21 98.41 118.67 0.83 0.49 0.54 59.03 Number of Leave 11.68±0.23 270.51 287.69 0.94 0.51 0.53 44.34 Leaf length/ leaf width 1.49±0.01 0.42 0.43 0.96 0.73 0.75 44.77 Stem diameter (cm) 0.47±0.01 0.26 0.27 0.97 0.58 0.59 45.28 Internode length (cm) 14.40±0.15 32.38 40.62 0.80 0.29 0.33 37.56 Harvest index (%) 3.40±0.23 64.86 95.77 0.68 0.61 0.75 86.84 Table 4. Principal component (PCs) for nine quantitative characters in 43 accessions of D. dumetorum and two accessions of D. cayenensis. Parameter Eigenvalue Variance (%) Cumulative (%) Stem length Leaf length Internode number Leaf width Harvest index Leaf number Internode length Day to emergence Stem diameter PC1 4.57 50.83 50.83 0.90 0.85 0.85 0.72 -0.08 0.49 0.62 -0.15 0.48 PC2 1.66 18.49 69.32 0.31 0.14 -0.07 0.44 0.79 0.78 0.68 0.10 -0.09 PC3 1.25 13.94 83.26 0.07 0.27 -0.14 0.22 0.00 0.08 -0.04 0.96 0.84 Table 5. Mean and S.D. for three clusters on agronomic traits. Trait Cluster I Cluster II Cluster III Stem length (cm) 51.77±8.61 122.60±14.65 82.95±8.29 Leaf length (cm) 8.05±0.46 13.10±1.62 10.85±1.11 Internode number 7.99 ± 2.50 14.54±4.66 9.48±1.60 Leaf width (cm) 5.71±1.48 9.50±1.85 7.13±0.78 Harvest index 5.31±6.69 4.47±1.75 2.51±1.64 Leaf number 9.91±3.80 16.56±7.06 10.14±1.69 Internode length (cm) 8.43±2.33 16.09±2.22 13.71±1.49 Day to emergence 29.33±15.09 25.55±10.43 20.61±7.82 Stem diameter 0.37±0.13 0.66±0.16 0.48±0.15 above stem base. Cluster II contained nine accessions (21, 22, 26, 36, 38, 40, 41, 42 and 45). All the accessions of this cluster were from South-West region. They were characterized by many spines on and above stem base, except accession 36 with low spines on stem base. In Ekona, Cluster I was constituted by 31 accessions. It included all the accessions from West and North-West regions with six accessions from South-West region (1, 13, 23, 36, 37 and 43). As in Baham, this cluster was characterized by low spines on and above stem base. 788 Afr. J. Biotechnol. Figure 3. Scattered diagram of 43 accessions of D. dumetorum and 2 accessions of D. cayenensis for two PCs. The digits 1, 2 and 3 represent the cluster number. Cluster II contained nine accessions from South-West (21, 22, 24, 26, 38, 40, 41, 42 and 45) and three from Nigeria (32, 33 and 34). They were characterized by many spines on and above stem base. It contained the only accession which formed flowers and fruits (32). Morphology diversity assessed component for qualitative characters by principal The result of principal component analysis based on 25 and 26 qualitative characters of 43 accessions of D. dumetorum in Baham and Ekona, respectively, are presented in Tables 6 and 7. In Baham six principal components are observed with Eigen-values greater than 1.0 contrary to Ekona with seven principal components. In Baham, the first six principal components explained 71.39% of the variation, while the first principal component (PC1) alone explained 21.60% of the total variation. The PC1 had high loading for tendency of tuber branched, tuber shape, leaf density, number of tuber per seedbed, flowering. The second component (PC2) explaining about 16% of total variation was correlated with spines on stem base, spines on stem above base, spines length and plant vigor. The third component (PC3) explaining about 11% of total variation was mainly associated with characters such as roots on tuber surface, place of roots on the tuber surface, and cracks on the tuber surface. In Ekona, the first seven principal components explained 77.34% of the variation, while the first principal component (PC1) alone explained about 22% of the total variation. The PC1 had high loading for spines on stem base, spines on stem abovebase, spines length and tuber length. The second component (PC2) explaining about 17% of total variation was correlated with roots on tuber surface, and place of roots on the tuber surface. The third component (PC3) explaining about 12% of total variation was mainly associated with characters such as tuber shape, petiole length and leaf density. To assess the scores of individual accessions PC1 and PC2 were plotted (Figure 6). In Baham, the biggest set which represented the cluster I in cluster analysis occupied the low corner of the plot with relatively the highest positive and negative values for PC1. Contrary to cluster analysis, PCA analysis detected one sub-group within cluster I. This sub-group was constituted by nine accessions from West (8, 9, 10, 15, and 20), South-West (37 and 43) regions and Nigeria (32 and 33). It constituted the flowering accessions. The second set represented the cluster II which occupied the top corner of the plot with relatively high score for PC2. In Ekona, the biggest set which represented the cluster I in cluster analysis occupied the right corner of the plot with relatively the highest positive and negative values for PC2. The second set represented the cluster II, and occupied the left corner of the plot with relatively high positive Siadjeu et al. 789 0 I I II II Banga bakudu sweet 1 Muyuka 3 Bamendjou 1 Mabondji sweet white 1 Alou 1 Fundong 1 Batibo 1 Bafut 1 Mankon 1 Bangangté 1 Babungo 1 Dschang 1 Bangang 1 Kumbo 1 Nkwen Babadjou 1 Bana1 Fenkam-foto1 Bambalang 1 Ibo sweet 1 Ibo sweet 3 Bamendjou 2 Bangang 2 Bamokonbou 1 Bayangam 2 Ibo sweet 2 Bambui 1 Bangou 1 Guzang 1 Fongo-tongo 1 Fonkouankem 1 Buea sweet 1 Bayangam 1 Buea sweet white yam 1 Bekora 1 Muyuka 1 Bekora 2 Muyuka 2 Penda-boko sweet 1 Mabondji sweet yellow 1 Mbongue sweet 1 Ekona Muyuka sweet white 1 Lysoka sweet 1 Baham cayenensis 1 Bandjoun cayenensis 1 5 Rescaled Distance Cluster Combine 10 15 20 25 13 43 8 37 1 30 18 4 39 16 3 25 14 35 44 2 11 27 6 32 34 9 15 10 20 33 7 17 31 28 29 23 19 24 21 41 22 42 45 38 40 26 36 5 12 Figure 4. Relationship of 43 accessions of D. dumetorum and 2 accessions of D. cayenensis based on single linkage clustering of 32 qualitative characters in Baham. score for PC1. DISCUSSION The key to success of any genetic improvement programme lies in the availability of genetic variability of the desired traits (Heller, 1996). Morphological charac- terization is an important first step in description and classification of crop germplasm because a breeding program mainly depends upon the magnitude of genetic variability (Ghafoor et al., 2001). Quantitative characters For all the quantitative characters, the magnitude of 790 Afr. J. Biotechnol. 0 I II Bambui 1 Nkwen 1 Bambalang 1 Bana1 Bangang 1 Bamendjou 1 Banga bakundu sweet 1 Muyuka 3 Mabondji sweet white 1 Bafut 1 Fenkam-foto1 Batibo 1 Dschang 1 Kumbo 1 Babadjou 1 Babungo 1 Mankon 1 Fundong 1 Alou 1 Bangangté 1 Bayangam 1 Bangang 2 Bayangam 2 Fongo-tongo 1 Lysoka sweet 1 Fonkouankem 1 Guzang 1 Bamokonbou 1 Bamendjou 2 Bangou 1 Buea sweet 1 Bekora 1 Muyuka 1 Bekora 2 Mbongue sweet 1 Muyuka 2 Penda-boko sweet 1 Ibo sweet 1 Ibo sweet 3 Mabondji sweet yellow 1 Buea sweet white yam 1 Ekona Muyuka sweet white 1 Ibo sweet 2 Baham cayenensis 1 Bandjoun cayenensis 1 5 Rescaled Distance Cluster Combine 10 15 20 25 7 44 6 11 14 8 13 43 37 4 27 18 25 35 2 3 39 30 1 16 19 15 20 28 36 29 31 10 9 17 23 21 41 22 40 42 45 32 34 38 24 26 33 5 12 Figure 5. Relationship of 43 accessions of D. dumetorum and 2 accessions of D. cayenensis based on single linkage clustering of 32 qualitative characters in Ekona. Table 6. Principal components (PCs) for qualitative characters in 43 accessions of D. dumetorum in Baham. Parameter Eigenvalue % of variance Cumulative (%) Tendency of tuber branched Tuber shape Leaf density Number of tuber per seedbed PC 1 4.10 21.60 21.60 0.761 0.744 0.726 0.658 PC 2 3.03 15.96 37.57 -0.094 -0.206 -0.203 -0.099 PC 3 2.13 11.21 48.78 0.048 0.049 0.146 -0.204 PC 4 1.68 8.86 57.64 -0.255 0.222 0.137 0.269 PC 5 1.38 7.25 64.89 0.079 -0.400 0.422 0.231 PC 6 1.23 6.50 71.39 0.187 -0.020 0.075 -0.305 Siadjeu et al. 791 Table 6. Contd. Parameter Flowering Tuber length Spines on above stem base Spines length Spines on stem base Plant vigour Roots on tuber surface Place of roots on the tuber surface Cracks on the tuber surface Leaf lobation Tuber flesh colour Petiole length Place where tuber branched Aerial tuber Tuber skin thickness PC 1 0.645 0.413 -0.160 0.013 -0.269 0.496 0.099 0.145 0.031 0.066 -0.132 0.145 0.121 0.004 -0.048 PC 2 0.271 -0.058 0.884 0.878 0.862 0.638 -0.094 -0.139 0.264 0.084 -0.083 0.064 -0.146 -0.151 0.111 PC 3 0.208 0.351 -0.122 -0.152 -0.108 0.009 0.935 0.905 -0.609 -0.136 0.253 0.250 -0.405 -0.047 -0.138 PC 4 -0.264 -0.128 0.224 0.005 -0.157 -0.222 0.093 0.077 0.156 0.795 0.694 0.105 -0.107 -0.141 -0.279 PC 5 0.264 -0.164 -0.007 -0.024 -0.102 0.287 -0.004 0.067 -0.191 0.084 -0.069 0.790 0.509 -0.137 -0.197 PC 6 0.038 -0.331 -0.019 -0.115 -0.115 -0.086 0.109 0.135 0.274 -0.007 0.090 -0.012 0.043 0.795 -0.649 Table 7. Principal components (PCs) for qualitative characters in 43 accessions of D. dumetorum in Ekona. Parameter Eigenvalue % of variance Cumulative (%) Spines on above stem base Spines on stem base Spines length Tuber length Roots on tuber surface Place of roots on the tuber surface Tuber shape Petiole length Leaf density Cracks on the tuber surface Flowering Number of tuber per seedbed Tuber flesh colour Leaf lobation Plant vigour Tendency of tuber branched Tuber skin thickness Aerial tuber Fruit formation Place where tuber branched PC 1 4.40 22.01 22.01 0.914 0.914 0.876 0.712 -0.139 -0.139 0.191 0.164 -0.228 0.375 0.174 -0.394 -0.041 0.224 0.485 -0.221 0.399 -0.053 0.225 0.273 phenotypic coefficient of variation (PCV) values for all the traits was near the corresponding genotypic coefficient of variation. This indicated a highly significant effect of genotype on phenotypic expression with little effect of the environment (Manju and Sreelathakumary, 2002). High PC 2 3.48 17.39 39.40 -0.115 -0.115 -0.117 0.110 0.962 0.962 0.311 0.071 0.123 -0.336 0.047 0.050 0.033 -0.092 -0.016 0.041 0.379 -0.196 0.003 0.467 PC 3 2.42 12.11 51.50 -0.166 -0.166 -0.051 0.190 0.002 0.002 -0.712 0.673 0.655 -0.486 -0.001 0.074 -0.179 0.170 0.232 0.088 -0.163 0.225 -0.069 0.075 PC 4 1.53 7.65 59.16 -0.094 -0.094 0.198 0.357 0.033 0.033 0.198 0.140 0.434 0.175 0.851 0.422 -0.109 0.320 0.274 0.098 0.167 -0.176 0.457 0.073 PC 5 1.31 6.56 65.72 0.086 0.086 -0.190 0.071 0.010 0.010 -0.073 -0.088 -0.319 0.090 0.049 -0.269 0.812 0.738 -0.532 0.032 -0.062 -0.056 -0.029 -0.188 PC 6 1.18 5.92 71.65 -0.029 -0.029 0.030 -0.064 0.059 0.059 0.263 0.394 0.151 0.251 0.144 0.242 -0.050 0.184 0.289 0.834 0.575 0.282 -0.282 0.254 PC 7 1.14 5.69 77.34 0.086 0.086 -0.014 0.054 -0.035 -0.035 -0.162 0.047 0.154 0.087 -0.009 0.268 -0.003 -0.157 0.046 0.148 -0.029 0.743 0.707 0.536 GCV along with high heritability and high genetic advance will provide better information than single parameters alone (Saha et al., 1990; Baye et al., 2005). Hence, traits such as harvest index, internode number and stem length can be improved in the breeding 792 Afr. J. Biotechnol. II I II I A 1 2 B 1 2 Figure 6. Plot of the first (PC1) and the second (PC2) principal components for 43 accessions of D. dumetorum based on qualitative characters. A: Baham; B: Ekona. The numbers represent the accessions. program of D. dumetorum. However, all the traits of this study showed high heritability, and according to Manju and Sreelathakumary (2002), high heritability estimates indicate the presence of large number of fixable variable additive factors and hence these traits may be improved by selection. The PCA revealed that stem length, leaf length, internode number, leaf width, harvest index, leaf number and internode length were positive, indicating that these traits contributed at their peak towards diversity and can be used in the classification of D. dumetorum accession. Qualitative character Cluster analysis using single linkage of 32 morphological qualitative characters gave two major groups of D. dumetorum accessions in Ekona as well as in Baham with a few differences between the members of these groups, that is, accession 32 formed flowers and fruits in Ekona but has not flowered in Baham. This difference is probably due to environmental effects, in fact plants respond and adapt differently to pressure differences imposed by distinctive agro-climatic zones (Singh et al., 1998). There was no clear separation between accessions and area of collection. The same result has been reported by Sonibare et al. (2010), resulting fromthe natural migration of populations. Cluster analysis has also clearly separated D. dumetorum accessions from D. cayenensis accessions in the two areas of cultivation. This observation is explained by the fact that both species belong to two different sections; lasiophyton and Enantiophylum for D. dumetorum and D. cayenensis, respectively. The section lasiophyton is characterized by the fact that the vines twine to the right, that is, in a clockwise direction when viewed from the ground upwards, whereas species in section Enantiophylum twine to the left (Onwueme and Winston, 1994). The PCA analysis is a way of identifying patterns in the data and expressing the data in such a way as to highlight their similarities and differences (Winterota et al., 2008). Traits such as the tendency of the tuber to branch, tuber shape, leaf density, number of tubers per seedbed, flowering, spines on stem base, spines on stem above base, spines length and plant vigor were positive for PC1 and PC2, thus contributing to the maximum diversity of D. dumetorum accessions, whereas in Ekona, we had traits such as spines on stem base, spines on stem above base, spines length and tuber length, roots on tuber surface and place of roots on the tuber surface. This difference is related to the fact that plants react differently to varying environmental conditions. That is why morphological and agronomic features cannot be relied upon due to the inconsistency in identification (Muthamia et al., 2013). The results were consistent between cluster and PCA analysis, but the PC detected in Baham shows that the subgroup of D. dumetorum was constituted by the flowering accessions. Thus, grouping accessions by multivariate methods is practical value in the breeding programme, Ghafoor et al. (2001) have already remarked this in blackgram (Vigna mungo L.). Conclusion This study shows the relatively high genetic diversity of D. dumetorum accessions. This diversity could effectively be used in the breeding programme of D. dumetorum accessions. Although, morphological traits allowed the Siadjeu et al. separation of D. dumetorum in different clusters, their expression is subjected to agro-climatic variations and thus provide limited genetic information. This is why, molecular markers are recommended with caution to reveal the full extent of existing biodiversity of D. dumetorum in Cameroon. Conflict of interests The authors did not declare any conflict of interest. REFERENCES Afoakwa EO, Sefa-Dedeh S (2001). Chemical composition and quality changes in trifoliate yam Dioscorea dumetorum tubers after harvest. J. Food Chem. 75(1):85-91. Agbor-Egbe T, Treche S (1995). Evaluation of the chemical composition of Cameroonian yam germplasm. J. Food Compost. Anal. 8:274283. Anonymous (2008). Second report on the state of plant genetic resources for food and agriculture in Cameroon. Institute of Agricultural Research and Development (IRAD), Yaounde, Cameroon 74 p. Baye B, Ravishankar R, Singh H (2005). Variability and association of tuber yield and related traits in potato (Solanum tubersum L.). Ethiop. J. Agric. Sci. 18(1):103-121. Corley D, Tempesta MS, Iwu M (1985). Convulsant alkaloids from Dioscorea dumetorum. Tetrahedron Lett. 26 (13):1615-1618. Coursey DG (1976). The origins and domestication of yams in Africa. In: Origins of African domestication. Ed Harlan JR. Mouton Publisher pp. 383-408. Dansi A, Mignouna HD, Zoundjihékpon J, Sangaré A, Asiedu R, Quin F (1999) Morphological diversity, cultivar groups and possible descent in the cultivated yams (D. cayenensis / D. rotundata) complex in Benin Republic. Gen. Res. Crop Evol. 46:371-388. Degras L (1993). The yam: a tropical root crop (2ndedn.). London: Macmilan Press Ltd. 408 p. Falcinelli M, Veronesi F, Lorenzetti S (1988). Evaluation of an Italian germplasm collection of Lolium perenne L. through a multivariate approach. In: Proceedings of the Eucarpia Fodder Crops Section Meeting, Lusignan, France. pp. 22-24. Ghafoor A, Sharif A, Ahmad Z, Zahid MA, Rabbani MA (2001). Genetic diversity in blackgram (Vigna mungo L. Hepper). Field Crops Res. 69:183-190. Hanson CH, Robinson HF, Comstock RE (1956). Biometrical studies on yield in segregating population of Korean lespedesa. Agron. J. 48: 268-272. Heller J (1996). Physic nut Jatropha curcas L. Promoting the conservation and use of underutilized and neglected crops. Institute of Plant Genetic and Crop Plant Research, Gatersleben/International Plant Genetic Resource Institute, Rome. IPGRI/IITA (1997). Descriptors for Yam (Dioscorea spp.). International Plant Genetic Resources Institute (IPGRI), Rome), International Institute for Tropical Agriculture (IITA) (Ibadan) 53 p. Iwu MM, Okunji CO, Ohiaeri GO, Akah P, Corley D, Tempesta MS (1990). Hypoglycaemic activity of dioscoretine from tubers of Dioscorea dumetorum in normal and alloxan diabetic rabbits. Planta Med. 56 (3):264-268. Johnson HW, Robinson HF, Conmstock RE (1955). Estimates of genetic and environmental variability in soybeans. Agron. J. 47:314318. Kwoseh CK (2000). Identification of resistance to major nematode pest of yams (Dioscorea spp.) in West Africa. PhD thesis. University of Reading, UK. 196 p. 793 Lyonga SN, Ayuk-takem JA (1979). Collection, selection and agronomic studies on edible yams (Dioscorea spp.) in Cameroun. Proceedings of Fifth International Symposium of Tropical Root Crops. pp. 217-243. Manju PR, Sreelathakumary I (2002).Genetic variability, heritability and genetic advance in hot Chilli (Capsicum Chinense Jacq.). J. Trop. Agric. 40:4-6. Mbome Lape I, Trèche S (1994). Nutritional quality of yams (D. rotundata and D. dumetorum) flours for growing rats. J. Sci. Food Agric. 66: 447-455. Mignouna HD, Abang MM, Fagbemi SA (2003). A comparative assessment of molecular marker assays (AFLP, RAPD and SSR) for white yam (Dioscorea rotundata) germplasm characterization. Ann. Appl. Biol. 142:269-276. Mignouna HD, Dansi A, Zok S (2002). Morphological and isozymic diversity of the cultivated yams (Dioscorea cayenensis/ Dioscorea rotundata complex) of Cameroon. Genet. Resour. Crop Evol. 49:2129. Muthamia ZK, Morag FE, Nyende AB, Mamati EG, Wanjala BW (2013). Estimation of genetic diversity of the Kenyan yam (Dioscorea spp.) using microsatellite markers. Afr. J. Biotechnol. 12(40):5845-5851. Ngong-Nassah E, Lyonga SN, Ayuk-Takem J (1980).How to grow yams for better yields. Technical Bulletin N° 3, IRA, Bambui, Cameroon. Norman PE, Tongoona P, Shanahan PE (2011). Diversity of the morphological traits of yam (Dioscorea spp.) genotypes from Sierra Leone. J. Appl. Biosci. 45:3045-3058. Onwueme IC, Winston BC (1994). Tropical Root and Tuber Crops: Production, Perspectives and Future Prospects. Food & Agriculture Org (Ed.), Rome 228 p. Saha SC, Mishira SN, Mishira RS (1990). Genetic variation in F2 generation of Chilli capsicum. NewsLett. 8:29-30. Sefa-Dedeh S, Afoakwa EO (2002). Biochemical and textural changes in trifoliate yam Dioscorea dumetorum tubers after harvest. Food Chem. 79:27-40. Singh AK, Smart J, Simpson CE, Raina SN (1998). Genetic variation visa-vis molecular polymorphism in groundnut, Arachis hypogaea L. Genet. Resour. Crop. Evol. 45:119-126. Singh RK, Chaudhry BD (1985). Biometrical Methods in Quantitative Genetic Analysis. Kalyani Publishers, Ludhiana 303 p. Sonibare Mubo A, Asiedu R, Albach DC (2010). Genetic diversity of Dioscorea dumetorum (Kunth) Pax using Amplified Fragment Length Polymorphisms (AFLP) and cpDNA. Biochem. Syst. Ecol 38:320-334. Tamiru M, Becker HC, Maass BL 2011. Comparative analysis of morphological and farmers cognitive diversity in yam landraces (Dioscorea spp.) from Southern Ethiopia. Trop. Agric. Dev. 55(1):2843. Treche S (1989). Nutritional potential of yams (Dioscorea spp.) cultived in Cameroon. Appendices. Thesis, ORSTOM Editions, Collection Studies and Thesis, Paris. 595p. Treche S, Delpeuch F (1979). Evidence for the development of membrane thickening in the parenchyma of tubers of Dioscorea dumetorum during storage. C. R. Hebd. Seances Acad. Sci. 288:6770. Winterota R, Mikulikova R, Mazac J, Havelec P (2008). Assessment of authenticity of fruits spirits by gas chromatographic and staple isotope ratio analyses. Czech J. Food Sci. 26:368-375. Wricke H, Weber WE (1986). Quantitative genetics and selection in plant breeding. Berlin: Walter de Gruyter and Co. Vol. 14(9), pp. 794-810, 4 March, 2015 DOI: 10.5897/AJB2014.14273 Article Number: E58842250962 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Isolation and characterization of some drought-related ESTs from barley Alzahraa Radwan1, Rania M. I. Abou Ali2*, Ahmed Nada1,4, Wardaa Hashem2, Shireen Assem1 and Ebtissam Husein3 1 Department of Plant Molecular Biology, AGERI, ARC, Egypt. Department of Nucleic Acids and Protein Structure, AGERI, ARC, Egypt. 3 Department of Genetics, Faculty of Agriculture, Cairo University, Egypt. 4 Faculty of Biotechnology, October University for Modern Sciences and Arts (MSA), Egypt. 2 Received 27 October, 2014; Accepted 16 February, 2015 Drought is one of the main constraints facing crops and affecting their production. In a trial to investigate and understand drought effect, differential display experiments were performed where; about 107 DD-fragments have been isolated from wild barley plants subjected to drought treatment. These fragments were categorized according to their gene expression into four categories: 1) up regulated genes; 2) up and down regulated; 3) down regulated and 4) down and up regulated genes. The isolated fragments were cloned and sequenced. Sequence analysis using GeneBank database revealed that some fragments have significant similarities with starch branching enzyme I (sbeI) gene; glycosyl transferase family 1 gene; Retrotransposons Ty3-gypsy subclass; gag-polypeptide of LTR copia-type retroelement gene; IMP cyclohydrolase/phosphoribosylaminoimidazolecarboxamide formyltransferase and unknown proteins. Some other fragments have significant similarity with Triticum aestivum gene for TaAP2-B, complete cds and 3B chromosome, clone BAC TA3B63N2. These results indicate that starch metabolism, transposon elements and purine metabolism might have been affected by drought stress. Key words: Wild barley, differential display, drought; starch metabolism, purine metabolism. INTRODUCTION Barley (Hordeum vulgare L) is an important cereal crops. It is ranked as the fourth crop in the 2007 world wide cereal crops’ ranking. It is one member of the grass family. Barley is used for brewing malts for beer, animal feed and certain distilled beverages, and it is a component of human health foods. From evolution point of view, the scientists have hypothesized that the Hordeum spontaneum is the ancestor plant for all types of barley. Since the stone age, barley has been cultivated and consumed. It can grow in many areas because of its adaptability and durability (Fastnaught, 2001). It has many health benefits such as in heart diseases, diabetes, lower level of cholesterol, levels of blood sugar and also as vitamins and antioxidants (Smith, 2004). Barley is *Corresponding author. E-mail: rania2012amsa@gmail.com. Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Radwan et al. mainly grown in the north coastal regions of Egypt under rain fed conditions and in the newly reclaimed lands under irrigation. The area of barley production has been increased, especially in the newly reclaimed lands. Barley is a grain cereal that grown in semi-arid areas. These areas are known with harsh environmental conditions such as drought. Barley can be germinated and grown in such sever conditions. The early growth stages are considered as the most susceptible period to drought stress and the big challenge in the plant productivity (Amini, 2013). Despite of all these difficulties, barley can grow in these semi-arid areas like Egypt. According to Stanca et al. (2003), barley gene content has several good gene candidates that enhance the adaptability of plants to live in the wide harsh environmental conditions. Drought stress is considered as one of the main constraints facing the production of plant crops in the newly reclaimed areas of Egypt. In drought stress, plants suffer wilting from decreased photosynthetic activity, and osmotic fluctuations. Also, they are susceptible during the reproductive stage, reducing yield and fertility (Ashraf, 2010). Many efforts have been made to improve crop production under the conditions of drought stress. Unlike animals, plants cannot escape from environmental stresses that might cause severe damages. Therefore, plants have several adaptation mechanisms that help to tolerate osmotic stress coming from heat, salt and/or drought stresses. These adaptation mechanisms are performed through induction of a plant molecular response (Cattivelli et al., 2011). According to Cattivelli et al. (2011), plant molecular response is performed in three consequence steps; starts with the perception of the external environmental stress followed by signal transduction process to induce selective gene(s) as a final step to accumulate specific protective molecule. Induction of these stress related gene(s) is regulated and controlled by transcriptional elements. These molecular responses improve the ability of the plant to adapt such harsh environmental conditions. In the last 20 years, several stress-related DNA fragments and genes have been fully characterized. The productivity of the plant is too sensitive to the water insufficiency which result from nearly all types of environmental stresses specially the drought stress. Drought stress might cause yield loss more than any other factor that cause loss in the crop yield. Drought stress has a direct effect on plant development where it affects the water/nutrient relationship, respiration and photosynthesis processes (Farooq et al., 2009). Drought causes reduction in transpiration, photosynthesis, and also other biochemical processes related to development, crop productivity and plant growth (Tiwari et al., 2010). Moreover, drought stress has a direct effect on plant morphology where it causes reduction in the leaf size, prolongation of stem and induction of root proliferation (Farooq et al., 2009). The increase in the osmoprotectants synthesis such as soluble sugar and proline enables 795 plants to survive through drought stress. This increase is considered as one of the common metabolic adaptations (Waseem et al., 2011). There are several drought-related genes that have been characterized, such as element-binding DNA fragments during drought stress, aquaporin, late embryogenesis abundant proteins (LEA’s) and dehydrin family. According to the newly discovered biotechnological techniques, drought tolerance mechanisms can be enhanced through breeding, marker-assisted techniques and genetic engineering and gene manipulation for drought related gene(s) (Farooq et al., 2009). Many studies have been done on the effect of drought stress on barley growth, production and its adaptation against this stress (Cattivelli et al., 2011; Amini, 2011; Vaezi et al., 2010). Differential display technique (DD-PCR) is a powerful technique for studying the co-current expression of upand down regulated genes and subsequently isolating those genes. The differential display technique was described for the first time by Liang and Pardee (1992). The differential display technique has been used to study the gene expression in barley, where differentially expressed genes have been isolated from shoots of barley seedlings treated with cold, drought and ABA (Malatrasi et al., 2006). Also, barley plants were subjected to drought for four days to compare the palea, lemma and awn transcriptoms (Abebe et al., 2010). El-Shehawi et al. (2011) have used the same technique in wheat to study and isolate cDNAs to represent tissue specific genes. They have isolated, cloned and sequenced many tissue specific cDNAs fragments. Also, Eissa et al. (2007) have isolated, characterized, cloned and sequenced some ESTs from wild barley (H. spontaneum L.) which was subjected to 250 mM NaCl using DD technique. On the other hand, DD-PCR technique has been used in drought stress studies on different plants such as sugarcane culms (Iskandar et al., 2011); the effect of ABA on wild type Vicia villosa (Abou Ali et al., 2010) The aim of the current study was to investigate the effect of drought stress on wild barley (H. spontaneum L.), and to isolate and identify some drought related gene fragments and candidates from barley treated shoots (under drought stress). MATERIALS AND METHODS Plant materials The wild barley (H. spontaneum L.) seeds were washed for 1 min with 70% ethanol by shaking and then removed, followed by soaking in 20% sodium hypochlorite (commercial Clorox) supplemented with few drops of Tween 20 for 10 min. The seeds were washed several times using sterilized distilled water and then germinated on MS medium (Duchefa Biochemie, M0222.0050) for 8 days. For treatment, seedlings were dehydrated for 0, 3 and 10 h on 3 mm Whatman filter paper at room temperature according to 796 Afr. J. Biotechnol. Gao et al. (2008). The control seedlings were left in the MS media. After that, the treated and control seedlings were harvested, and quick frozen in liquid nitrogen, then stored at -80°C until RNA extraction. Isolation of RNA and differential display-polymerase chain reaction (DD-PCR) The TriPure Isolation Reagent (Cat. No. 11 667 157 001, RocheGermany) was used for total RNA isolation from the shoots of drought treated wild barley (H. spontaneum L.) plants (3 and 10 h) and shoots of control barley plants; about 200 mg tissues were used in each RNA extraction. The DD-PCR reactions were described in RNAmap kit (GenHunter Corporation, USA). Each cDNA reaction contained 2 μg total RNA, 2 μM anchor primer (T11C or T11G), 1.0 μl of dNTPs (10 mM), and 1.0 μl MMLV reverse transcriptase (200 U/μl). The reverse transcription (RT) reactions were performed for 50 min at 42°C followed by incubation for 15 min at 70°C. The list of primers sequences is shown in Table 1. PCR amplification of cDNA One micro lilter of each cDNA reaction was used for PCR amplification in the presence of 1.0 μl of dNTPs (25 μM), 1.0 μl anchored primer (2 μM), the same as in the RT reaction, 1.0 μl arbitrary primer (2 μM namely AP1, AP2, AP3 or AP5), 1 μl MgCl2 (25 mM) and 0.3 μl Taq DNA polymerase (5 U/ μl) (Fermantas, USA). The PCR program was: 4 min at 94°C (1 cycle); 1 min at 94°C, 2 min at 42°C, 1 min at 72°C (40 cycles); 10 min at 72°C (1 cycle). The products of PCR were loaded on a 6% acrylamide gel after denaturation of PCR products at 90°C for 5 min. The silver staining system (Promega, USA) has been used for gels visualization. Isolation of DD fragments and cloning The differentially display bands were cut from the gel and extracted according to Abou Ali et al. (2010). The nomenclature of the isolated fragment was depending on the primers combination that were used in the PCR reaction. For example, the primers combination between anchor primer G and arbitrary primer 3 showed 6 differentially display fragments and the fragment number 1 was named G3-1. This system of nomenclature was followed in all isolated fragments. Then the bands were re-amplified using the same PCR reactions conditions as mentioned before. The pGEM-T easy system (Promega, USA) was used for cloning. Callard et al. (1996) method was used for the plasmid isolation, the modified boiling method. For right colonies screening, EcoR1 digestions were used (Sambrook et al., 1989). Sequencing of the cDNA insert Sanger et al. (1977) method was used for sequencing. The basic local alignment search tool (BLAST) in the GeneBank databases was used for comparing nucleotide sequence or the deduced amino acid sequence of each sequenced clones (http://www.ncbi. nlm.nih.gov) according to Altschul et al. (1997). The conserved rejoin alignments were done according to Marchler-Baue et al. (2013). RESULTS AND DISCUSSION Wild barley (H. spontaneum L) seedlings were subjected to drought stress treatment and subsequently differential mRNA display technique was used to isolate genes and fragments that might be related to drought stress treatment from treated seedlings. The PCR products of different primer pair combinations were loaded on sequencing gels and the cDNA fragments were visualized by silver staining (Figures 1 and 2). One hundred and seven fragments were found to be differentially displayed due to drought treatment of the barley. Expression patterns of DD fragments The differentially displayed fragments were isolated and classified into four categories according to their patterns of expression: category i) included 37 DD- fragments which were observed to be up-regulated in seedling shoots in response to drought treatment across the time; category ii) included 34 DD- fragments which were up-regulated after 3 h and then down-regulated in shoots after 10 h of drought treatment; category iii) included 15 DD- fragments which were down regulated in shoots of treated seedlings across time, whereas, category iv) included 21 DD- fragments which down-regulated after 3 h and then up-regulated in shoots after 10 h of drought treatment (Table 2). Thirty (30) differentially display fragments were detected in the primers combination between anchor primer G and arbitrary primer 4 while, the primers combination between anchor primer G and arbitrary primer 5 gave 10 differentially display fragments. Seven differentially display fragments were observed in the primers combination between anchor primer C and arbitrary primer 1 while, the primers combination between anchor primer C and arbitrary primer 2 gave 40 differentially display fragments. Finally, the primers combination between anchor primer C and arbitrary primer 3 gave 14 differentially display fragments. Cloning and sequencing The DD fragments were eluted, and cloned in pGEM-T easy vector. The cloning was confirmed using EcoR1 Digestion (Figure 3A and B). Twenty five (11, 4, 10) cloned fragments have been sequenced. Figure 4 shows the results of the sequencing. Sequence alignment using Genebank databases The resulted sequences were subjected to alignment analysis using GeneBank databases and the analysis results revealed significant similarities between the sequences of the isolated fragments and sequences of different genes recorded in the GeneBank databases. Table 3 summarizes the sequence alignment analysis Radwan et al. Figure 1. Polyacrylamide gels of DD cDNAs from untreated (C) and drought treated wild barley (Hordeum sponteneum L.) shoots (3 and 10 h) using different primer combinations of anchored primer T 11C, with arbitrary primer 1, 2 and 3 (AP1, AP2 and AP3). Arrows indicate a number of differentially expressed bands on a duplicate basis. The long arrow shows the direction of band selection (from the top to the bottom of the gel). 797 798 Afr. J. Biotechnol. Figure 2. Polyacrylamide gels of DD cDNAs from untreated (C) and drought treated wild barley (Hordeum sponteneum L.) shoots (3 and 10 h) using different primer combinations of anchored primer T11G, with arbitrary primer 3, 4 and 5 (AP3, AP4 and AP5). Arrows indicate a number of differentially expressed bands on a duplicate basis. The long arrow shows the direction of band selection (from the top to the bottom of the gel). Radwan et al. 799 Table 1. The primers sequences. Primer name a- Anchored primers T11C T11G b- Arbitrary primers AP1 AP2 AP3 AP5 Primer sequence 5'- TTT TTT TTT TTC- 3' 5'- TTT TTT TTT TTG -3' 5'- AAG CTT GAT TGC C -3' 5'- AAG CTT CGA CTG T -3' 5'- AAG CTT TGG TCA G -3' 5'- AAG CTT AGT AGG C -3' Table 2. Expression pattern for barley isolated DD-fragments. Category Clone name Expression profile 3h 3h 10 h 10 h Regulation type C* C Category I G4-1, G4-5, G4-12, G4-18, G4-21, G4-27, G5-1, G52, G5-4, G5-7, G5-8, G5-9, C1-6, C1-7, C2-3, C2-11, C2-12, C2-15, C2-16, C2-18, C2-23, C2-24, C2-27, C2-28, C2-29, C2-30, C2-33, C2-34, C2-35, C2-36, C2-37, C2-38, C3-1, C3-2, C3-5, C3-10, G5-5 - - - - + + Up regulation Category II G4-3, G4-4, G4-7, G4-8, G4-9, G4-14, G4-26, G4-30, G4-31, G3-2, G3-3, G3-5, G3-6, C1-5, C2-4, C2-5, C2-6, C2-7, C2-10, C2-17, C2-19, C2-20, C2-21, C222, C2-25, C2-26, C2-39, C2-40, C3-3, C3-6, C3-7, C3-8, C3-12, C3-14 - - + + - - Up-down regulation Category III G4-15, G4-17, G4-20, G4-24, G4-32, G5-3, G5-6, G5-10, G3-1, G3-4, C1-4, C2-1, C2-2, C2-13, C214, + + - - - - Down regulation Category IV G4-2, G4-6, G4-10, G4-13, G4-16, G4-19, G4-22, G4-25, G4-28, G4-29, C1-1, C1-2, C1-3, C2-8, C2-9, C2-31, C2-32, C3-4, C3-9, C3-11, + + - - + + Down-up regulation *C, Control; 3 and 10 h drought treatment for 3 and 10 h, respectively. Figure 3. The screening of some clones using EcoR1 enzyme digestion. A) Lane 1, 1 Kb Marker (Fermantas); lane 2, undigested pGEM-T easy vector; lane 3, digested pGEM-T easy vector using EcoR1 enzyme; lane 4, digestion of C1-1; lane 5, digestion of C1-2; Lane 6, digestion of C1-3; lane 7, digestion of C1-4; lane 7, digestion of C1-4; lane 8, digestion of C1-5; lane 9, digestion of C1-6; lane 10, digestion of C1-7; lane 11, digestion of C1-8; lane 12, digestion of C1-9. B) lane 1, 50 bp (Fermantas); lane 2, undigested C3-1 fragment; lane 3, digested C3-1 fragment using EcoR1 enzyme; lane 4, undigested C3-2 fragment; lane 5, digested C3-2 fragment; lane 6, undigested C3-3 fragment; lane 7, digested C3-3 fragment; lane 8, undigested C3-4 fragment; lane 9, digested C3-4 fragment; lane 10, 1kb DNA marker (Fermantas). 800 Afr. J. Biotechnol. C1-1 (492 bp) TAGGTTTTCTATGGCATGGCTAATTCTTGCTCTAAAATTGCCATCATGCTAATTTTGTCAACCTGCTAACAGCA TGTTCTATTCTGCAAAAATCATAGTAATTAATTTATACATCATATGGAGTTGTGTCCATGTAGTAAGTTGGGG TATGCCATGTCTACTACATGCCCATGTATTTTTCATAACCTAAAATCTTAAAAATGCACGCGCTCGATTTGGG GCAATCAAGCTTAGTTAAGCTTGATTGCCATGTAGGTTTTCTATGGCATGGCTAATTCTTGCTCTAAAATTGC CATCATGCTAAATTTGTCAACCTGCTAACAGCATGTTCTATTCTGCAAAAATCATAGTAATTAATTTATACATC ATATGGAGTTGTGTCCATGTAGTAAGTTGGGGTATGCCATGTCTACTACATGCCCATGTATTTTTCATAACCT AAAATCTTAAAAATGCACGCGCTCGATTTGGGGCAATCAAGCTTAA C1-2 (636 bp) AATTCGATTAAGCTTGATTGCCAACCACTTATCTGAGGAATTAATGCCTCTCACATTCCAGTTTAAGATATTC CAAGTTGCATTGTTATTCATTAATAATCAGTTTGGTGATACTGAAGTCAGCAGAGCCCACCCCCTGATGACA ATCCCAGGCCATAAATTTTTTTGTTTCCACAAAAAGTACAGAGCATTGTAAATATGTTGGGACATTCCAGCA GTGGACATAGTAGGTGAGGAGGTGAGCCAAAGCATCCAAAGTCGATTGCCCACAGCTTCCAAGGCAACAG ATAGGACAGAAGTCTCAGCCATAAGTGGATACCAGAGTTGACATACCAGGAAGCTTGATTGCCATGCAACG AATGCACTAAGAGCTATAAGTGTATGAAAGCTCAATATGAAAACTCAGTGGCTGTGCATCTAATCTATAATG AAAAATTCCCACTAGTATATGAAAGTGACAACATAGGAGACTCTCCATATGAAGAACATAGTGGTACTTTGA AGCACTAGTGTCTAGCATGCCCCTTTTTTCTTTTTCTATGTTTTCTTTTTTTCCTTTTTTCTCTCTCCCATTTTCCG GAGTCCCACCCTGACATGTGGGGCAATCAAGCTTAATCACTAGTGAATTCGCGGCCG C1-3 (460 bp) AATTCCATTAACCTGGATGGCATCCACTGGACTGTGTTTGAATTATTTTGCTTTACCCGTGGGCACACATTTG TCTGCAATTCTCTGTATGTGCTTACTTCAGGCTTTCTCACAACTCATCCCGACATGAGCCTCATATATACGTGG GGGCATCAGGCTTCTGAGGCCGAGGATGCTTAAACACATACCTGCAACAATAGTATCATGTCGCCGCATTA GTTTTATGTTAATTTCGTGGGTTTTACTTAGATTTCTTGCTCTCAAGAAACTAAAAGTAGACCTTTCACTAGTT GGTGGATCCCAGTGAACACCGTCGTATGGAGCTCCAAATTTAGAGGCATCAGCAATTGCATAACGAATCCA TGCAGGAATCCGATCAACCCATACTCCATCTTCATGGTGAAATCGAAATTTAACCCTTGGAATTATGGGGGA TGGCAGGTTTCCCGTTGACTTGGG C1-4 (504 bp) TAAGCTTGATTGCCTAAAACGGAAGACTCAAGATATGGGTGATTTAATAGATGTTCTGACGAGGTATGTTG AGTTAGACGGCATAAAGGTTCCTGGCTCAGACACGGTTAAGGTAGCAAGAACAATCAACAAGGTGGAAAC CATGAAGGTAAAAATAACAAACAGAGCAGCCTTAGGGAGAGTTATAATTTGTGGCTAATACGAATACTAGG TTCAAGAACCAGCGCTGCTCTAGAGGAGCTTACAATGGTAATAAGTCGCACAATTATGAGGAAGCACTCAA GGTGCCTTGCCGAAAGCATAGTACCTAAAACAATTCATCTACTCACTCATGGGAGAAGTGTTATATTATGCA CGAGTTAATAGTGGAGGATATACGAGTCAGTATGGTTAAACTGATTCACAAGGCGGCTCGTGTGGCGGATT CTCGGGATCAATTTCCAATGAACCAGACGGCTAGTGATCGGATTTTCAGCACCAATGAAACACTCGCAATGG GAAGC C1-5 (370 bp) GCATGCTCCGGCCGCCATGGCGGCCGCGGGAATTCGATT AAGCTTGATTGCCGAAGGAATCTACAAATATTGTGGAGGAATCCCTTATAGAATGGGAAGTGACTACATTA AAAAGGGATATAGCCCGAAATAAAAAGATTAGTGCGCTTCGCCTTGAATAACATGATAAGGGGCTAGTTCC TGATTATAATGCAATAAGAGATAGTTTGCAAGAAGATGAATCTTTGCCAATTGATAGAATTGGCGAGCAAA ATATGGTTCTACAATAATGCATATGCCTTCACCTAGTACAGCATCATACTGTACACCCCTTACACAATTGCAA Figure 4. Results of clones sequencing. Radwan et al. C1-7 7 (511 bp) GATT GATTGCCCTTCGGGTCCAAGTGAAATTTTACCTCAGCAGAACTTAGTTCCTGTAAATGATCTTGACAG CTTAGCCCTGAAAATGAATGACGTCATGCAAGACGCCAGCAAATACTACGTTGCCTTTGATGAAAAG TTTTTACCTCATAATATGGCAGCGCAATATTTAGACTACTTTAATATTCAGATCGATAATCAAAAATAA TCCACTATATTTTTTGTATTTTGCCTTCGGCAATCAAGCTTAAGCTTGATTGCCCTTCGGGTCCAAGT GAAATTTTACCACAGCAAAATTTAGTTCCTGTAAATGATCTTGACAGCTTAGCCCTGAAAATGAGTGA CGTCATGCAAGACGCCAGCAAATACTACGTTACCTTTGATGAAAAGTTTTTACCTCATAATATCGCAG CGCAATATTTAGACTACTTTAATATTCAGATCGATAATCAAAAATAATCCACTATATTTTTTGTATTTTG CCTTCGGCAATCAAGCTTAAATC C2-2 9 (621 bp) AAGCTTCGACTGTCCACTCGAAAGTATCTAATTTCTTCATGAGTCGGTACAGAGGAAGTGCTTTCTC GCCGAGTCGACTGATGAACCTGCTGAAAGCCTCTAGGCAACCTGTGAGACGATGAACATCGTGGAT TCTGACCGGCCTCTCCATCGGACGATGGTCCCGATCTTTTCGGGGTTGACATCGATCCCTCGTTCAT AAACGAAGAAACCGAGTAACTTCCCGCTGGGAACACCGAATGAACATTTGGTGGTGTTAAGCTTGAT ATCGTCCCTATGAAGGTTGGCAAACTTTTCTGCCAAGTCAGTCAGCAGGTCGGAACCTTTGCGTGAC TTGACTACGATATCATCCATATACGCCTCCACATTCCGGCCGATCTGGTCGAGGAGACATTTTTGGA TCATGCGCATAAAGGTAGCTCCTGCATTCTTCATACCGAATGGCATAGTGATGTAGCAGAAGCACCC GAATGGGGTGATGAAGGCTGTTTTTAATTCATCGGGGCCATACAGACGGATCTGATGATAGCCCGA ATAGGCATCTAGAAATGACAGACGCTCGCAACCCACAGTCGAAGCTTAATCACTAGTGAATTCGCGG CCGCCTGCAGGTCGACCAT C2-3 (637 bp) GACGAGTGCATGCTCGGCGCATGCGGCGCGGGATTCGATTAGCTTTCGACTGTTTTTTATAGATTCC AGGATCAGCCAATAGTATCAGCCAGCTGGCGTTCTGTCAAATTTGGCGAACTGATGCTCACATAAGT CAGTAACTTTTTAGCTATTTCTTTTAAGTCTGTAGCCGTCATTTTATTACTACGCGTAAAGGAAACAAC CTGCTTTAACGTATTTTCTACCAAAGGTTTTCCACTAGCATCATAAATTTCCCCACGAGCAGAACTGG TTGTGACCTTGGTCTGACTAGCTGAGGCTAGCTTTTTTTCGTAAAAATCCTTGTTCAAAACCTGCATA TACAACAAACGACCAATAATGGTCATAAAGAGCAAAATGACGATTGAAAACAATAAATTAAGCCGAAT CGGAATCGAATGGCTGTTAAATTTTCTCATACAAATCAGTCTCATTTCTAATTAAAATCTTACTCTTAA TTGTACCACAATTTGAGCAGAAAATTATGGAAAAGTAAGAAGCTTTTTTCGTTTTTACAGTAAGATAC GTTTTTATTTATTCATCCCTATATTATATGTTATAATGAATGTAAAAGTTCAATAATCTAGTCTTTTTCC AACACGACTCACAGTCGAAGCTT C2-4 (411 bp) GACGAGTCGCTGCTCCGGCGCCATGGCGGCCGCGGGATTCGATTAGCTTCGACTGTAGCAGATAA AGACTTTTTAAAAAGGAAAGAAGAAAATGACTAAACGCGCACTAATTAGTGTTTCAGACAAAGCGGG CATTGTTGAATTTGCCCAAGACTCAAAAAACTCGGTTGGGACATCATCTCGACAGGTGGGACTAAAG TTGCCCTTGACAATGCTGGGGTAGATACCATTGCTATCGACGATGTGACTGGTTTCCCAGAAATGAT GGATCTCGTGTGAAGACCCTACACCCGAAGATCTACTGTGGCCTTCCTAATTTTTGTCGTATTTTACT CCTACTCTTGCCACTCCGAATATTAAATCAAATTTAAACCTATAAAAGACTATCCACCCACATCTTCCA CACATAA C2-5 (684bp) AAGCTTCGACTGTATATTGATGTTACTTAGGAGGTTATAGTATATGAGTACGCTCTCCAACTGTATCT CATTTTTGGAAACATTCTCATCATCTCCTGCTCCAACGCACATTTTAGAAGTAAGAATTCCCCTCGTC TCGCACGGACATGGTTTTCTCATTCATACCGCCGCATGAATGTTCCTCACACGACAAACACACCAGA ACACTAGCACTCATGCCGAACTACTATGCCCCCCCAAGCAAGAAAGTGCTCCACATGAACCAACGC TATCGATACTTCTCTCTAATTTTGTCCTCCGCGCGCAGGTTAACTTTGATACCCGCTGTAGATGATGT CCCTTTTTCACCGGATCCTAGACATGCTGAAGGCGAAAGGACATTACTTTAATGCCTGTGTGTTGGC CGATACCATTGAGGATTTCTGACCACCTCCTTCAGATTTCGCCAGATAAATTGATCTGCGACGAAGC CTTCACCGTGTAATCCCGTAAGGCATCCTCGAATACTGATAGTGCATTAACTGTATTGTGCTTTTTGT TCTTTCTCACACATCTTCCTGCAAGCATCCAGCAAAAAGGATCTCAAAATCTGACCAACTTCTGAGAA TATCTGTTATTCCCTAACCCCAGAACACCGATCGATAAATCCCTTCTGAATAACCACAGTCTACAACT CCCTCGGAG Figure 4. Contd. 801 802 Afr. J. Biotechnol. C2-6 (901bp) GCGATGCATCTAGATTAGCTTCGACTGTGGAGAAGTTGAAAATATTTCCTAAATAATTAAATTGAGTTAAGGACCTA TTGAGAAAAATTCTAAAGAAGTGTAGTTCGGAGTTCGTTATAAATTGATATTTAAGAGTGTTGCGACGAGTACCCGA TGCTTGATTGGGTTGATTGATCTGTGTAAATGGTGAATTAATGATGTTGCATTATGATATTGTTGTATGATGATGATA ATTATTGTTGTTTTTATTAACAGTCGAAGCTTAATCGGATCCCGGGCCCGTCGACTGCAGAGGCCTGCATGCAAGCT TTCCCTATAGTGAGTCGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCA CAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATT AATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCG CGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAAC ATGTGAGCAAAAGGCCAGCAAAAGGTCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCC CCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG CGTTTCCCCCTGGAAGCTCCCTTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCG C2-8 ( 862 bp) AATTCGATTAAGCTTCGACTGTGCATAGTAATCCGACTAAGTTGAGACTTGGTATTGCGCCAAAGCACTCGGCTGAT GACCATGAAGCAAGCACTAGCGAGGCAAAGCCACGAGACCCTAAATACACTCGGCCATGGTGGTGTCCTCCAGGG CTAACAAAGACACAAAAGAGGAAATTACAAAGGTTGAGGAATCAAGAGATGGCAGAACGGGAGGCCGAGAAACA AAGGGATAAATTATTCAATGACACTCGGCCCATGATACCTACAAAACAAGTGTGGAAGCCTAAACAAGTACAAAAT GCAGCGGCTTCTACATCTATTACAGCAACACTTGCATCATCAAAATAGGATGATGTAGTTATGACACTTTTTCCATCG CCTATTGCTTCCTATTCACTTGAACATATTTCAGATTCCATGGACACACCCAAGGAGGAAGATGATATTTTATATTAT GAGCTTACACCAGTTCATGAAGGTATGGATATCAATATGGTGTATTATTTACCCGCTGAATTTCTTGCTCTAGATGAA GAAGGGGAGGTGGCTCAGCTAGATTTTGGCCCTAAAAATGCAATATTCGAGAAGCCAGAAGAACTGGTGACACAC TTGAAACCGTTGTATCTAAGAGGTCACATTAATGGATCACCACTTACTTGGATGCTTGTTGACGGTGGTGTTGTGGT GAATCTTATGCCCTATTCGGTCTTCATGAAGTGGTCTTGCCCGACAATAAATTGATAAAGATCAATATGGTACTTAAT GGATTTGAAGGCCATGAGAAAATTGCAACCAAAGGTGTTATGTATGTGGAACTTTACAGTCGAAGCTTATCTCAGT GATTCGCGGCCGCTGCAGCC C2-9 (659 bp) AAGCTCGACTGTCAACGTTGCTGACTATTGATTGTAGCCGCGAGTCCAGAAAAGGGGTGCTTTCTGTTCCGGCCATT CTTCTCATCTCCAGCGCTAACCCTGATTATGTTGGATGGGCGATGTCGACACTTGCTAGGACCTGGGTGACTCATTCC TATCGACGCATGATGGTAACATTCTCGCCAAATAAATTAAACCTCTAGCGCTCATTCTCAAATTTGATGCCCGTTGAT GGAGGAAAGTGAAGCCCTTGAACCAATGCACTCAAAATTCCATATTCGGATGGTTGTCCGCATCGTTTTCCACTAGG ATACTCGACTGCTTATCATGTCCGATGATCATCAGAACTTGCCAGATACAGCAGGCCCATGGATACAAGGCTTAATC ACTTTAAGTTCTCAGTTTAATCTTCTTGGGATCTTTCACCTCCCTCAGACTCCTAAATAATCTATAAGCTATTGGCTTTC AATTGAGTGAGTTTTAGGATGAATATTCTGATGATCTGACTCAATTCTTTTCCGGCATCAAGCAAATCTGATGGTTCT CATGCATCTAGAACTTCCTCCTCTCTAAAGATGGCCATCTTTGTAACAATACCCTAGACCTCCGTAACCTCAGAAATCT GATTGATTATTCATTTTCTAAATCAAAAGCTTTAC Figure 4. Contd. results. Starch metabolism The first fragment to be discussed is C1-3 (460 bp) which has down and up regulation pattern. The expression pattern decreased after 3 h drought treatment then increased after 10 h treatment. Blastn sequence analysis revealed significant similarities between C1-3 isolated fragment and starch branching enzyme I (sbeI) Genebank Accession No. AY304541 isolated from H. Radwan et al. 803 C3-1 (720 bp) GATGTCAGCGACCTCGAATCAGCTTCAACTAGGTACTCTTTCAAGTAGTACTATTTAGAATCCAAAGAATGACAATCAATATT TTTCCATCACCACTCAAAATAGTAAGGACACCATTGATAATCTCATGGTTGTAGTTGATCAAGCTAGGAATGATGTCATTGAT ATAAATAAGGCACCTGAAGAGGAATCTAAAAAGTTGGTGACTAGTGGGGAGTCATTACTACAATCGACAGGTGTTTATAAA ATTGTTGAGAAGGATAAAAAGAAGAGAAAATAGTTGAGCCCGTGTTAAAGACCATTCCATAACCTACCCCTCATTTTCCTTAA AGATTGAAGAAGAAATAAGACAATAGGAAGTATCAGAAGTTTTTGTGGATATTGAAAAAAATTCTGTTAATATTTCTTTTATC AAAACATTTATGCAGATTCCTAGATACGCTATGTTCATGAAGGATTTTGTTACTAGAAAGCGGATGGTGAGTTCTTAGATAAC TAATAATGTTCATCATTGTAGTGACATCATATTTTGATCATTGGTTGAGAAGAAGGAGGAATCTAGAGCATTTACTATTCTTT GTACTATCGGGTCCTTCCGCTTCTCTCGAGCTTTATGTAAATTGGGATAAGCTATAAATTTGATGTTGTTGGTAGTGTACAAG TAGCTGGGGTTGGTGGCACCCAAACCTACCTCTATGAGGTTATTGATGGCTGACCAAA C3- 2 (813 bp) AAGATTGACAGGAAAGCAATGTCGGATCAACAAAAGCGTGACTTCAAAAATCACCACAAGGCCAGAACCATTCTTCTCAGC GCCATCTCTTACGCTGAATACGAAAAGATATCTAACAGAGACACATCAAAGAACATGTTTGACTCACTCAGAATGACGCATG AAGGAAACATTCAGGTCAAAGAAACTAAAGCTCTTGCGCTCATTCAGAAGTATGAGGCATTCAAAATGGAAGAAAGTGAAT CCATTGAAACAATGTTCTCAAGATTCCAAATTCTGGTGGCTGGTCTCAAGGTTCTGGACAAAGGATACTCTACTGCTGATCAT GTCAAGAAGATCATCAGAATCTTGCCAAAACAGTGGAGGCCAATGGTTACAGCGCTGAAGCTAGCTAAAGATCTCAACAAA ATTTCTCTGGAGGAACTTATCAGCTCCCTCAGAAGTCACGAGATAGAGCTAGAAGCTGATGAACCTCAAAAGCAAGGTAAG CCTTTAGCATTAAAATATAACAGAAGATCTGACTCTAAAGTTTTGCAGGCAGTTAAAGAAACATCTGATGGGTCCTCATCAGA AGAAGATGAACTTTCCCTCCTCTCCAGAAGAGTGAACCAACTATGGAAGAAGAGGCAAAGGAAGTTCAGGAATCCCAGAAG ATCTGATCAGAATGAGTCCTCTTCCAGATACAGAAAGCCAGACTCCTCCTCTGGATACAGAAGATCTGAAGGCTCTTCAGGA AGCAGAAAGTCAAACACCAAAGACATCACGTGCTATGAATGCAACGAGCAAGGACATTATAAGAGTGACTGACCAAAG C3- 3 (496 bp) GCCGCACCATCGTGTCACTGACTCACAGGTACCGCTAGAGCTTTTGGGATGTATTCAAGGTCATGCAAGGCGACCTTGTGAT CACCTGGGCTGATTTCAAGGAAGGATTCCGCACGTCCCACATTCAATCAAGAGTCGTGGCTATCAAGAAGTGGGAATTTTTG AGAGTTGAAGCAAGGAAGTGTATATGTAAACGAGTACATGCAAAAGTTCAACCTCCTGTTGAGATATTCCCCTAAAGATGAC ACCACTAAGGCTGCCAATATAGAACTCTTCATGGAAGGACTCTCGCAGTCCCTAGAGTATCAACTCGTTGTTTGCGATTTCCA CACCTTCTTCCACCTGGTGAACCAGTCCCTTATGTCGAACACAAGCATCGTGCCATGGAAGATACTCGCAAGAGCAAGATGA TCAGCAAGGCTAGTTCCAGCAACCAAAAGCCTTGCCCCTGGCAGCTATCTCCCGTCAAGCCAACCTATCAGCCTGACCAAAG CTT C3- 8 (264 bp) AAGCTTTGGTCAGGTCCATGATTTCCTAGCAATCCATGGCACCATTGTTTAGTGAAATTCTGGCTGTATATACTCAATGTCAC GTTCAATGTTATGACACCGTATCTGACTTTCTATAAGACAGTAAATATAAAAACAGTACAGAACACAGTCAATTGTTTACCCA GCTCAGTGTACAACATCACCTACTCTGGGGGCTACCAAGCCAGGGAGGAAATCCACTATAAGAGACGTTATTTCAGGAATAA GTCAAACAGTTGATCT Figure 4. Contd. vulgare (Table 3). Also, blastx analysis of the same fragment using GeneBank databases revealed high similarities between it and the starch branching gene sebl isolated from H. vulgare Genebank Accession No. AAP72268. The results of sequence analysis using blastx and conserved blast alignments (Marchler-Baue et al., 2013) analysis tools revealed that C1-3 fragment has conserved regions with alpha amylase catalytic domain found in bacterial and eukaryotic branching enzymes (BEs) and 1,4 alpha glucan branching enzyme. This gene is responsible for introducing alpha-1,6 branch points to form amylopectin. Starch branching enzymes (SBEs) have been found in different plant developing stages in the barley storage tissues (Sun et al., 1998). During different stages of development, the plants need starch branching activities. SBEs found in many isoforms, they can be classified into two major groups based on catalytic and structural properties, the first group is SBE family II or A and the other group, is SBE family I or B. SBEI was up-regulated under salt treatment in rice while SBEIII was downregulated on the other hand, the contents of glucose and fructose increased (Theerawita et al., 2012). When barley plant was subjected to drought, many genes involved in carbohydrates metabolism were down regulated (Abebe et al., 2010). Normally, starch synthesis is inhibited under water deficit condition (Mahajan and Tuteja, 2005) but alpha- amylase is found to be up regulated in treated Vitis vinifera plants under cold stress (Xin et al., 2013). The current results show that the SBEI 804 Afr. J. Biotechnol. Table 3. Genebank Homology results for some differential display fragments. Fragment name Fragment length (bp) Clone 1 C1-1 486 C1-2 613 C1-3 C1-4 Blast N Homology results Accession number No significant similarity Blast X E-value, Identity Homology results Accession number E-value, Identity - No significant similarity - Triticum aestivum gene for TaAP2-B, complete cds Access. no AB749309 8e-66 -202/237 (85%) No significant similarity - 460 Hordeum vulgare starch branching enzyme I (sbeI) mRNA, partial cds; nuclear gene for plastid product Access. no AY304541 2e-79 -177/181(98%) starch branching enzyme I [Hordeum vulgare] Access. no AAP72268 It showed conserved region 504 No significant similarity C1-5 370 Triticum aestivum 3B chromosome, clone BAC TA3B63N2 Access. no AM932689 C1-6 570 No significant similarity C1-7 511 C2-1 Short sequence C2-2 C2-3 621 637 2e-27 -69/143(48%) - No significant similarity - 5e-78 -230/269 (86%) No significant similarity - - Glycosyl transferase family 1 (Enhyrobacter aerosaccus) Access. no WP_007116863 -2e-13 - 34/59 (58%) No significant similarity - Glycosyl transferase family 1 (Enhyrobacter aerosaccus) Access. no WP_007116863 It showed conserved region 6e-14 -34/62 (55%) - No significant similarity - - No Significant similarity - Hordeum vulgare vrs1 locus, complete sequence; and Hox1 gene, complete cds Access. no EF067844 - Hordeum vulgare DNA, downstream region of HvNAS1 gene Access. no AB023436 - No significant similarity - 0.0 -539/576(94%) -0.0 -532/576(92%) - Retrotransposon protein, putative, Ty3-gypsy subclass [Oryza sativa Japonica Group] Access. no ABA93610 It showed conserved region - No significant similarity - 4e-80 -120/192(63%) - Radwan et al. 805 Table 3. Contd. Fragment name Fragment length (bp) C2-4 411 Blast N Homology results Accession number Streptococcus parasanguinis ATCC 15912, complete genome CP002843.1 Blast X E-value and identity 2e-96 -245/270 (91%) Homology results Accession number E-value and identity -IMP cyclohydrolase [Streptococcus infantis] Access. no WP_006154970 - IMP Cyclohydrolase/Phosphoribosylaminoimidazole carboxamide formyltransferase [Streptococcus sp. HSISS2] Access. no WP_021144787 It showed conserved region -1e-28 -57/57 (100%) 4e-28 56/57 (98%) C2-5 684 No significant similarity - No significant similarity C2-6 901 No significant similarity - Hypothetical protein, partial [SAR86 cluster bacterium SAR86C] Access. no WP_010157945 9e-45 -79/80 (99%) Retrotransposon protein, putative, unclassified [Oryza sativa Japonica Group] Access. no ABA96795 4e-40 -89/197 (45%) C2-8 862 C2-9 G5-5 G5-7 G5-8 G5-9 659 C3-1 No sequence No sequence No sequence 720 Hordeum vulgare subsp. vulgare Rpg4 gene, complete sequence; RGA1 (RGA1) gene, complete cds; Rpg5 gene, complete sequence; PP2C (PP2C) gene, complete cds; and ADF3 gene, complete sequence Access. no EU812563 No significant similarity No significant similarity Solanum lycopersicum strain Heinz 1706 chromosome 10 clone hba-26b13 map 10 Accession no AC244352 0.0 -696/819(85%) - - 1e-06 -170/253(67%) No significant similarity No significant similarity Hypothetical protein with similarity to putative retroelement [Oryza sativa Japonica Group] Accession no AC113339_5 - - 2e-15 -42/112 (38%) 806 Afr. J. Biotechnol. Table 3. Contd. Fragment name C3-2 C3-3 C3-8 Fragment length (bp) Blast N Homology results Accession number Blast X E-value and identity Homology results accession number E-value and identity 813bp Lotus japonicus genomic DNA, chromosome 1, clone: LjT26E16, TM0103, Access. no AP0096 -2e-62 -323/441(73%) -TNP1 [Medicago truncatula] 5e- Access. no XP_003590350 -Serine/threonine protein kinase SRPK1 [Medicago truncatula] Accession no XP_003629120. It showed conserved region -Integrase, catalytic region; Zinc finger, CCHCtype; Peptidase aspartic, catalytic [Medicago truncatula] Accession no ABD32582 496 bp -Triticum aestivum chromosome 3B-specific BAC library, contig ctg1030b Access. no FN564435 1e-63 -338/461(73%) retrotransposon protein, putative, Ty3-gypsy sub-class [Oryza sativa Japonica Group] Access. no AAX95143 3e-13 -29/71 (41%) 264 -Glycine max strain Williams 82 clone GM_WBb0083G02, complete sequence Access. no AC235334 -Glycine max NB-LRR type disease resistance protein Rps1-k-1 (Rps1-k-1) and NBLRR type disease resistance protein Rps1-k-2 (Rps1-k-2) genes, complete cds Access. no EU450800 hypothetical protein MTR_1g045380 [Medicago truncatula] Access. no XP_003590165 -1.3 18/25 (72%) expression was affected by drought. Glycosyl transferase gene family 1 (cell wall metabolism) The results of blast x analysis have revealed that the two fragments, C1-6 and C1-7 have significant similarities with glycosyl transferase gene family 1 isolated from Enhyrobacter aerosaccus Genebank 4e-20 101/125(81%) 2e-18 100/125(80%) Accession No. WP_007116863 with E-value 12e13 and 6e-14, respectively. The results of blastx and conserved blast alignments revealed that C16 and C1-7 fragments have conserved regions with glycosyl transferase GTF domain (MarchlerBaue et al., 2013). Their expression was found to be up regulated in the differential expression experiment. The glycosyl transferase enzymes (GTFs) (EC2.4) are enzymes that catalyze the glycosyl (sugar) residues transfer during biosyn- -1e-37 -71/134 (53%) -2e-35 -70/134 (52%) thesis and degradation of glycolipids, glycoproteins and polysaccharides to the acceptor which regulate the acceptors properties such as solubility, activity and transport within the cells. The glycosyltransferase have been classified into more than 90 gene families according to catalytic specificity, sequence similarities and consensus sequences. UDP glycosyltransferase gene was found to be up-regulated transcripts in cold treated V. vinifera plants (Xin et al., 2013). Radwan et al. Glycosyl transferase family 1 and 2 have been isolated from drought treated Gossypium herbaceum roots (Ranjan et al., 2012). Transposons elements The results of the differential display experiments revealed that the DD- fragment C2-2 (621 bp) showed down regulation after 3 and 10 h treatment. In blastx, the isolated fragment gave significant similarities with retrotransposon protein, putative, Ty3-gypsy subclass (Oryza sativa Japonica Group, Genebank Accession No. ABA93610.) It showed conserved region with RT_superfamily including putative active site, putative nucleic binding site, putative NTP binding site and RT_LTR retrotransposon protein (Marchler-Baue et al., 2013). On the other hand, the results of blastn analysis showed similarities between the isolated fragment and H. vulgare vrs1 locus, complete sequence and Hox1 gene. Retrotransposon elements were found to be down regulated in chickpea under drought stress (Deokr et al., 2011). The results of the differential display experiments revealed that the C3-3 fragment (496 bp) was up and down regulated under the treatment condition where, it has expression pattern up in 3 h and down in 10 h under drought treatment. The results of Blastx analysis revealed that the isolated fragment has significant similarities with retrotransposon protein, putative, Ty3-gypsy sub-class (O. sativa Japonica Group) but with different Genebank Accession number AAX95143, while, it gave similarities in blastn analysis with H. vulgar BAC 631P8 Genebank Accession No. DQ249273 DD- fragment C2-8 (862 bp) that has up and down regulation pattern and gave similarities with retrotansposon protein putative, unclassified (O. sativa Japonica Group, Genebank Accession No. ABA96795 in blastx analysis while, in blastn analysis, it has a significant analysis with H. vulgare subsp. vulgare Rpg4; RGA1 gene; Rpg5 gene; PP2C gene; and ADF3 gene, Genebank Accession No. EU812563. However, DD- fragment C3-1 (720 bp) that was up-regulated in the differential expression experiment showed significant similarities in blastx with hypothetical protein with similarity to putative retroelement (O. sativa Japonica Group) but with different Genebank Accession No.AAM08859 and AC113339. Using blastn analysis, DD- fragment C3-1 showed similarities with Solanum lycopersicum strain Heinz 1706 chromosome 10 clone hba-26b13 map 10, Genebank Accession No. AC244352 Grandbastien (1998) showed that the retrotransposons activation by external change and stresses is common in eukaryotes, including plants. He suggested that several well-characterized plant retrotransposons transcriptional activation seemed to be linked tightly to active molecular pathways by stress which is under the cis regulatory sequences activation. The retrotransposons could play a 807 role in their regulatory features modification. Different biotic and abiotic stresses activated most transposable elements in plant (Le et al., 2007) such as BARE-1 increased under drought in barley and then decreased (Kalendar et al., 2000), which showed the transposons activation played as stress adaptation. Wang et al. (2011) have isolated four retrotransponson elements from rice subjected to drought. Eissa el al. (2007 have isolated BARE-2 and partial BAGY-2 retrotransposons elements from wild barley (H. spontaneum L.) under salinity, it was down regulated. Tomita et al. (2011) have suggested that BARE-1 element in Hordeum was the active at the recent time while the transposable elements majority of high-copy seemed to be inactive which might be interesting to perceive the adaptive evolution processes of plant. Polok and Zielinski (2011) have confirmed the transposons role in speciation in barley and many mobile transposons in the past are became stable at present. IMP cyclohydrolase Nucleotide (synthesis of nitrogenous compounds) metabolism DD-fragment C2-4 (411 bp) showed up-regulation in 3 h treatment and then down regulation in 10 h. This fragment has similarities with IMP cyclohydrolase (Streptococcus infantis) Genebank Accession No. WP_006154970 IMP cyclohydrolase/ Phosphoribosylaminoimidazolecarboxamide formyltransferase (Streptococcus sp. HSISS2] Genebank Accession No. WP_021144787 while, blastn analysis revealed similarities with Streptococcus parasanguinis ATCC 15912, Genebank Accession No. CP002843. According to Marchler-Baue et al. (2013) analysis method, It has conserved regions for IMPCH[cd01421], Inosine monophosphate cyclohydrolase domain, PurH[COG0138], AICAR transformylase/IMP cyclohydrolase PurH (only IMP cyclohydrolase domain in Aful), purH [TIGR00355], phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase; PurH\ is bifunctional: IMP cyclohydrolase (EC 3.5.4.10) and purH[PRK00881], bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase. The enzyme aminoimidazole carboxamide ribonucleotide transformylase/inosine monophosphate cyclohydrolase (purHJ) (ATIC) encodes a bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway. The biosynthetic pathway of purine has been considered as an important target for antiviral, anticancer and antimicrobial drug development because of the purine nucleotides critical role in the synthesis of RNA and DNA (Zhang et al., 2008). Abou Ali et al. (2010) isolated 2 DD- fragments from shoots of V. villosa wild plant treated with abscisic acid 808 Afr. J. Biotechnol. which showed similarities with ATP binding/ kinase/ uracil phosphoribosyltransferase-uridine kinase (Arabidopsis thaliana) and IMP dehydrogenase/GMP reductase (Medicago truncatula), respectively. IMP dehydrogenase catalyzes the rate-limiting step in de novo biosynthesis of guanine nucleotides and has an essential role in providing necessary precursors for DNA and RNA synthesis. IMP cyclohydrolase/phosphoribosylaminoimidazolecarboxami de formyltransferase is one of the housekeeping enzymes involved in nucleotide metabolism. In the past, it was thought that the housekeeping genes are expressed in all cells at a consistent level. But, it is proved that the expression of these genes is very dynamic to meet the metabolic demands of plant cells. These changes can have an effect on plant development, so there is now a great concern about their expression. The housekeeping genes have important activities in survival of plant under stress (Moffatt and Ashihara, 2002). The identification mechanisms by which plant cells monitor and respond to their basic metabolic requirements rely on the integration of transcript, protein and metabolite profiles of different cell types (Fiehn et al., 2001). Unfortunately, the housekeeping genes expression levels complicate their analysis because small differences in activity (2 to 3 folds) may cause large metabolic impacts so they are difficult to be reproducibly detected. Fragments with chromosomes similarities The differentially display fragment C1-2 (613 bp), has down and up regulation expression pattern, showed similarities in blastn with Triticum aestivum gene for TaAP2-B, complete cds Genebank Accession No. AB749309. While C1-5 fragment (370 bp), has up and down regulation expression pattern, showed similarities with T. aestivum 3B chromosome, clone BAC TA3B63N2 Genebank Accession No. AM932689. Both fragments gave no significant similarities in blastx analysis. gave similarities between the C3-8 isolated fragment and Glycine max strain Williams 82 clone GM_WBb0083G02, complete sequence Genebank Accession No. AC235334 Glycine max NB-LRR type disease resistance protein Rps1-k-1 (Rps1-k-1) and NB-LRR type disease resistance protein Rps1-k-2 (Rps1-k-2) genes, complete cds Genebank Accession No. EU450800. Fragments C3-2 (813 bp) expression pattern was up regulated. It gave similarities with TNP1 (M. truncatula) Genebank Accession No. XP_003590350, hypothetical protein MTR_5g060670 (M. truncatula) Genebank Accession No. XP_003614875, Serine/threonine protein kinase SRPK1 (M. truncatula) Genebank Accession No. XP_003629120, integrase, catalytic region; Zinc finger, CCHC-type; Peptidase aspartic, catalytic (M. truncatula), Genebank Accession No. ABD32582. MTR_8g073400 included several domains, zf-CCHC; zinc knuckle, rve; Integrase core domain, gag_pre-integrs; GAG-pre-integrase domain, UBN2; gag-polypeptide of LTR copia-type, PKc_like; protein kinases, catalytic domain. All of these genes are shared together with UBN2 [pfam14223], gagpolypeptide of LTR copia-type domain. Three Serine/ threonine protein kinases were isolated from treated V. vinifera plants under cold stress and was found to be up regulated (Xin et al., 2013). These kinds of kinases regulate several biological processes in plant cells and were found to be localized in the cell wall and also, responded to the external environmental challenges (Morris and Walker, 2003). In Arabidopsis, SNF1-type serine/threonine protein kinase of wheat was found to enhance tolerance to multi- stress (Mao et al., 2010). According to Marchler-Baue et al. (2013), it showed a conserved domain with UBN2 [pfam14223], gagpolypeptide of LTR copia-type. This family is found in plants and fungi, and contains LTR-polyproteins. In blast N, it gave similarities with Lotus japonicus genomic DNA, chromosome 1; clone LjT26E16, TM0103, Genebank Accession No. AP009652. Fragments with no significant similarities Unknown proteins Fragment C2-6 (901 bp) showed up regulation in 3 h treatment and then down regulation in 10 h treatment in the differential display experiment. It was cloned and sequenced. In the blastx sequence analysis, it gives significant similarities with hypothetical protein, partial sequence (SAR86 cluster bacterium SAR86C, Genebank Accession No. WP_010157945 while it does not give any significant similarities in blastn. C3-8 (264 bp) differentially displayed fragment was up regulated after 3 h of drought treatment then down regulated after 10 h. The blastx analysis showed similarities with hypothetical protein MTR_1g045380 (Medicago truncatula, Genebank Accession No. XP_003590165 while, the blastn analysis Six DD fragments, C1-1 fragment (486 bp) with down and up regulation; C1-4 fragment (504 bp) with down regulation; C2-3 (637 bp) with up-regulation; C2-5 (684 bp) with up and down regulation; C2-9 fragment (659 bp) with down and up regulation and G5-5 with up regulation, gave no significant similarities neither in blast N nor blast X. Conclusion When wild barley plants were subjected to drought, they exhibit tolerance through some genes expression. Several drought–related stress fragments have been isolated and categorized into four categories according to Radwan et al. their expression: up; up and down: down and down and up regulation. These fragments were found to be involved in starch metabolism, cell wall metabolism, transposon element and purine metabolism. These genes especially starch metabolism genes help in the grain production. Also, there are some isolated fragments that showed similarities with drought-related stress genes; their function are unpredictable. To determine the individual regulated genes role in drought stress response, some biotechnological technique like RNAi could be used to silencing these genes and then evaluates the importance of each one of these gene using molecular and physiological techniques under drought stress. This study in the laboratory cannot give a full picture about understanding the crop response to drought and the drought stress transcriptome alone but with some field experiments combined with some physiological studies in the future will be needed in future studies to provide a clear picture in the molecular mechanisms which control the drought stress adaptation. Numbers of important genes were identified in this study, and it will be a good start for doing more biotechnological studies. This study will serve as source for discovery of new candidate genes with different gene expression and can be used in further work for manipulating drought tolerance crops. In the future, the transformation of economic crops with some of identified genes will increase stress tolerance to drought and also some other abiotic stresses. Conflict of interests The authors have not declared any conflict of interests. REFERENCES Abebe T, Melmaiee K, Berg V, Wise RP (2010). Drought response in the spikes of barley: gene expression in the lemma, palea, awn, and seed. Funct. Integ. Geno. 10(2):191-205. Abou Ali RMI, Shanab GML, Haider AS, Eissa HF, Salem AM (2010). Characterization and expression of abscisic acid inducible gene (s) in wild legumes. Egypt J. Genet. Cytol. 39(1):57-72. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res. 25:3389-3402. Amini R (2013). Drought stress tolerance of barley (Hordeum vulgare L.) affected by priming with PEG. IJFAS J. 2(20):803-808 Ashraf M (2010). Inducing drought tolerance in plants: Recent advances. Biotech. Adv. 28:169-183. Callard D, Lescure B, Mazzolini L (1996). A method or the elimination of false positives generated by mRNA differentially display technique. Biotech. 16(6):1096-1103. Cattivelli L, Ceccarelli S, Romagosa I, Stanca M (2011). Abiotic stresses in barley: problems and solutions. pp 282-306. In: Ullrich SE (ed) Barley: production, improvement, and uses, Wiley-Blackwell Eissa HF, Saleh OM, Dyer WE (2007). Genomic characterization of stress related genes from wild barley. Egypt J. Genet. Cytol. 36(1):123. El-Shehawi AM, Elseehy MM, Hedgcoth C (2011). Isolation and sequence analysis of wheat tissue-specific cdnas by differential display. Plant Mol. Biol. Rep. 29(1):135-148. 809 Farooq M, Wahid A, Kobayashi N, Fujita D, Basra SMA (2009). Plant Drought Stress: Effects, Mechanisms and Management. Agro. Sust. Dev. 29(1):185-212 Fastnaught CE (2001). Barley fibre. In: Cho, S., Dreher, M. (Eds.). Handbook of Dietary Fibre. Marcel Dekker, New York, pp. 519-542. Fiehn O, Kloska S, Altmann T (2001). Integrated studies on plant biology using multiparallel techniques. Curr. Opin. Biotech. 12:82-86. Gao J, Xiao Q, Yin L, He G (2008). Isolation of cDNAs clones for genes up-regulated in drought-treated Alternanthera philoxeroides root. Mol. Biol. Rep. 35:485-488. Grandbastien MA (1998). Activation of plant retrotransposons under stress conditions. Trends Plant Sci. 3(5):181-187. Iskandar HM, Casu RE, Fletcher AT, Schmidt S, Xu J, Maclean DJ, Manners JM, Bonnett GD (2011). Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms. BMC Plant Biol. 11:12. Kalendar R, Tanskanen J, Immonen S, Nevo E, Schulman A (2000). Genome evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in response to sharp microclimatic divergence. Proc. Natl. Acad. Sci. USA, 97:6603-6607. Le Q, Melayah D, Bonnivard E, Petit M, Grandbastien MA (2007). Distribution dynamics of the Tnt1 retrotransposon in tobacco. Mol. Genet. Genom. 278(6):639-651. Liang P, Pardee AB (1992). Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Sci. 257: 967-971. Mahajan S, Tuteja N (2005). Cold, salinity and drought stresses: an overview. Arch. Biochem. Biophys. 444:139-158. Malatrasi M, Corradi M, Svensson JT, Close TJ, Gulli M, Marmiroli N (2006). A branched-chain amino acid aminotransferase gene isolated fromHordeum vulgare is differentially regulated by drought stress. Theo. Appl. Genet. 113(6):965-976. Mao X, Zhang H, Tian S, Chang X, Jing R (2010). TaSnRK2.4, SNF1type serine/threonine protein kinase of wheat (Triticum aestivum L.), confers enhanced multistress tolerance in Arabidopsis. J. Exp. Bot. 61:683-696. Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY (2013). CDD: conserved domains and protein three-dimensional structure. Nucl. Acids Res. 41(D1):D384-352. Moffatt BA, Ashihara H (2002). Purine and Pyrimidine Nucleotide Synthesis and Metabolism. In The Arabidopsis Book, Somerville CR, Meyerowitz EM eds (Rockville, MD: American Society of Plant Biologists). Morris ER, Walker JC (2003). Receptor-like protein kinases: the keys to response. Curr. Opin. Plant Biol. 6:339-342. Polok K, Zielinski R (2011). Mutagenic treatment induces high transposon variation in barley (Hordeum vulgare L.). Acta. Agric. Slov. 97(3):179-188. Ranjan A, Pandey N, Lakhwani D, Kumar DN, Pathre U, Sawant S (2012). Comparative transcriptomic analysis of roots of contrasting Gossypium herbaceum genotypes revealing adaptation to drought. BMC Genom. 13:680. Sambrook J, Fritsch EF, Maniatis T (1989). Molecular cloning: A laboratory manual, 2 nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Sanger F, Nicklen S, Coulson AR (1977). Biochemistry DNA sequencing with chain-terminatinginhibitors (DNA polymerase/ nucleotide sequences/ bacteriophage 4X174). Proc. Nati. Acad. Sci. USA. 74:5463-5467. Smith A (2004). Oxford Encyclopedia of Food and Drink in America (New York: Oxford University Press). pp. 77-85. Stanca AM, Romagosa I, Takeda K, Lundborg T, Terzi V, Cattivelli L (2003). Diversity in abiotic stresses. pp. 179-199. In von Bothmer R, Knüpffer H, van Hintum T, Sato K (ed.) Diversity in barley (Hordeum vulgare L.), Elsevier Sun C, Sathish P, Ahlandsberg S, Jansson C (1998). The Two Genes Encoding Starch-Branching Enzymes IIa and IIb Are Differentially Expressed in Barley. Plant Physiol. 118:37-49. Theerawita C, Boriboonkaset T, Chaum S, Supaibulwatana K, Kirdmanee C (2012). Transcriptional regulations of the genes of starch metabolism and physiological changes in response to salt stress rice (Oryza sativa L.) seedlings. Physiol. Mol. Biol. Plants, 810 Afr. J. Biotechnol. 18(3):197-208. Tiwari JK, Munshi AD, Kumar R, Pandey RN, Arora A, Bhat JS, Sureja AK (2010). Effect of salt stress on cucumber: Na+/K+ ratio, osmolyte concentration, phenols and chlorophyll content. Acta. Physiol. Plant 32:103-114 Tomita M, Okutani A, Beiles A, Nevo E (2011). Genomic, RNA, and ecological divergences of the Revolvertransposon-like multi gene family in Triticea. BMC Evol. Biol. 11:269. Vaezi B, Bavei V, Shiran B (2010). Screening of barley genotypes for drought tolerance byagro-physiological traits in field condition. Afr. J. Agric. Res. 5(9):881-892 Wang WS, Pan YJ, Zhao XQ, Dwivedi D, Zhu LH, Ali J, Li ZK (2011). Drought-induced site-specific DNA methylation and its association with drought tolerance in rice (Oryza sativa L.). J. Exp. Bot. 62(6):1951-1960. Waseem M, Ali A, Tahir M, Nadeem MA, Ayub M, Tanveer A, Ahmad R, Hussain M (2011). Mechanism of drought tolerance in plant and its management through different methods. Cont. J. Agric. Sci. 5(1):1025 Xin H, Zhu W, Wang L, Xiang Y, Fang L et al. (2013). Genome Wide Transcriptional Profile Analysis of Vitis amurensis and Vitis vinifera in Response to Cold Stress. PLoS ONE 8(3): e58740. Zhang Y, Morar M, Ealick SE (2008). Structural Biology of the Purine Biosynthetic Pathway. Cell Mol Life Sci. 65(23):3699-3724. Vol. 14(9), pp. 811-819, 4 March, 2015 DOI: 10.5897/AJB2014.14132 Article Number: 7EB252D50963 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Metabolic and biofungicidal properties of maize rhizobacteria for growth promotion and plant disease resistance Pacôme A. Noumavo1, Nadège A. Agbodjato1, Emma W. Gachomo2,3, Hafiz A. Salami1, Farid Baba-Moussa4, Adolphe Adjanohoun5, Simeon O. Kotchoni2,3 and Lamine Baba-Moussa1* 1 Laboratoire de Biologie et de Typage Moléculaire en Microbiologie, Département de Biochimie et de Biologie Cellulaire, Faculté des Sciences et Techniques, Université d’Abomey-Calavi 05 BP 1604 Cotonou, Bénin. 2 Department of Biology, Rutgers University, 315 Penn St., Camden, NJ 08102, USA. 3 Center for Computational and Integrative Biology (CCIB), Rutgers University, 315 Penn St., Camden, NJ 08102, USA. 4 Laboratoire de Microbiologie et de Technologie Alimentaire, Faculté des Sciences et Techniques, Université d’AbomeyCalavi, Bénin. 5 Centre de Recherches Agricoles Sud, Institut National des Recherches Agricoles du Bénin, Attogon, BP 884 Cotonou, Bénin. Received 27 August, 2014; Accepted 19 February, 2015 Plant growth promoting rhizobacteria (PGPR) are known to influence plant growing both by direct and/or indirect mechanisms. This study aimed to establish PGPR profile of 15 bacteria isolated from maize (Zea mays L.) rhizosphere in Benin. These rhizobacteria were screened in vitro for the plant growth promoting traits like production of indole acetic acid (IAA), ammonia (NH3), hydrogen cyanide (HCN), catalase, exopolysaccharides and antifungal activity against phytopathogenic fungi for example Fusarium verticillioides, that is an important maize pathogenic. Most rhizobacteria strains were found to produce catalase (100%), exopolysaccharides (100%), ammonia (86.66%), hydrogen cyanide (80%) and indole acetic acid (60%). Pseudomonas putida, Pseudomonas fluorescens and Azospirillum lipoferum have highly produced many of the investigated metabolites. Streptomyces hygroscopicus, Streptomyces fasciculatus, Pseudomonas aeruginosa, P. putida, P. fluorescens and A. lipoferum inhibited mycelial growth of F. verticillioides and Aspergillus ochraceus. P. fluorescens and P. aeruginosa were highly antagonistic against F. verticillioides (52.24% of mycelial growth inhibition) and A. ochraceus (58.33% of mycelial growth inhibition). These results suggest the possibility to use these rhizobacteria as biological fertilization to increase maize yield and the biological control of F. verticillioides and A. ochraceus. Key words: Rhizobacteria, Plant growth promoting rhizobacteria (PGPR), antifungal activities, biological control, Benin. INTRODUCTION Agriculture is increasingly dependent on the use of chemical fertilizers, growth regulators and pesticides to increase yield. Continued use of such chemical causes wide spread problems in environmental pollution, animal 812 Afr. J. Biotechnol. and human health, destruction of natural biological communities and modifies natural nutrient recycling (Karuppiah and Rajaram, 2011). One of the solutions to these problems is the use of bioresources to replace the chemical products. To face this situation, the use of bioresources to replace these synthesis products is increasingly considered. Among these bio-resources, the use of Rhizobacteria attracts more and more scientists’ attention. The rhizosphere is the area around and under the influence of plant roots and it is known to promote the growth of different prokaryotic and eukaryotic microorganisms (Wahyudi et al., 2011; Cardon and Gage, 2006). Rhizospheric microorganisms can have positive, negative or neutral effects on plant growth and can be classified into following categories bacteria, fungi, actinomycetes, protozoa and algae among many others (Paul and Clark, 1996). Indeed, among these microorganisms, bacteria are the most studied and well known probably because they grow quickly and they have the ability to use a wide range of substances as carbon or nitrogen sources (Karuppiah and Rajaram, 2011). Some of the bacteria found in the rhizosphere include plant growth promoting rhizobacteria (PGPR). The term PGPR comprises of many bacterial species belonging to Pseudomonas, Azospirillum, Azotobacter, Klebsiella, Enterobacter, Alcaligenes, Arthrobacter, Burkholderia, Bacillus and Serratia genus (Saharan and Nehra, 2011) and which improve plant growth. The mechanisms used by PGPR to promote plant growth are not fully understood. PGPR rhizobacteria use one or more direct or indirect mechanisms to improve the growth and health plants. The direct promotion by PGPR entails either providing the plant with a plant growth promoting substances that are synthesized by the bacterium or facilitating the uptake of certain plant nutrients from the environment. The indirect promotion of plant growth occurs when PGPR lessen or prevent the deleterious effect of one or more phytopathogenic microorganisms. These mechanisms can be triggered simultaneously or individually at different stages of the plant development (Ahmad et al., 2008). Several direct mechanisms such as atmospheric nitrogen (N2) fixation, minerals (for example phosphate) solubilization, antagonism against phytopathogenic microorganisms by production of siderophores, and the ability to produce or change the concentration of the phytohormones (indole3-acetic acid, gibberellic acid, cytokinines and ethylene) have been reported (Nelson, 2004). Examples of indirect mechanisms include production of antibiotics, lytic enzymes, hydrogen cyanide, catalase, siderophores and competition for space and nutrients. These mechanisms include those involved in the host plant, pathogens andharmful microbes’ biological control (Khan et al., 2006). Thus, the plant health may not be affected in presence of pathogens microorganisms and favorable conditions to cause the diseases, because PGPR destroy the pathogen molecular signal or open plant induced systemic resistance (ISR). The present study aimed to establish the PGPR profile of 15 rhizobacteria isolated from maize rhizosphere in Benin, in order to select the best PGPR. MATERIALS AND METHODS Microorganisms The bacteria strains (15) used, were Azospirillum lipoferum, Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas fluorescens, Streptomyces hygroscopicus, Streptomyces rimosus, Streptomyces fasciculatus, Bacillus coagulans, Bacillus thuringiensis, Bacillus pumilus, Bacillus polymixa, Bacillus licheniformis, Bacillus lentus, Bacillus circulans and Bacillus firmus. These bacteria were previously isolated from the maize rhizosphere in Benin (West Africa), and were biochemically characterized by standard methods of Cappuccino and Sherman (1992) and Aneja (2003). The bacteria cultures were maintained on Muller Hinton (MH) broth with 10% of glycerol at -20°C. At the onset of the experiments all the strains were grown on their respective selective medium: Pseudomonas on King’s B medium, Bacillus on Nutrient agar, Azospirillum on NFb-medium and Streptomyces on Kusterglycérol medium. Screening of rhizobacteria for different metabolites Indole acetic acid production The production of indole acetic acid (IAA) was detected by adapting method described by Brick et al. (1991). Bacteria were grown in nutrient broth supplemented with L-Tryptophan (500 µg/ml) at 36 ± 2°C for 48 h. Fully grown cultures were centrifuged at 3000 rpm for 30 min. Two (2) ml of the supernatant were mixed with 2 drops of orthophosphoric acid and 4 ml of Salkowski reagent (50 ml of 35% perchloric acid, 1 ml of 0.5 M ferric chloride solution). The appearance of a pink color after 25 to 30 min, indicates IAA production. According to the color intensity, three point scale (+ = low intensity; ++ = Average intensity and +++ = high intensity) were used for analyze the results. Hydrogen cyanide production All rhizobacteria were investigated for the production of hydrogen cyanide (HCN) by the method of Lorck (1948). Bacterial streaks were made on nutrient agar enriched with glycine (4.4 g/l) poured *Corresponding author. E-mail address: laminesaid@yahoo.fr. Tel: +229 97.12.34.68. Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Abbreviations: IAA, Indole acetic acid; HCN, hydrogen cyanide; PGPR, plant growth promoting rhizobacteria; ISR, Induced Systemic Resistance; EPS, exopolysaccharides; IPA, indole pyruvic acid. Noumavo et al. into Petri dishes. The top of the plate was covered with a Whatman filter paper No. 1 soaked in 2% sodium carbonate in 0.5% picric acid solution. After sealed with parafilm, those plates were incubated at 36 ± 2°C for 4 days. The positive reaction of HCN production is shown by apparition of orange to red color. According to the color intensity, three point scale (+ = low intensity; ++ = Average intensity and +++ = high intensity) were used to analyze the results. 813 Where, r1 = diameter of pathogen growth in monoculture (control); r2 = diameter of pathogen growth in dual culture. Data analysis and photo manipulation Catalase production Catalase is an enzyme which hydrolyzes the hydrogen peroxide (H2O2) to oxygen and water. With a sterile pipette, a bacterial colony was dispersed in a drop of hydrogen peroxide previously deposited on a clean dry slide. The positive reaction is shown by an immediate release of oxygen bubbles forming foam solution (Riegel et al., 2006). Exopolysaccharides production The exopolysaccharides (EPS) production was estimated by modified method of Damery and Alexander (1969). Bacteria strains were inoculated into Erlenmeyer flask containing 25 ml of yeast extract mannitol (YEM) broth supplemented with 1% of carbon source (glucose). The inoculated flasks were incubated at 36 ± 2°C on a gyro-rotatory shaker at 150 rpm for 72 h. After incubation, the bacterial suspension was centrifuged at 3500 rpm for 30 min and the supernatant was mixed with two volumes of chilled acetone. The crude polysaccharide developed was collected by centrifugation at 3500 × g for 30 min. The EPS was washed with distilled water and acetone (alternately), and weighed after overnight drying at 105°C. Ammonia production The production of ammonia by rhizobacteria was tested by peptone water method (Cappuccino and Sherman, 1992). The strains were inoculated in peptone water (10 ml) and incubated for 48 to 72 h at 36 ± 2°C. After incubation, Nessler’s reagent (0.5 ml) was added to each tube. The ammonia production was showed by development of brown to yellow color. According to the color intensity, three point scale (+ = low intensity; ++ = average intensity and +++ = high intensity) were used to analyze the results. Antifungal activity of rhizobacteria The antifungal activity of rhizobacteria against some phytopathogenic fungi namely Fusarium verticillioides, Aspergillus ochraceus, Aspergillus tamarii and Aspergillus wentii was assessed by dual culture method according to Kumar et al. (2002). A disk (5 mm diameter) was cut out from a young culture of the fungal pathogen and placed in the middle of a Petri dish of potato dextrose agar (PDA). Ten (10) µl of a rhizobacteria suspension (approx. 108 CFU/ml) were spotted 2 cm from and on opposite sides of the fungus infected disk. The control Petri dishes were realized by monocultures of each pathogen. The Petri dishes were incubated at 26 ± 1°C and checked for zones of inhibition of mycelium growth after seven (7) days when the fungal mycelium had reached the edge of the Petri dish. When the pathogen grew over the rhizobacteria, we concluded that rhizobacteria did not have antifungal activity. On the other hand, when fungal growth was restricted by the rhizobacteria, the rhizobacteria’s antifungal activity (percentage of inhibition) was calculated by the following formula: The data were analyzed by using Microsoft Office Excel software version 2003. The graphs were realized by using the same software. Adobe Photoshop version 7.0 was used for photos treatment. RESULTS Production of plant growth promoting metabolites (PGPM) by rhizobacteria strains Fifteen (15) rhizobacteria strains were evaluated for production of the plant growth promoting metabolites as catalase, ammonia, hydrogen cyanide, exopolysaccharides and indole acetic acid (IAA) as well as for antifungal properties. All the 15 strains had produced catalase, and exopolysaccharides (Figure 1), while 86.66, 80 and 60% of the strains had produced ammonia, hydrogen cyanide and IAA, respectively. Nine of the strains were found to have antifungal properties (Figure 1). Of the four bacteria genera (Bacillus, Streptomyces, Pseudomonas and Azospirillum) used for production of PGP metabolites searching, all the strains of Pseudomonas and Azospirillum were found to produce catalase, ammonia, hydrogen cyanide, IAA and exopolysaccharides. The production of plant growth promoting metabolites (PGPM) by different genera of the 15 rhizobacteria strains tested in this study is presented in Figure 2. All the species of Pseudomonas and Azospirillum tested were found to produce catalase, ammonia, hydrogen cyanide, indole acetic acid and exopolysaccharides. All the species of Streptomyces and Bacillus have produced catalase and exopolysaccharides, while 87.5 and 66.7% of the Bacillus and Streptomyces species have respectively produced ammonia. Only 75 and 66.7% of Bacillus and Streptomyces species have respectively produced hydrogen cyanide, whereas 62.5% of Bacillus species have produced IAA but none of Streptomyces species have produced any IAA Quantification of PGP-metabolites rhizobacteria strains produced by Table 1 provides a detailed profile of different rhizobacteria species for the parameters previously evaluated (catalase production, ammonia, cyanide hydrogen, indole acetic acid and exopolysaccharides) and an estimate the levels production of these parameters. When reading this 814 Afr. J. Biotechnol. Figure 1. Production of plant growth promoting metabolites by rhizobacteria strains. Cat =Catalase; NH 3=ammonia; HCN=hydrogen cyanide; IAA= indole acetic acid; EPS= exopolysaccharides; AFA= antifungal activity. Figure 2. Production of plant growth promoting metabolites by different genera of rhizobacteria. Cat=Catalase; NH3=ammonia; HCN=hydrogen cyanide; IAA=indole acetic acid; EPS=exopolysaccharides; AFA= antifungal activity. Noumavo et al. 815 Table 1. Estimation of plant growth promoting metabolites produced by rhizobacteria. Rhizobacteria B. coagulans B. thuringiensis B. circulans B. polymixa B. licheniformis B. firmus B. lentus B. pumilus S. hygroscopicus S. rimosus S. fasciculatus P. aeruginosa P. putida P. fluorescens A. lipoferum Cat + + + + + + + + + + + + + + + NH3 + ++ + + + + + + ND + + +++ +++ ++ Production HCN + + ND + + + ND + + ND + + +++ +++ +++ IAA + ++ ND + + ND ND + ND ND ND ++ +++ +++ +++ EPS +++ + ++ ++ ++ ++ + + + + + + ++ +++ ++ Cat = Catalase; NH3 = ammonia; HCN = hydrogen cyanide; IAA = indole acetic acid; EPS = exopolysaccharides ; B. = Bacillus ; S. = Streptomyces ; P. = Pseudomonas ; A. = Azospirillum ; + = low ; ++ = average ; +++ = high ; ND = not detected. table, we can observe that the different rhizobacteria do not have the same potential for production of PGPmetabolites. Thus, Pseudomonas putida and P. fluorescens highly produce ammonia, while Azospirillum lipoferum and B. thuringiensis have an average ammonia production. On the contrary, S. rimosus and B. lentus do not produce ammonia. The other strains lowly produced ammonia. A. lipoferum, P. fluorescens and P. putida showed high production level of hydrogen cyanide and indole acetic acid. S. rimosus, B. lentus, B. circulans, S. fasciculatus, S. rimosus, S. hygroscopicus, B. lentus, B. firmus and B. circulans have not produced the hydrogen cyanide and indole acetic acid. Apart from P. fluorescens that displays high production of exopolysaccharides, all the other rhizobacteria had low or average produced exopolysaccharides. Antagonism assay of rhizobacteria strains against phytopathogenic fungi The antifungal properties of the rhizobacteria strains used in this study were tested against plant pathogenic: Fusarium verticillioides, Aspergillus Ochraceus, A. Tamarii and A. wentii. The growth of F. verticillioides was inhibited by S. hygroscopicus, S. fasciculatus, P. aeruginosa, P. putida, P. fluorescens and A. lipoferum to varying degrees. An inhibition zone was observed in Petri dishes for A. ochraceus co-inoculated with P. aeruginosa, S. hygroscopicus, S. fasciculatus, P. putida, P. fluorescens and A. lipoferum (Table 2). B. thuringiensis, B. licheniformis, B. firmus, B. lentus and S. rimosus did not inhibit the growth of any of the pathogenic fungi tested (Table 2). No antagonism was observed between rhizobacteria strains and A. tamarii and A. Wentii (Figure 3d). In opposite, S. hygroscopicus, S. fasciculatus, P. aeruginosa, P. putida, P. fluorescens and A. lipoferum have inhibited the normal A. ochraceus mycelial growth. P. aeruginosa, S. hygroscopicus and S. fasciculatus have induced the mycelial growth inhibition of A. ochraceus respectively with the rate of 58.33, 57.98 and 57.73% (Table 2). Many rhizobacteria strains have presented the antagonism against F. verticillioides. Indeed, all rhizobacteria except B. thuringiensis, B. licheniformis, B. firmus, B. lentus (Figure 3c), B. pumilus and S. rimosus have inhibited the mycelial growth of F. verticillioides. S. fasciculatus (50.25%) (Figure 3b), A. lipoferum (50.58%) and P. fluorescens (52.24%) have strongly inhibited mycelial growth of F. verticillioides. It was remarked that all rhizobacteria display antagonistic effect to A. ochraceus which have also inhibited F. verticillioides. DISCUSSION Understanding the bacteria mechanisms of root colonization and plant growth is crucial to improve the biological control methods against the plant pathogens and efficient use of plant growth promoting rhizobacteria (Kloepper et al., 1980). Indeed, PGPR properties investi- 816 Afr. J. Biotechnol. Table 2. Antifungal profiles of rhizobacteria strains. Rhizobacteria B. coagulans B. thuringiensis B. circulans B. polymixa B. licheniformis B. firmus B. lentus B. pumilus S. hygroscopicus S. rimosus S. fasciculatus P. aeruginosa P. putida P. fluorescens A. lipoferum Mycelial growth inhibition over control (%) F. verticillioides A. ochraceus A. tamarii 41.46 48.42 34.49 46.43 57.73 50.25 57.98 49.25 58.33 48.59 55.00 52.24 51.16 50.58 52.38 - A = Azospirillum; As = Aspergillus; F = Fusarium; - = no inhibition. Figure 3. Antagonism between rhizobacteria and plant pathogens. a=Mono-culture of F. verticillioides; b= dual culture of F. verticillioides and S. fasciculatus; c=dual culture of F. verticillioides and B. lentus; d=dual culture of A wenti and B. firmus; e=mono culture of A. wenii. A. wentii - Noumavo et al. gating the different rhizobacteria in the study revealed interesting results that illuminate their PGPR profiles. All rhizobacteria strains used in this study produced catalase. These strains are in the genera Bacillus, Pseudomonas, Azotobacter and Streptomyces. Previous studies by Rathaur et al. (2012) showed that Bacillus spp., Pseudomonas spp., and Azotobacter spp., isolated from Withania somnifera (Ashwagandha), were also able to produce catalase. The ability to produce catalase gives the bacteria an added advantage because it makes them potentially more resistant to environmental, mechanical and chemical stresses (Rathaur et al., 2012). The ability of PGPR to produce ammonia is considered as an important measure to influence indirectly plant growth (Karuppiah and Rajaram, 2011). About eighty-six percent (86%) of tested rhizobacteria had produced ammonia (87.5% of Bacillus spp., 66.6% of Streptomyces spp., 100% of Pseudomonas spp., and Azospirillum spp.,). P. putida and P. fluorescens displayed high production of ammonia, while Azospirillum lipoferum and B. thuringiensis had average production. In studies by other researchers, ammonia production was detected in 95% of strains isolated from the rhizosphere of rice, mangroves and soils contaminated by effluent (Samuel and Muthukkaruppan, 2011, Joseph et al., 2007). B. subtilis MA-2 and P. fluorescens MA-4 known to be real producers of ammonia were shown to significantly increase the biomass of medicinal and aromatic plants such as geranium (Mishra et al., 2008). All the studied strains have produced low to moderate amount of exopolysaccharides, except P. fluorescens that displayed high production. Exopolysaccharides (EPS) produced by rhizobacteria join soil aggregates and change their porosity (Alami et al., 2000). Thus, the soil porosity which is directly associated to the transfer of water from the soil to plant roots, is influenced by bacterial activity. Bacterial EPS produced on root surfaces also contribute to the maintenance of the water flow required for photosynthetic activity and plant growth. In addition, EPS can limit or retard the soil dessiccation under water stress conditions. Conversely, in water excess (flooding), EPS help to prevent the dispersion of clay soil (Henao and Mazeau, 2009). Only 60% of the strains were able to produce IAA (100% of Pseudomonas spp. and Azospirillum spp., 62.5% of Bacillus spp., 0% of Streptomyces spp.,). A. lipoferum, P. fluorescens and P. putida have produced large amounts of IAA. Several bacterial species for example Bacillus spp., Pseudomonas spp., Azotobacter spp., Azospirillium spp., Phosphobacteria spp., Glucanoacetobacter spp., Aspergillus spp. and Penicillium spp. have been reported to produce IAA (Shobha and Kumudini, 2012, Wahyudi et al., 2011). IAA production by PGPR varies according to species and strains origin. This may also be influenced by growth conditions, stage of development and the substrate 817 availability (Ashrafuzzaman et al., 2009). The IAA produced by rhizobacteria plays a major role in roots elongation and can directly promote roots growth by cells elongation and cells division stimulation or indirectly influences the ACC (Amino cyclopropane-1-carboxylate)deaminase activity in rhizobacteria (Rathaur et al., 2012). In addition, Patten and Glick (2002) reported that low levels of IAA can stimulate roots elongation, while high levels of IAA stimulate the lateral and adventitious roots formation. The ACC-deaminase product by PGPR, hydrolyzes plant’s ACC, an immediate precursor of plant ethylene hormone, which prevents production of toxic ethylene levels (Patten and Glick, 2002). The ability of rhizobacteria to use tryptophan added to their culture medium is an important parameter to detect and quantify their IAA production. Tryptophan is the main precursor of the bacterial IAA biosynthesis via the Indole Pyruvic Acid (IPA) pathway (Patten and Glick, 1996). IAA is part of many secondary metabolites produced by rhizobacteria in abundance during the stationary phase, even in the absence of tryptophan (Wahyudi et al., 2011). Another important trait of PGPR, that may indirectly influence the plant growth, is the production of hydrogen cyanide. Eighty percent (80%) of rhizobacteria tested produced hydrogen cyanide (100% of Pseudomonas spp., Azospirillum spp., 75% of Bacillus spp., 66.6% of Streptomyces spp.). In a study by Karuppiah and Rajaram (2011), 75% of Bacillus spp., isolated produced hydrogen cyanide, whereas only 40% of rhizobacteria isolated from bean (Phaseolus vulgaris L.) in France by Kumar et al. (2012) produced the same secondary metabolite. Many rhizobacteria displayed antagonism against phytopathogenic fungi: S. hygroscopicus, S. fasciculatus, P. aeruginosa, P. putida, P. fluorescens and A. lipoferum significantly (51.16 to 58.33%) inhibited the mycelial growth of A. ochraceus. All rhizobacteria except B. thuringiensis, B. licheniformis, B. firmus, B. lentus, B. pumilus and S. rimosus inhibited the F. verticillioides mycelia growth by 34.49 to 52.24%. Fatima et al. (2009) showed that Azospirillum WPR-42 and Azospirillum WM 3 isolated from wheat (Triticum turgidum) inhibited mycelial growth of Rhizoctonia solani by 55 and 75%, respectively. Wahyudi et al. (2011) also demonstred that isolates of Bacillus spp. inhibited mycelial growth of Sclerotium rolfsii and F. oxysporum by 8.33 and 25%, respectively. None of the rhizobacteria tested in this study were antagonistic against A. tamarii and A. wentii. This suggests that the modes of action and types of antifungal metabolites produced vary from a rhizobacteria to another (Williams and Asher, 1996). The reduction of fungal growth by some PGPR and the in vitro inhibition zones may be probably due to antifungal substances and/or lytic enzymes released by PGPR. Indeed, the synthesis of a wide range antibiotics is most common character associated with the ability of PGPR to preclude the plant pathogens proliferation (Mazurier et al., 2009). The antibiosis mechanism is well-known and perhaps 818 Afr. J. Biotechnol. most importantly used by PGPR to limit the pathogens’ invasion. It consists of direct inhibition of the pathogen growth through the antifungal metabolites and/or antibiotics production (Adam, 2008). B. subtilis strains produce a variety of powerful antifungal metabolites such as zwittermycine-A, kanosamine (Peypoux et al., 1999) and lipopeptides belonging to surfactin, iturin and the fengycin families (Rahman et al., 2007). Some antifungal molecules, produced by Pseudomonas spp, such as hydrogen cyanide (HCN), viscosamide, pyoluteorine, 2,4diacetylphloroglucinol, pyrrolnitrin, phenazines and butyrolactone are also implicated in the bio-control (Haas and Defago, 2005). Conclusion This study focused on establishing the PGPR profiles of bacteria isolated from maize rhizosphere in Benin. Most of the rhizobacteria strains were found to produce catalase, exopolysaccharides, ammonia, hydrogen cyanide and indole acetic acid. P. putida, P. fluorescens and A. lipoferum produced most of the investigated metabolites. These results suggest the possibility to use these rhizobacteria as biological fertilization to increase the maize yield. S. hygroscopicus, S. fasciculatus, P. aeruginosa, P. putida, P. fluorescens and A. lipoferum inhibited mycelial growth of F. verticillioides and A. ochraceus. P. fluorescens and P. aeruginosa were highly antagonistic against F. verticillioides and A. ochraceus and can be used in biological control of these phytopathogenic fungi. Conflict of interests The authors declare that they have no competing interests. ACKNOWLEDGEMENTS The authors thanked the International Foundation of Science (IFS research grant No. C/5252-1) and West Africa Agricultural Productivity Programme (WAAPP/PPAAO) for funding this work. REFERENCES Adam A (2008). The systemic resistance induced in tomato and cucumber and stimulation of the lipoxygenase pathway by nonpathogenic rhizobacteria. Ph.D. Thesis, University of Liège. Liège. Belgium. p. 148. Ahmad F, Ahmad I, Khan MS (2008). Screening of free-living rhizospheric bacteria for their multiple growth promoting activities. Microbiol. Res. 163:173-181. Alami Y, Achouak W, Marol C, Heulin T (2000). Rhizosphere soil aggregation and plant growth promotion of sunflower by an EPSproducing Rhizobium sp. isolated from sunflower roots. Appl. Environ. Microbiol. 66:3393-3398. Aneja KR (2003). Experiments in Microbiology, Plant pathology and Biotechnology. 4th ed. New Age International Publishers, Daryaganj, New Delhi. Ashrafuzzaman M, Hossen FA, Ismail MR, Hoque MA, Islam ZM, Shahidullah SM, Meon S (2009). Efficiency of plant growthpromoting rhizobacteria (PGPR) for the enhancement of rice growth. Afr. J. Biotechnol. 8: 1247-1252. Brick JM, Bostock RM, Silverstone SE (1991). Rapid in situ assay for indoleacetic acid production by bacteria immobilized on nitrocellulose membrane. Appl. Environ. Microbiol. 57: 535-538. Cappuccino JC, Sherman N (1992). Microbiology: A Laboratory Manual. Benjamin (ed). Cumming Publishing Company, New York. USA. pp. 125-179. Cardon ZJ, Gage DJ (2006). Resource exchange in the rhizosphere: molecular tools and the microbial perspective. Anim. Rev. Ecol. Evol. Syst. 37:459-488. Damery JT, Alexander M (1969). Physiological differences between effective and ineffective strains of Rhizobium. Soil. Sci. 108: 209-215. Fatima Z, Saleemi M, Zia M, Sultan T, Aslam M, Rehman R, Fayyaz Chaudhary M (2009). Antifungal activity of Plant Growth-Promoting Rhizobacteria isolates against rhizoctonia solani in wheat. Afr. J. biotechnol. 8:219-225. Haas D, Defago G (2005). Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat. Rev. Microbiol. 3: 307-319. Henao LJ, Mazeau K (2009). Molecular modelling studies of clayexopolysaccharide complexes: soil aggregation and water retention phenomena. Mat. Sci. Engin. 29: 2326-2332. Joseph B, Ranjan Patra R, Lawrence R (2007). Characterization of plant growth promoting rhizobacteria associated with chickpea (Cicer arietinum L.). Int. J. Plant. Prod. 2: 141-152.Karuppiah P, Rajaram S (2011). Exploring the Potential of Chromium Reducing Bacillus sp. and there Plant Growth Promoting Activities. J. Microbiol. Res. 1:1723. Khan MS, Zaidi A, Wani PA (2006). Role of phosphate solubilizing microorganisms in sustainable agriculture-a review. Agron Sustain. Dev. 27:29-43. Kloepper JW, Schroth MN, Miller TD (1980). Effects of rhizosphere colonization by plant growth promoting rhizobacteria on potato plant development and yield. Ecol. Epidemiol. 70:1078-1082 Kumar A, Kumar A, Devi S, Patil S, Payal C, Negi S (2012). Isolation, screening and characterization of bacteria from Rhizospheric soils for different plant growth promotion (PGP) activities: an in vitro study. Recent Res. Sci. Technol. 4:01-05. Kumar NR, Arasu VT, Gunasekaran P (2002). Genotyping of antifungal compounds producing plant promoting rhizobacteria, Pseudomonas fluorescens. Curr. Sci. 82:1463-466. Lorck H (1948). Production of hydrocyanic acid by bacteria. Physiol. Plantarum. 1:142-146. Mazurier S, Corberand T, Lemanceau P, Raaijmakers JM (2009). Phenazine antibiotics produced by fluorescent pseudomonads contribute to natural soil suppressiveness to Fusarium wilt. ISME J.. 3: 977-991. Mishra PK, Mishra S, Selvakumar G, Bisht SC, Kundu S, Bisht JK, Gupta HS (2008). Characterization of a psychrotrophic plant growth promoting Pseudomonas PGERs17 (MTCC 9000) isolated from North Western Indian Himalayas. Annal. Microbiol. 58: 1-8. Nelson LM (2004). Plant growth promoting rhizobacteria (PGPR): Prospect for new inoculants. Crop Managt. doi: 10. 1094/CM-20040301-05-RV. Patten CL, Glick BR (1996). Bacterial biosynthesis of indole-3-acetic acid. Can. J. Microbiol. 42:207-220. Patten CL, Glick BR (2002). Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. Appl. Environ. Microbiol. 68:3795-3801. Paul EA, Clark FE (1996). Soil Microbiology and Biochemistry. Academics Press, San Diego: CA, USA, p. 340. Peypoux F, Bonmatin JM, Wallach J (1999). Recent trends in the biochemistry of surfactin. Appl. Environ. Microbiol. 51: 553-563. Rathaur P, Ramteke PW, Waseem W, John SA (2012). Isolation and characterization of nickel and cadmium tolerant plant growth promoting rhizobacteria from rhizosphere of Withania somnifera. J. Biol. Environ. Sci. 6:253-261. Noumavo et al. Rahman M, Ano T, Shoda M (2007). Biofilm fermentation of iturin A by a recombinant strain of Bacillus subtilis 168. J. Biotechnol. 127: 503507. Riegel P, Archambaud M, Clavé D, Vergnaud M (2006). Bactérie de culture et d’identification difficiles. Biomérieux, Paris, France. pp. 93112. Saharan BS, Nehra V (2011). Plant Growth Promoting Rhizobacteria: A Critical Review. LSMR. 21: 1-30. Samuel S, Muthukkaruppan SM (2011). Characterization of plant growth promoting rhizobacteria and fungi associated with rice, mangrove and effluent contaminated soil. Curr. Bot. 2: 22-25. 819 Shobha G, Kumudini BS (2012). Antagonistic effect of the newly isolated PGPR Bacillus spp. on Fusarium oxysporum. Int. J. Appl. Sci. Eng. Res. 1:463-474. Wahyudi AT, Astuti RP, Widyawati A, Meryandini A, Nawangsih AA (2011). Characterization of Bacillus sp. strains isolated from rhizosphere of soybean plants for their use as potential plant growth for promoting Rhizobacteria. J. Microbiol. Antimicrobial. 3:34-40. Williams GE, Asher MJC (1996). Selection of rhizobacteria for the control of Phythium ultimum and Aphanomyces cochiliodes on sugerbeet seedlings. Crop Prot. 15:479-486. Vol. 14(9), pp. 820-828, 4 March, 2015 DOI: 10.5897/AJB2014.14339 Article Number: 664332050964 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper High-level lipase production by Aspergillus candidus URM 5611 under solid state fermentation (SSF) using waste from Siagrus coronata (Martius) Becari Cyndy Mary Farias1, Odacy Camilo de Souza1, Minelli Albuquerque Sousa1, Roberta Cruz1, Oliane Maria Correia Magalhães1, Érika Valente de Medeiros2, Keila Aparecida Moreira2 and Cristina Maria de Souza-Motta1* 1 Mycology Department, CCB, Federal University of Pernambuco, Av. Professor Nelson Chaves, s/n, 50670-420, Cidade Universitária, Recife, Pernambuco, Brazil. 2 Academic Unit of Garanhuns, Federal Rural University of Pernambuco, Av. Bom Pastor, s/n, 55292-270, Mundaú, Garanhuns, Pernambuco, Brazil. Received 25 November, 2014; Accepted 19 February, 2015 The current study evaluated lipase production by Aspergillus candidus URM 5611 through solid state fermentation (SSF) by using almond bran licuri as a new substrate. The microorganism produced high -1 levels of the enzyme (395.105 U gds ), thus surpassing those previously reported in the literature. The variable moisture content, the inductor concentration, temperature and pH were analyzed. The best production conditions were initial moisture content of 75%, 0% of inductor, at 25°C, pH 5.5, in 10.0 g of substrate. The variables initial moisture and inductor contents showed significant effects on lipase production by increasing enzyme activity in about 200% when compared with the initial screening -1 (197.44 U gds ). Optimum lipase activity was obtained at pH 2.5 at an optimum temperature of 65°C. The lipase was stable from pH 2.5 to 9.0 and at temperatures between 30 to 65°C. Results from the study are promising for the economic use and value addition from these important agro residues, which are abundantly available in Brazil. This is the first report on lipase production by A. candidus URM 5611 reaching a much higher yield of enzyme under SSF with almond bran licuri used as substrate. Key words: Aspergillus candidus URM 5611, solid state fermentation (SSF), licuri waste, lipase characterization. INTRODUCTION The enzymes from microbial sources receive special attention in the global market for bioproducts, due to their current and potential application in industry, mainly in detergents, oils and fats, dairy manufactures and pharmaceutical industries (Ângelo, 2014). Lipases stand out among the enzymes produced by fungi (Contesini et al., 2010). Lipases (EC 3.1.1.3, triacylglycerol acilhydrolases) are enzymes that occupy a prominent place among biocatalysts, and they have many applications (Ali et al., 2014). For this reason, its market share in global industrial enzymes grows significantly (Reinehra et al., 2014). In the future, this enzyme class will have industrial and commercial importance comparable to that of peptidases, which sale in industrial enzymes ranges from 25 to 40% (Barros et al., 2010; Ghasemi et al., 2011). The industrial Farias et al. lipases are mainly used as additives for washing detergents, food industries, especially in the preparation of chocolate substitutes and in the production of special flavors. Moreover, it has been widely used in the manufacture of cosmetics (tanning), in sewage treatment, and trancesterification of triglycerides (Treichel et al., 2010; Kotogán et al., 2014). The widening application of microbial lipases in biotechnology has necessitated the continued research and development of novel lipases by means of extensive screening and optimisation of process parameters (Mostafa and El-Hadi, 2010). The biotechnological potential of lipases is related to the fact that these enzymes catalyze not only the hydrolysis reactions, but also the esterification and transesterification reactions, and they keep their chemical structure and activity in different organic solvents (Tan et al., 2004). In addition, they do not often require the presence of cofactors, they catalyze various reactions at low temperature and pressure, have a broad specificity for substrates and exhibit high enantioselectivity (Reis et al., 2009; Contesini et al., 2010). They can be commonly found in nature and derive from animal, plant and microorganisms sources. Numerous filamentous fungi species produce these enzymes, especially those from the genus Aspergillus (Contesini et al., 2010; Fleuri et al., 2014). The genus Aspergillus is currently considered as one of the largest biotechnological substance producers, with several species found in nature (Liu et al., 2006). There are about 837 (Hawksworth et al., 2011) Aspergillus species commonly isolated from soil and decaying plants. These fungi produce a number of extracellular enzymes (among them: lipases), many of which are applied in different industry sectors (Contesini et al., 2010; Fleuri et al., 2014). Solid state fermentation (SSF) has become a major attraction for the production of this enzyme, like other products of high added value, due to the use of agroindustrial wastes as well as the obtained increased volumetric productivity (Ramachandran et al., 2007; Casciatori et al., 2014). Despite functional electrical stimulation (FES) advantages, this technology is still not widely used for lipase production in large scale. This fact is due to the lack of systematic studies at bench scale, for example, the definition of microorganisms producing suitable substrates and culture conditions (Holker and Lenz, 2005; Fleuri et al., 2014). However, there are few studies on lipase production by Aspergillus species through SSF. Therefore, there is the 821 need for further studies on these microorganisms’ potential for enzyme production by this method, as well as on new substrates to be used during fermentation. This study aimed to investigate lipase production by Aspergillus species preserved under mineral oil in Micoteca URM Culture Collection (WDCM604) under SSF using low cost residue. It also aimed to optimize culture conditions for production and evaluate enzyme stability regarding changes in pH and temperature. MATERIALS AND METHODS Microorganisms and inoculum preparation Eighteen isolates of Aspergillus isolated from castor bean obtained from the Micoteca URM culture collection (URM, Recife, Brazil, WDCM604) (Micoteca, 2014) were inoculated on malt extract agar (MEA (g L−1): malt 20, glucose 20, peptone 1, and agar 20) and kept at 28°C. Spores of each isolate were transferred under strict aseptic conditions to 10 mL of sterile distilled water with 0.1% Tween 80. After homogenization, the spores in the suspension were counted by means of a Neubauer chamber in order to obtain the concentration of 5x108 spores mL-1 (Sabu et al., 2005). Solid state fermentation (SSF) Solid substrate Almond bran licuri (Syagrus coronata (Martius) Beccari) were obtained from COOPERLIC - Cooperative Lanyard sand Processing, Licuri in Caldeirão Grande, Bahia, Brazil. The waste was flushed with sterile distilled water and dried in an oven (QUIMIS, Q316M2, São Paulo, Brazil) at 55°C for 48 h. Lipase production under SSF As for lipase production in 250 ml Erlenmeyer flasks, 10 g bran licuri were added with 1% olive oil, in order to induce it. The mixture was moistened with phosphate buffer (0.1 mol L -1). The initial moisture content was adjusted to 50% and pH 7.0. The flasks were autoclaved, cooled and inoculated with 1 mL of the spore suspension at a concentration of 5 x 108 spores mL-1 and incubated at 30°C (BOD, TECNAL, TE-371, São Paulo, Brazil) for 48, 72 and 96 h (Sabu et al., 2005). Enzymes extraction Fifty (50) mL of sterile distilled water containing 0.01% Tween 80 were added to each flask and kept on a rotary shaker (TECNAL) at 150 rpm for 10 min. The fermented substrate was subjected to filtration by using sterile lint and serial filter paper (CELAB 22.15 microns) with the aid of a vacuum pump. The resulting supernatants were assayed for lipase activity. All fermentation tests were carried out in three independent experiments (Brunk et al., 2005). *Corresponding author. Email: smotta@ufpe.br. Tel: +55 81 2126 8948. Fax: +55 81 2126 8480. Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Abbreviation: SSF, Solid state fermentation. 822 Afr. J. Biotechnol. Table 1. Variable levels of the 24 experimental design for the production of lipase (U gds-1) in SSF by Aspergillus candidus URM 5611 using bran licuri as substrate. Variable Inductor (I) Im (%) T (ºC) pH Low (-1) 5.0 45 25 5.5 Levels Central (0) 10.0 60 32.5 6.5 High (+1) 15.0 75 40 7.5 I, inductor; Im, initial moisture content; T, temperature. Enzyme activity The enzymatic activity was accomplished by titrimetric method using olive oil (10% w/ v) as substrate for the enzyme dosage, which was emulsified with arabic gum (5% w v-1) in distilled water. 5 mL of this emulsion was added to 1 mL of crude enzyme extract, and incubated for 1 h at 37°C, then titrated with NaOH solution (0.05 M) according to Watanabe et al. (1977). The activity dosage was performed by using phenolphthalein as indicator and the arithmetic mean of the values was used to determine the enzyme activity calculation. One lipase activity unit was defined as the amount of enzyme that releases 1 µ mole fatty acid per minute, under the conditions described above, and that can be determined through the equation by Leal (2002). The moisture of each sample was determined according to the AOAC (2003) for further conversion of the results into dry substrate (U gds-1). Experimental design and statistical analysis The influence of temperature (T), initial moisture content (Im), inductor (I) and pH (pH) on lipase production was evaluated from the results of the experiments performed according to a 24 factorial design (Bruns et al., 2006), plus four central points (Table 1). All statistical analyses were performed by using Statistic 8.0 software (Statsoft, 2001). Enzyme partial characterization Lipase activity of the crude enzyme extract was measured at different pH and temperature values as well as the effect of pH on the enzymatic activity stability. Effect of pH on the enzymatic activity stability The pH effect was determined by enzymatic activity at 50°C; the crude enzyme extract was emulsified for 3 min with gum arabic (5% w/v) in olive oils at different pH, by using the following buffers: citrate - phosphate (2.5 to 3.5); acetate (4.0 to 4.5); citrate phosphate (5.0 to 7.0) and Tris-HCl (7.4 to 9.0), all 0.05 M. In order to determine enzyme pH stability, the enzyme extract was previously subjected to the action of different pH values by using buffer solutions with pH ranging from 2.5 to 9.0 for periods of 60, 120 and 180 min and it was then subjected to the determination of lipase activity as described above. The analyses were performed in triplicate. Effect of temperature on the enzymatic activity stability The temperature effect was determined with pH optimal constant of 2.5 by incubating the enzyme extract with the respective substrate, with temperature variations between 30 to 80°C, with a variation range of 5°C for a period of 60, 120 and 180 min. The enzymatic activity was performed as previously described. All analyses were performed in triplicate. Aiming to determine the temperature stability of the enzyme, the extract was preincubated at temperatures ranging from 30 to 80°C for 60 min and it was then subjected to lipase activity determination. The analyses were performed in triplicate. RESULTS AND DISCUSSION Screening for lipase production All the 18 tested cultures of Aspergillus produced high levels of lipase when bran licuri was used as substrate. Eleven of the 18 culture (61.1%) samples yielded over 100/ gds. A. candidus URM 5611 was the best producer -1 with 197.44 U gds , followed by Aspergillus flavus URM 5794 and Aspergillus sclerotiorum URM 5792 with -1 production of 163.25 and 154.21 U gds , respectively, (Table 2). Because of the high level of lipase (197.44 U -1 gds ) produced by A. candidus URM 5611, this microorganism was selected to study the best conditions for enzyme production. Palma et al. (2000) obtained maximum lipase activity by Penicillium restrictum 27.8 U -1 gds by using babassu palm supplemented with peptone as substrate. In solid-state cultivation on a mixture of sunflower seed meal and sugarcane bagasse, Alberton et al. (2010) evaluated lipase production by Rhizopus -1 microsporus. The maximum production was 26 U gds , and it was applied to the treatment of dairy waste. When compared with the results obtained in the current study, species from genus Aspergillus appear to be most promising for lipase production by SSF, since they produce high levels of the enzyme. Castiglioni et al. (2009) tested lipase production by Aspergillus fumigatus under SSF by using shell and rice bran oil, and olive added as carbon source. The obtained value of the total -1 activity of 117.02 U gds was similar to that obtained in the present study by Aspergillus caespitosus URM 5938 with almond bran licuri and olive oil as carbon source and -1 total activity of 117.33 U gds . However, it was still less than the maximum value obtained with A. candidus URM -1 5611 which showed total activity of 197.44 U gds . Fleuri Farias et al. 823 Table 2. Total lipase activity (U gds-1) produced by cultures of Aspergillus using licuri bran as substrates and incubated for 96 h. a Access number URM 5910 5938 5611 5608 5794 5698 5620 5827 5838 5870 5609 5787 5792 5615 5774 5606 5829 5701 Species Aspergillus awamorii Nakaz. Aspergillus caespitosus Raper & Thom Aspergillus candidus Link Aspergillus duricaulis Raper & Fennell Aspergillus flavus Link Aspergillus fumigatus Fresen. Aspergillus japonicus Saio Aspergillus melleus Yukawa Aspergillus niger Tiegh. Aspergillus niveus Blochwitz Aspergillus ochraceus K. Wilh. Aspergillus parasiticus Speare Aspergillus sclerotiorum Huber Aspergillus stromatoides Raper & Fennell. Aspergillus sydowii (Bain. & Sart.) Thom & Church Aspergillus terreus Thom Aspergillus variecolor Thom & Raper Aspergillus versicolor (Vuill.)Tiraboschi Lipase activity 99.08 117.37 197.44 74.33 163.25 90.91 106.27 112.88 84.71 115.57 128.73 110.00 154.21 128.28 94.90 81.89 95.47 143.33 a Access number in the Micoteca URM culture collections (Recife, Pernambuco, Brazil). et al. (2014), evaluated lipase production by an Aspergillus strain, by using wheat bran, soybean meal and soybean meal with sugarcane bagasse as substrate, through SSF. The authors observed lipase activity of -1 67.5, 58 and 57.3 U gds for each substrate, respectively. Compared to the present study, A. candidus -1 URM 5611 showed higher lipase activity (197.44 U gds ). Such microorganism is preserved in a Culture Collection of reference in Brazil (Micoteca URM Culture Collection (WDCM604), and it was duly identified. The fungi from genus Aspergillus are widely used in enzyme production. The lipase production by Aspergillus species has been widely reported, mainly because this enzyme is usually extracellular. Lipase (EC 3.1.1.3) (triacylglycerol lipase) also called triacylglycerol acylhydrolase, catalyzes the hydrolysis of ester bonds from oils and fats and may act in synthesis reactions (esterification, interesterification, alcoholysis, acidolysis and aminolysis) (Sharma et al., 2001). These reactions have the advantage of giving biotechnological potential to enzymes, such as stability in organic solvents, and no requirement for cofactors broad specificity (Azeredo et al., 2007). In the present study, A. candidus URM 5611 proved to be a major lipase producer, and it was selected for enzymatic optimization and characterization. This is the first report on lipase production by an isolate from this species. Effects of the variables on lipase production A. candidus URM 5611 presented efficient lipolytic activity (LA) when olive oil is used as inductor, but in the absence of this oil, there was an increase in production with higher activity. Therefore, it was selected to a study on the effect of independent variables such as temperature, pH, moisture, and induce lipase production in solid state fermentation for 48 h (Table 3). The maximum lipase activity produced by A. candidus URM 5611 was 397.158 -1 U gds in run 3 as follows: 48 h of fermentation using 0% olive oil at pH 5.5, 75% moisture at 25°C. When -1 compared with the initial screening (197.44 U gds ), after production optimization, A. candidus URM 5611 had its lipase production increased by 200%. This value (397.15 -1 U gds ) was higher than that reported in the literature so far. For example, Kempka et al. (2008) tested a strain of Penicillium verrucosum by using soybean meal as substrate at 27.5°C with moisture of 55% and an activity -1 of 40 U gds within 48 h of fermentation. Ul-Haq and -1 Idress Rajoka (2002) found 48 U gds activity by the fungus Rhizopus oligosporus by using almond cake as substrate at 30°C for 72 h. However, it is less than the lipase activity obtained by Mala et al. (2007) who evaluated the lipase production by A. niger at 30°C, 62% moisture using wheat bran and sesame cake as -1 substrates, and obtained 384 U gds at 72 h of fermentation. Thus, A. candidus 5611 URM showed to be most promising for lipase production under SSF at high levels. The Pareto chart shows the estimated effects of the variables (main effect or first-order) and the interactions between variables (second order effect) on the response variables (biomass and lipase activity), in order of magnitude. The length of the bars is proportional 824 Afr. J. Biotechnol. Table 3. Experimental design results for lipase production under SSF fermentation by Aspergillus candidus URM 5611. Run 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Experimental variables Temperature (°C) Initial moisture (%) 25 45 40 45 25 75 40 75 25 45 40 45 25 75 40 75 25 45 40 45 25 75 40 75 25 45 40 45 25 75 40 75 32.5 60 32.5 60 32.5 60 32.5 60 Inductor (%) 0 0 0 0 3 3 3 3 0 0 0 0 3 3 3 3 1.5 1.5 1.5 1.5 to the standardized variable effect. The vertical line can be used to determine that the effects were statistically significant, because the bars that extend through this line correspond to statistically significant effects with confidence level of 95% (Porto et al., 2008). The effects have been demonstrated in these variables, as well as the interactions between them (Figure 1). It was observed that, at 48 h of fermentation, the humidity showed a positive effect, whereas the oil showed a negative effect, which means that higher moisture levels and lower inductor are better for lipase production. The other variables showed no effect on lipase production. Fermentation using only licuri almond meal, without the addition of olive oil and the accretion of moisture are sufficient to get a good lipase production by A. candidus URM 5611. This result can be explained due to high lipid content in the substrate composition (49.2 + 0.08; Source: Crepaldi et al (2001), which suggested the occurrence of inhibition by excess substrate. Lipids generally lead to increased lipase production (Mahadik et al., 2002; Dominguez et al., 2003). However, in the current study, the increased lipid source seems to have had an inhibitory effect on enzyme production. A similar situation was observed by Vargas (2008) who evaluated lipase production by Penicillium simplicissimum and found that the addition of oil to the different soybean cakes used as substrate resulted in a decreased lipase production. This fact suggested the occurrence of inhibition by excess substrate. As the amount of water is pH 5.5 5.5 5.5 5.5 5.5 5.5 5.5 5.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 6.5 6.5 6.5 6.5 Total activity (U gds 48 h 72 h 77.66 39.55 73.90 35.44 397.15 153.15 112.71 38.04 45.78 20.53 45.03 21.56 90.73 34.33 77.04 32.16 71.33 26.63 79.38 27.61 87.92 51.14 395.10 150.10 45.75 21.17 54.21 20.03 85.36 39.14 85.95 35.08 67.17 38.75 74.92 34.99 76.61 46.85 86.81 42.67 -1 ) 96 h 25.55 31.83 62.18 43.20 20.46 18.94 34.61 27.15 24.32 26.93 46.52 60.18 19.59 23.13 30.78 31.69 37.10 33.53 43.68 43.31 always limited, controlling the level of moisture is essential to process optimization in the solid state. The water content suitable for the substrate must enable the formation of a water film on the surface in order to facilitate dissolution and transfer of nutrients and oxygen. However, the spaces among the particles must remain free to allow oxygen diffusion and heat dissipation (Gervais and Molin, 2003; Sanchez, 2009). The moisture, at very low levels, impairs the transport of nutrients and toxins through the membrane and it can cause the loss of functional properties of cellular metabolic chain enzymes (Gervais and Molin, 2003). According to Mahanta et al. (2008), water content is a significant factor in substrate physical properties. High water content leads to decrease on substrate porosity, there by decreasing gas exchange. Moreover, low water content may result in reduction of microbial growth and in consequent decreased enzyme production. Initially, Dantas and Aquino (2010) evaluated the influence of water content between 35 and 65% on several substrates (castor cake, babassu pie, pumpkin seeds, avocado peel and coffee grounds) in lipase production by A. niger under SSF. Higher production of lipase (24.6 U/g) was obtained when babassu pie was used as carbon source with water content of 45%. This relationship can be better understood by observing the plot square (Figure 2). It can be seen that the highest effect values are at the base, and they correspond to moisture, but this effect is opposite in relation to inductor concentrations. The best Farias et al. 825 Figure 1. Pareto chart of interaction effects on the response of lipase activity produced by Aspergillus candidus URM 5611 after 48 h of cultivation. conditions for enzymes production with lipolytic activity can be obtained without added inductor and increased moisture in the fermentation medium. By analyzing the fermentation costs, the current result is very interesting when a process on an industrial scale is designed. It is more advantageous to the industry to produce lipolytic enzymes using low cost substrates. Enzyme characterization pH effect on lipase activity and stability As for the characterization of lipase produced by A. candidus URM 5611, the crude enzyme extract was chosen as the best condition for enzyme production (Table 3, Run 03). The highest lipase activity was obtained at pH 2.5. The lipase from A. candidus URM 5611 was stable at pH range from 2.5 to 9.0 with activity values above 65% for 180 min. The maximum stability was observed at pH 7.4 with 79% residual activity. These results show that lipase is stable over a wide pH range. Figure 3 shows the formation of two peaks, possibly due to the presence of isoenzymes. Therefore, there is a need for further studies on the purification of this enzyme. Mahadik et al. (2002) observed that lipases produced by A. niger NCIM 1207 had maximal activity at pH 2.5, and Falony et al. (2006) demonstrated lipase stability at a pH range of 2.0 to 10.0 for A. niger, thus corroborating the results from the current study. Moreover, Pera et al. (2006) reported that the optimum pH activity of A. niger is of approximately 6.0. Ângelo et al. (2014) characterized the lipase produced by Fusarium oxysporum, and found increased lipolytic activity at pH 8.5. The enzyme was stable at pH range from 5.5 to 6.5, and showed low stability at pH 8.5. It is known that lipases have isoforms, depending on the origin of the enzyme. Furthermore, assay conditions, incubation team, pH, temperature, substrate and the used methodology can directly affect enzymes kinetic properties and stability (Carvalho et al., 2005). Effect of temperature on activity and stability The effect of temperature on lipase activity demonstrated that the maximum relative activity was obtained at 65°C, for 180 min. The enzyme was most stable at 60 and 65°C with 120% residual activity, for 180 min. These results show that the lipase is stable over a wide temperature range. Maia et al. (2001) evaluated the optimum temperature of lipase from Fusarium solani and found it at 35°C. Pastore et al. (2003) studied the characteristics of the lipase produced by a strain of Rhizopus, and found the optimum temperature of 40°C. Saxena et al. (2003) reported that the optimum temperature of lipase from A. 826 Afr. J. Biotechnol. Figure 2. Square of the variables (inductor and moisture) as the response variable under lipolytic activity. Figure 3. Effect ( ) and stability ( ) of lipase residual activity (%) on pH in SSF produced by Aspergillus candidus URM 5611 after 180 min of incubation with initial pH ranging from 2.5 to 9.0. carneus was 37°C, thus differing from the results obtained in the current study, since the optimum temperature for the activity of lipase produced by A. candidus was of 65°C. Carvalho et al. (2005) evaluated kinetic properties of the lipase by Geotrichum candindum in crude extract, and found that the enzyme was stable up to 50°C. Ângelo et al. (2014) evaluated the temperature effect on the activity of lipase from F. oxysporum, and found the optimum temperature of 40°C. In view of the stability results obtained at different temperatures for the lipase produced by solid state fermentation of A. candidus URM 5611, there were thermo- Farias et al. stable lipases when it is incubated for 180 min at temperatures between 30 to 80°C in constant pH of 2.5. Thermostability is important for the application of lipase in the detergent industry. Thermostable lipases have been isolated from many sources, including Mucor pusillus, Rhizopus and Aspergillus terreus (Singh and Mukhopadhyay, 2012). A more stable lipase alone has maximum activity at 60°C and it loses at least 90% of its activity after 15 min at 60°C (Said and Pietro, 2004). Conflict of interests The authors did not declare any conflict of interest. ACKNOWLEDGEMENTS The authors acknowledge FACEPE IBPG-0086-2.03/08, FINEP ref. 2083/07, FACEPE APQ-0483-2.12/10 and CNPq 552410/2005-5. The authors also gratefully acknowledge the COOPERLIC, the Micoteca URM, of the Mycology Department at UFPE, Brazil. REFERENCES Alberton D, Mitchell DA, Cordova J, Peralta-Zamora P, Krieger N. (2010). Production of a Fermented Solid Containing Lipases of Rhizopus microsporus and Its Application in the Pre-Hydrolysis of a High-Fat Dairy Wasterwater. Food Technol. Biotechnol. 48 (1): 28-35. Ali S, Ren S, Huang Z (2014). Extracellular lipase of an entomopathogenic fungus effecting larvae of a scale insect. J. Basic Microbiol. 54:1-12. Ângelo T, Silva RRS, Cabral, H (2014). Concomitant production of peptidases and lipases by fungus using agroindustrial residue in solid-state fermentation. Int. J. Curr. Microbiol. App. Sci. 3(5):810823. AOAC Internation (2003). Official Methods of Analysis of AOAC International.17th edition. 2nd revision.Gaithersburg, MD, USA, Association of Analitycal Communities. Azeredo LAI, Gomes PM, Sant’anna JrGL, Castilho LR, Freire DMG (2007). Production and regulation of lipase activity from Penicillium restrictum in submerged and solid-state fermentations. Curr. Microbiol. 54(5):361-365. Barros M, Fleuri LF, Macedo GA (2010). Seed lipases: Sources, applications and properties – A review. Braz. J. Chem. Eng. 27(1):1529. Bruns RE, Scarminio IS, Neto BB (2006). Statistical DesignChemometrics, 1st ed., Amsterdam: Elsevier, 422 p. Carvalho PO, Calafatti AS, Marassi M, Silva DM, Contesini FJ, Bizaco R (2005). Potencial de biocatálise enantiosseletiva de lipases microbianas. Quím. Nova. 28(4):614-621. Casciatori FP, Laurentino CL, Taboga SR, Casciatori PA, Thoméo JC (2014). Structural properties of beds packed with agro-industrial solid by-products applicable for solid-state fermentation: Experimental data and effects on process performance. Chem. Engin. J. 255:214-224. Castiglioni GL, Bertolin TE, Costa JAV (2009). Produção de biossurfactnte por Aspergillus fumigatus utilizando resíduos agroindustriais como substrato. Quím. Nova 32(2):292-295. Contesini FJ, Lopes DB, Macedo GA, Nascimento MG, Carvalho PO (2010). Aspergillus sp. lipase: potential biocatalyst for industrial use. J. Mol. Catal. B: Enzymatic, 67: 163-171.Crepaldi IC, AlmeidaMuradian LB de, Rios MDG, Penteado M de VC, Salatino A (2001). Composição nutricional do fruto de licuri (Syagrus coronata (Martius) Beccari) Rer. bras. Bot. SP, 24 (2). Dantas EM, Aquino LCL (2010). Fermentação em Estado Sólido de diferentes resíduos para a obtenção de Lipase Microbiana. Ver. Bras. Prod. Agroin. Campina Grande 12(1):81-87. 827 Dominguez A, Costas M, Longo MA, Sanroman A (2003). A novel application of solid state culture: production of lipases by Yarrowia lipolytica. Biotechnol. Lett. 25:1225-1229. Falony G, Armas JC, Mendoza JCD, Hernández JLM (2006). Production of A. niger Lipase, Food Technol. Biotechnol. 44 (2):235240. Gervais P, Molin P (2003). The role of water in solid-state fermentation. Biochem. Eng. J. 13:85-101. Fleuri LF, Novelli PK, Delgado CHO, Pivetta MR, Pereira MS, Arcuri M de LC, Capoville BL (2014). Biochemical characterisation and application of lipases producedby Aspergillus sp. on solid-state fermentation using three substrates. Int. J. Food Sci. Technol. 49(12):2585-2591. Ghasemi Y, Rasoul-Amini S, Kazemi A, Zarrini G, Morowvat M H, Kargar M (2011). Isolation and characterization of some moderately halophilic bacteria with lipase activity. Microbiol. 80(4):483-487. Hawksworth DL, Crous PW, Redhead AS, Reynolds DR, Samson RA, Seifert KA, Taylor JW, Wingfield MJ (2011). The Amsterdam declaration on fungal nomenclature. IMA Fung. 2(105): 112. Holker U, Lenz J (2005). Solid-state fermentation – are there any biotechnological advantages? Curr. Opin. Microbiol. 8(3): 301-306. Kempka AP, Lipke NL, Pinheiro TLF, Menocin S, Treichel H, Freire DMG, Di Luccio M, Oliveira D (2008). Response surface method to optimize the production and characterization of lipase from Penicillium verrucosum in solid-state fermentation. Bioprocess Biosyst. Eng. 31(2): 119-125. Kotogán A, Németh B, Vágvölgyi C, Papp T, Takó M (2014). Screening for extracellular lipase enzymes with transesterification capacity in mucoromycotina strains lipolytic activity of mucoromycotina strains, Food Technol. Biotechnol. 52(1):73-82. Leal MCMR, Cammarota MC, Freire DMG, Sant`anna Jr GL (2002). Hydrolytic enzymes as coajuvants in the anaerobic treatment of dairy wastewaters. Braz. J. Chem. Eng. 19:175-180. Liu C, Huanng LC, Chang CT, Sung HY (2006). Purification and characterization of soluble invertases from suspension-cultured bamboo (Bambusa edulis) cells. Food Chem. 96: 621-631. Mahadik ND, Puntambekar US, Bastawde KB, Khire JM, Gokhale DV (2002). Production of acidic lipase by Aspergillus niger in solid state fermentation. Process Biochnol. 38:715-721. Mahanta N, Gupta A, Khare SK (2008). Production of protease and lipase by solvent tolerant Pseudomonas aeruginosa PseA in solidstate fermentation using Jatropha curcas seed cake as substrate. Bioresour. Technol. 99: 1729-1735. Mala JGS, Edwinoliver NG, Kamini NR, Puvanakrishnan R (2007). Mixed substrate solid state fermentation for production and extraction of lipase from Aspergillus niger MTCC 2594. J. Gen. Appl. Microbiol. 53(4): 247-253. Maia MMD, Heasley A, Camargo de Morais MM, Melo EHM, Morais JrMA, Ledingham WM, Lima Filho JL (2001). Effect of culture conditions on lipase production by Fusarium solani in batch fermentation. Bioresour. Technol. 76:23-27. Micoteca. Histórico. (2014). Disponível em: < http://www.ufpe.br/micoteca/historico.html>. Acesso em: 01/11/2014. Mostafa H, El-Hadi AA (2010). Immobilization of Mucor racemosus NRRL 3631 lipase with different polymer carriers produced by radiation polymerization. Malayas J. Microbiol. 6(2):149-155. Palma MB, Pinto AL, Gombert AK, Seitz KH, Kivatinitz SC, Castilho LR, Freire DMG (2000). Lipase production by Penicillium restrictum using solid waste of industrial babassu oil production as substrate. Appl. Biochem. Biotechnol. 84-86:1137-1145. Pastore GM, Costa VSR, Koblitz MGB (2003). Purificação parcial e caracterização bioquímica de lipases extracelular produzida por nova linhagem de Rhizopus sp. Ciênc. Tecnol. Aliment. 23(2):135-140. Pera LM, Romero CM, Baigori MD, Castro GR (2006). Lipase extracts from A. niger, Food Technol. Biotechnol. 44(2):247-252. Porto TS, Medeiros e Silva GM, Porto CS, Cavalcanti MTH, Neto BB, Lima-Filho JL, Converti A, Porto ALF, Pessoa Jr A (2008). Liquid– liquid extraction of proteases from fermented broth by PEG/citrate aqueous two-phase system. Chem. Eng. Process. 47:716-721. Ramachandran S, Singh SK, Larroche C, Soccol CR, Pandey A (2007). Oil cakes and their biotechnological applications - A review. Bioresour. 828 Afr. J. Biotechnol. Technol. 98(10):2000-2009. Reinehra CO, Rizzardia J, Silva MF, Oliveira D, Treichel H, Colla, LA (2014). Produção de lipases de Aspergillus niger e Aspergillus fumigatus através de fermentação em estado sólido, avaliação da especificidade do substrato e seu uso em reações de esterificação e alcoólise. Quim. Nova. 37(3):454-460. Reis P, Holmberg K, Watzke H, Leser ME, Miller R (2009). Lipases at interfaces: A review. Adv. Colloid Interface Sci. 147-148:237-250. Sabu A, Kiran GS, Pandey A (2005). Purification and characterization of tannin acyl hydrolase from Aspergillus niger ATCC 16620. Food Technol. Biotechnol. 43(2):133-138. Said S, Pietro RCLR (2004). Enzimas como agentes biotecnológicos. Ribeirão Preto: Editora Legis Summa. p. 412. Sanchez C (2009). Lignocellulosic residues: biodegradation and bioconversion by fungi. Biotechnol. Adv. 27(2):185-94. Saxena RK, Davidson WS, Sheoran A, Giri B (2003). Purification and characterization of an alkaline thermostable lipase from Aspergilluscarneus. Process Biochem. 39:239-247. Sharma R, Chisti Y, Banerjee UC (2001). Production, purification, characterization, and applications of lipases. Biotechnol. Adv. 19:627662. Singh AK, Mukhopadhyay M (2012). Overview of fungal lipase: A review. Appl. Biochem. Biotecnol. 166:486-520. Statsoft, inc. Statistica (data analysis software system), version 6 (2001). (Software estatístico). Tan T, Zhang M, Xu J, Zhang J (2004). Optimization of culture conditions and properties of lipase from Penicillium camembertii Thom PG-3. Proc. Biochem. 39: 1495-1502. Treichel H, Oliveira D, Mazutti MA, Luccio MD, Oliveira JV (2010). A review on microbial lipases production. Food Bioprocess Technol. 3: 182-196. Ul-Haq I, Idress S, Rajoka MI (2002). Production of lipases by Rhizopus oligosporus by solid-state fermentation. Process Biochem. 37: 637641. Watanabe N, Ota Y, Minoda Y, Yamada K (1977). Isolation and identification of alkaline lipases producing microorganismos, cultural conditions and some properties. Agric. Biol. Chem. 41:1353-1348. Vol. 14(9), pp. 829-834, 4 March, 2015 DOI: 10.5897/AJB2014.14347 Article Number: 760435A50965 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper Effects of cashew nut shell liquid (CNSL) component upon Aedes aegypti Lin. (Diptera: Culicidae) larvae’s midgut Ajit Kumar Passari1, Vineet Kumar Mishra1, Vijai Kumar Gupta2 and Bhim Pratap Singh1* 1 Molecular Microbiology and Systematics Laboratory, Department of Biotechnology, Aizawl, Mizoram University, Mizoram 796004 India. 2 Molecular Glyco-Biotechnology Group, Department of Biochemistry, National University of Ireland Galway, Galway, Ireland. Received 29 November, 2014; Accepted 23 February, 2015 The cashew nut shell liquid (CNSL) has been associated with a number of biological activities. The aim of this study was to evaluate the insecticidal potential caused by CNSL from Anacardium occidentalle L. (Anacardiaceae) upon Aedes aegypti and verify histomorphological alterations in the larval midgut. The experiments were carried out using third instar A. aegypti larvae, exposed to CNSL at different concentrations. After 24 h, the larvae were treated and stained with hematoxylin-eosin (HE). Morphometric analyzes were performed on the A. aegypti larvae midgut and registered by photomicroscopy. Anacardic acid was identified in CNSL by high performance liquid chromatography (HPLC) and showed 69% purity. The minimum concentration of CNSL that promoted mortality of A. -1 -1 -1 aegypti larvae (LC10) was 0.01 mg mL ; the LC90 was 0.139 mg mL and the LC50 was 0.07 mg mL . Changes in the midgut were severe in larvae treated with CNSL, especially at concentrations of 1.0 to -1 0.01 mg mL ; degeneration of the lining, hypersecretion of epithelial cells, increased vacuoles, and separation of the epithelial cells from the basal membrane, and disintegration of the brush border and rd damage of the peritrophic membrane occurred. CNSL caused damage to the midgut of 3 instars of A. aegypti by irreversibly disrupting their complete larval development. Key words: Dengue fever, bioinsecticids from plants, morfology of midgut. INTRODUCTION Aedes aegypti (Lin, 1762) is the vector mosquito that has the highest current dispersion in urban areas over the world and the medical importance of its vectorial capacity is to disseminate four serotypes of dengue virus as well *Corresponding author. E-mail: douradod@uol.com.br. Tel: (67) 9643-1980. Abbreviations: CNSL, Cashew nut shell liquid; HE, hematoxylin-eosin; HPLC, High performance liquid chromatography; BOD, biological oxygen demand; LD, lethal doses. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License 830 Afr. J. Biotechnol. as yellow fever. The insect’s diurnal haematophagic activity, the synanthropic behavior and anthropophilic habits associated with the physical complexity of urban centers have hampered its combat (Bessera et al., 2009). Each year infections with dengue virus are estimated to be responsible for more than 100 million of classic cases and more than 500 thousand cases of dengue hemorrhagic fever worldwide (Halstead et al., 2007). In Brazil Dengue fever has reached about 3 million cases since 1986. The states with the highest incidence were Acre (3619.5 cases per 100 000 inhabitants), Mato Grosso do Sul (2,521.1 cases per 100 000 inhabitants), Goiás (1353.1 cases per 100 000 inhabitants), Rondônia (1256.4 cases per 100 000 inhabitants), Roraima (1146.9 cases per 100 000 inhabitants) and Mato Grosso (1,095.5 cases per 100 000 inhabitants). These six states account for 75% of cases in Brazil (Oliveira et al., 2011). Synthetic insecticides, such as pyrethroids and organophosphates, are commonly used to control mosquitoes, but this application exposes operators and environments. It also leads to the development of mosquito resistance to the compounds (Rodriguez et al., 2007). Chemical control with organophosphates was shown to be inefficient in fighting the mosquito, and among the organophosphates, temephos was reported as Aedes-resistant by Melo-Santos et al. (2010). The search for new substances such as those extracted from plants has received special attention for natural molecules. Complex extracts certainly reduces the risk of resistance and the environmental toxicity (Wandscheer et al., 2004). According to Phukerd and Soonwera (2013), the use of plants and active molecules like proteins or secondary metabolites could act against insect defense mechanisms, causing them harm by inhibiting the digestive process and/or altering their metabolisms. Species from the botanical family Anacardiaceae, in special genus Anacardium, are currently being investigated for this purpose. Furthermore, Anacardium occidentale L. (cashew tree) stood out among the 11 species under investigation in recent years, certainly due to its high composition of phenolic lipids with antioxidant, antigenotoxic, cytostatic (Stasiuk and Kozubel, 2010) and insecticide activities (Asogwa et al., 2007), among others. These compounds, namely anacardic acids, constitute about 90% of the cashew nut shell liquid (CNSL) and is the main industrial and manufactured byproduct of this resinous plant (Mazzetto et al., 2009). A significant number of biological activities is credited to this acid, among them is the insecticidal effect on A. aegypti (Laurens et al., 1997; Lomonaco et al., 2009; Mukhopadhyay et al., 2010; Oliveira et al., 2011). The aim of this study was to evaluate the insecticidal potential of anacardic acid, a CNSL component from A. occidentalle L. (Anacardiaceae), upon A. aegypti and verify the histomorphological alterations in the larval midgut. MATERIALS AND METHODS Source of plant material The CNSL was provided by Kardol Chemical Industry, Campo Grande, Mato Grosso do Sul - Brazil, from the endocarp of the A. occidentale. The extraction of LCC is occurred with company standard and patented methodology. High performance liquid chromatography (HPLC) The CNSL was further submitted to HPLC (Varian 210, Diode Arrangement Detector) and software Star WS (workstation) was used. The columns used were reverse phase C-18 (Phenomenex) and the pre-column C-18. The elution process was carried out with a graded program of solvent A: acetonitrile/water/acetic acid; and B: 100% of tetrahydrofurane. The pump flow rate was 1 mL min -1 and 20 μL were injected (22°C). Identification of the compound with the aid of DAD detector scanning in the spectral range of 200 to 800 nm did not reveal interferences in retention time of the sample in HPLC by the developed elution method. Standard was easily identified and quantified based on their absorption spectra in the UV region and in retention time. Standard found in extracts were unambiguously identified by performing co-injection experiments in which aliquots of the extract and standard were mixed and diluted to a known volume, and analyzed through HPLC. The content estimation of the anacardic acid (≥85%, Sigma Aldrich) in the CNSL was performed by external calibration. Bioassays The experiments were performed in the Laboratories of Entomology of Dom Bosco Catholic University (UCDB), Campo Grande, MS. Larvae of late 3rd and early 4th instar of A. aegypti were used in the tests, from mass rearing of eggs aged from two to three months after oviposition, obtained from successive generations in vitro maintained with blood meal for one hour and half every two alternate days in the presence of partial light and temperature between 25 and 30°C according to a validated method of Porto et al. (2013) for conditions established by the use of biological oxygen demand (BOD). In order to confirm, susceptibility tests were performed with concurrent positive control of Rotenone concentrations ranging from 0.005 to 0.020 mg mL-1. The larvicidal biotest was performed in quadruplicates using four different concentrations of CNSL: 1.0, 0.1, 0.01 and 0.001 mg mL-1, in batteries of tests at different times, because the product is only 69% of anacardic acid and a mixture of several minor components. Twenty-five larvae were exposed to each specimen in the test solutions (25 mL) for 24 h, this is an acute test; after this period, the number of dead insects and survivors through stimulation with Pasteur pipette was observed. Individuals that did not move after stimulation were considered dead. Concentrations with the highest mortality were submitted to calculate the concentrations of larvicide Lethal Doses (LD). Statistical analyses The results obtained were statistically analyzed by the Probit method (Mclaughlin et al., 1991), using software Leora® (Polo 9735947870655352). The following standard doses prior dilution 1:10 considering the highest and the lowest toxic dose and four doses between 0 and 100% effect were used. Then, parametric analysis was performed by the probit method, using a random Passari et al. 831 Figure 1. Lethal concentrations (mg mL-1) of different concentration of CNSL. variable associated with a cumulative probability of response between binary zero (0) and one (1). Once the calculation is set at X2 or chi-square where defines the occurrence of two different variables, and calculating to compare proportions by dispersing 90, 95 and 99% confidence. Histology The larvae were left standing in their respective concentrations for 24 h before further analysis was done at the darkened cephalic capsule at room temperature in formaldehyde (4%) for a period of 2 h. These samples were processed in increasing concentrations of ethanol and embedded in paraffin, sectioned at 5 μm and stained with hematoxylin-eosin (HE). The morphometric analyzes were performed in the midgut of the A. aegypti larval digestive system, and captured in photomicroscope by Samsung® video camera, coupled to microscope Bioval L2000C, using software IMAGELAB version 2.4. (Figure 2). Tests carried out with diluted CNSL caused -1 mortality of dilution from 0.01 to 0.1 mg mL , and the confidence interval for mortality is a significance level of P <0.05. Anacardic acids and derivatives have been reported in a number of works as having insecticidal action, particularly for A. aegypti (Lomonaco et al., 2009). The results of this study demonstrate that A. aegypti -1 larvae and pupae are highly susceptible to 0.012 mg mL CNSL. Larvae and pupae of Anopheles subpictus, -1 however, are susceptible to 0.038 mg mL Cardanol/CNSL solution (Mukhopadhyay et al., 2010). -1 The cardol (LC50 = 14.20 ± 0.62 mg mL ) and cardanol -1 (LC50 = 32.90 ± 0.2 mg mL ) obtained from CNLS showed activity for A. aegypti (Lomonaco et al., 2009). According to Oliveira et al. (2011), the three components of CNSL demonstrated good larvicidal activity against A. -1 aegypti (LC50 = 12.40 mg L for anacardic acid; 10.22 mg -1 -1 L for cardol; and 14.45 mg L for cardanol). RESULTS AND DISCUSSION Composition of the CNSL and calculation of lethal concentrations (LC) The product was provided by Kardol, in which HPLC analysis showed the presence of 69% of anacardic acid and the remainder as a pool of substances according to benchmark analysis. From the larval mortality curve 2 (Y=28.635ln(x) + 138.8, R = 0.9181) in relation to increasing concentrations of CNSL (Figure 1), the minimum concentration capable of producing mortality -1 (LD10) was 0.01 mg mL and the maximum concentra-1 tion of toxicity (LD90) was 0.13 mg mL . The LC50 was -1 calculated in the dilution range of about 0.07 mg mL Histological analyses The third instar A. aegypti larvae in the control group showed elongated and wormlike external appearance. The histological sections showed a normal morphology of stomodeum stomach and intestinal cecum (Figure 3AB). In the middle region of low cylindrical cells, acidophilic cytoplasm with variable areas, central spherical nucleus and clear nucleolus were seen. The brush border is thicker and marked (previous) and the peritrophic matrix (PM) is evident (Figure 3C). Morphological analysis in the treated group based on different concentrations of CNSL -1 showed concentration of 0.001 mg mL in three regions, 832 Afr. J. Biotechnol. Figure 2. Larvae without treatment (A) and subjected to exposure of larvae active CNSL (B), 40x magnification. Figure 3. Photomicrography of 3rd instar larvae Aedes aegypti digestive system tissue. Control group. A) longitudinal section of gastric cecum, cardia valve (cv), anterior midgut (am), middle midgut (mm), lumen (L). HE. 100X. B) Transversal section of gastric cecum, ingesta (i), brush border (arrows), HE. 400X. C) Longitudinal section of posterior midgut (pm) and its brush borders (arrows), HE. 400X. cell shedding in the midgut, food debris and fragmentation of MP. The changes were apparent in gastric cecum, such as loss of brush border, and the absence of material ingested by the larvae in the lumen (Figure 4A). In the middle midgut, lining cells were rounded, with lots of side crossings and scaling, with a decrease in brush border and profuse secretion in the lumen (Figure 4B). The epithelium hindgut cells completely lost the lateral junction of flooring and base, resulting in detachment of the cells to the lumen of the hindgut. The brush border was evidenced in these cells (Figure 4C). The transition zone between the anterior and medial regions were formed by throttling midgut with intestinal -1 obstruction at a concentration of 0.1 mg mL (Figure 5A); in the posterior region, the cells had elongated brush border. The deleterious changes included total or partial destruction of the lining cells, high vacuolization of the cytoplasm and increased subperitrophic space with accumulation of acidophilic materials (Figure 5C). The Culicidae midgut of the larvae comprises three regions (previous, middle and further) and is formed by a layer of epithelial cells lining integral supported by a cylindrical basement membrane. Like other insects, insect abdominal region, in addition to its digestive function, provides chemical defense function, mechanical protecttion and defense against pathogens (Roel et al., 2010). The first change caused by anacardic acid in A. aegypti larvae was related to movement, contrasting the control group that showed great mobility and locomotion in liquid medium. The larvae subjected to the highest concentrations of anacardic acid showed low resistance, lethargy and immobility, with an overall mortality after 24 h of exposure. By observing the tissue section, it was possible to detect the disconnection of cells lining the basement membrane and loss of intercellular junctions. Passari et al. 833 Figure 4. Photomicrography of 3rd instar Aedes aegypti larvae digestive system treated with Anacardium occidentale (Anacardic acid 0.01 mg mL-1. A) Transversal section of gastric caecum, nucleus (n), brush border (arrows), HE. 400X. B) Longitudinal section of middle midgut, endoperitrophic space (ep), ectoperitrophic space (ecs), cellular secretion (cs), HE. 200x. C) Longitudinal section of posterior midgut, brush border (arrows), desquamation cell (dc), HE. 400x. Figure 5. Photomicrography of Longitudinal sections from 3rd instar Aedes aegypti larvae digestive system treated with Anacardium occidentale - Anacardic acid 0.1 mg mL-1 (A, B) and 1.0 mg mL-1 (C). A) Strangulation between the anterior and middle midgut (arrow). HE. 200x. B) Stratification in the median midgut (est) desquamation cell (dc). HE. 400x. C) Degeneration of the median midgut (d), remnants of the peritrophic matrix (small arrow). 400x. HE. As for the mode of action of phenolic lipids against larvaer A. aegypti, few studies have clarified the toxicity mechanisms of these compounds in this organism. The deleterious changes caused by anacardic acid were observed in all three regions of the midgut of the larvae of A. aegypti and this activity may be related to the chemical structure of lipids phenolic. The aliphatic chain of anacardic acid provides a hydrophobic nature, which facilitates its permeation in the membrane of the cell wall of the larva (lipoprotein membrane), which flows through the apolar lipid bilayer of the group affecting the permeability of the cell and within groups polar (phenolic and carboxylic acid group) can act on the protein amino acid residues of the organisms disabling them, as can be observed in the changes described in Figures 3, 4 and 5, this substance affect primarily the midgut epithelium, and secondarily the gastric caeca and malpighian tubules, successfully described histopathological alterations showed that this substances affect primarily the midgut epithelium, and secondarily the gastric caeca and malpighian tubules. Successfully, described histopathological alterations after exposure of third-instar larvae of A. aegypti to LCC. Larval death was observed by Valotto et al. (2010), using catechin and tannin 0.037 -1 mg mL of Magonia pubescens on larvae of A. aegypti. High cytoplasmic vacuolization, absence of boundaries and formation of apical vesicles were seen. The epithelial cells showed stratified, irregular nucleus and vacuoles. Scudeler et al. (2014) define that the stratification and transformation of a simple columnar epithelium into a stratified epithelium, that is, new replacement of cell layers showed that a sophisticated defense may occur to replace the loss as a result of local lesions induced by cells acid. Costa et al. (2012), in studies on A. aegypti larvae exposed with methanolic extract of Annona coriacea (Magnoliales: Annonaceae), described serious histopathological changes, such as vacuolization of the cytoplasm, hypertrophy of epithelial cells and their nucleus, deterioration of the brush border, cell disintegration and apical vesicles formation that released 834 Afr. J. Biotechnol. their material in the intestinal lumen. In this work, we observed the same changes caused by anacardic acid, a phenolic lipid that constitutes the most of the liquid from the bark of the cashew nut. The changes described in this work are mainly caused due to a loss of control of the ionic balance and water intake that is commonly reported in treatments with oils, plant extracts and toxins (Scudeler et al., 2014). The loss of the cytoplasm due to the release of cytoplasmic protrusions may be indicative of a toxic effect of anacardic acid in the columnar cells. Conclusion The LCC from A. occidentalle caused changes in the midgut of A. aegypti larvae, triggering it irreversible damage. In the light of the changes caused by anacardic acid in the larvae, this product proved to be toxic and potentially able to act as a larvicide and lethal action for -1 90% of the population at a dose of 0.13 mg ml after 24 h exposure in vitro conditions. Conflict of interests The authors did not declare any conflict of interest. REFERENCES Asogwa EU, Mokwunye IU, Yahaya LE, Ajao AA (2007). Evaluation of Cashew nut Shell liquid (CNSL) as a potential natural insecticide against termites (Soldiers and Workers Castes). Res. J. Appl. Sci. 2(9):939-942. Bessera EB, Fernandes CRM, Silva SÃO, Santos JW (2009). Efeitos da temperatura no ciclo de vida, exigências térmicas e estimativas do aumento de gerações anuais de Aedes aegypti (Diptera: Culicidae). Iheringia Sér. Zool. 99 (2):142-148. Costa MS, Pinheiro DO, Serrão JE, Pereira MJB (2012). Morphological Changes in the Midgut of Aedes aegypti L. (Diptera: Culicidae) Larvae Following Exposure to an Annona coriacea (Magnoliales: Annonaceae) Extract. Neotrop. Entomol. 41:311-314. Halstead SB (2007). Dengue. Lancet 370:1644-1652. Laurens A, Fourneau C, Hocquemiller R, Cavé A, Bories C, Loiseau PM (1997). Antivectorial Activities of Cashew Nut Shell Extracts from Anacardium occidentale L. Phytother. Res. 11:145-146. Lomonaco D, Santiago GMP, Ferreira YS, Arriaga AMC, Mazzetto SE, Mele G, Vasapollo G (2009). Study of technical CNSL and its main components as new green larvicides. Green Chem. 11:31-33. Mazzetto SE, Lomonaco D, Mele G (2009). Óleo da castanha de caju: oportunidades e desafios no contexto do desenvolvimento e sustentabilidade industrial. Quim. Nova 32:732-741. Mclaughlin JL, Chang C, Smith DI (1991). Bench-top bioassays for the discovery of bioactive natural products: an update. In: ATTA-URRAHMAN (Ed.) Studies in Natural Products Chemistry. 9. Amsterdam: Elsevier Science Publishers B.V. pp. 383-409. Melo-Santos MAV, Varjal-Melo JJM, Araújo AP, Gomes TCS, Paiva MHS, Regis LN, Furtado AF, Magalhaes T, Macoris MLG, Andrighetti MTM, Ayres CFJ (2010). Resistance to the organophosphate temephos: Mechanisms, evolution and reversion in an Aedes aegypti laboratory strain from Brazil. Acta Trop. 113:180-189. Mukhopadhyay AK, Hati AK, Tamizharasu W, Babu PS (2010). Larvicidal properties of cashew nut shell liquid (Anacardium occidentale L) on immature stages of two mosquito species. J. Vector Borne Dis. 47: 257–260. Oliveira MSC, Morais SM, Magalhães DV, Batista WP, Vieira EGP, Craveiro AA, Manezes JESA, Carvalho AFU, Lima GPG (2011). Antioxidant, larvicidal and antiacetylcholinesterase activities of cashew nut shell liquid constituents. Acta Trop. 117: 165–170. Porto KRA, Roel AR, Machado AA, Cardoso CAL, Severino E, Oliveira JM (2013). Atividade inseticida do líquido da castanha de caju sobre larvas de Aedes aegypti L., (1762) (Diptera: Culicidae). Rev. Bras. Biocienc. 11(4):419-422. Roel AR, Dourado D, Matias RC, Porto KRA, Bednaski AV, Costa RBM (2010), The effect of Azadiracta indica oil on the midgut and the development of Spodoptera frugiperda. Revista Brasileira de Entomologia. Rev. Bras. Entomol. 54: 505 – 510. Scudeler EL, Padovani CR, Santos DC (2014). Effects of neem oil (Azadirachta indica A. Juss) on the replacement of the midgut epithelium in the lacewing Ceraeochrysa claveri during larval-pupal metamorphosis. Acta Histochem. 116:771-780. Stasiuk M, Kozubel A (2010). Biological activity of phenolic lipids. Cell Mol Life Sci 67: 841-860. Valotto CFB, Cavasin G, Silva HHG, Geris R, Silva IG (2010). Alterações morfo-histológicas em larvas de Aedes aegypti (Linna EUS, 1762) (Diptera, Culicidae) causadas pelo tanino catéquico isolado da planta do cerrado Magonia pubescens (Sapindaceae). Rev. Patol. Trop. 39: 309-321. Wandscheer CB, Duque JE, Silva MAN da, Fukuyama Y, Wohlke JL, Adelmann J, Fontana JD (2004). Larvicidal action of ethanolic extracts from fruit endocarps of Melia azedarach and Azadirachta indica against the dengue mosquito Aedes aegypti. Toxicon 44: 829835. Vol. 14(9), pp. 835-842, 4 March, 2015 DOI: 10.5897/AJB2015.14403 Article Number: BCB227050967 ISSN 1684-5315 Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB African Journal of Biotechnology Full Length Research Paper In vitro dilutions of thioridaxine with potential to enhance antibiotic sensitivity in a multidrug resistant Staphylococcus aureus uropathogen Otajevwo, F. D. Department of Microbiology and Biotechnology, Western Delta University, Oghara, Delta State, Nigeria. Received 3 January, 2015; Accepted 19 February, 2015 This research effort seeks to use doses of thioridaxine to enhance antibiotic sensitivity in a multidrug resistant (MDR) Staphylococcus aureus strain. Five axenic (pure) strains of S. aureus coded SA1 to SA5 were obtained from five infected midstream urine samples, inoculated on sterile cystine lactose electrolyte deficient (CLED) agar and stocked on sterile nutrient agar slants at 4°C in a refrigerator. Bacteria strains were sub-cultured on fresh sterile CLED agar and mannitol salt agar plates to confirm S. aureus strains. Gram staining, catalase test and coagulase test were done on the resulting colonies to further confirm the strains as S. aureus. Antibiotic susceptibility test was done by agar disc diffusion method using sterile Mueller- Hinton agar plates before and after treatment with laboratory dilutions of thioridaxine. S. aureus strains 1, 3 and 5 were multidrug resistant as they resisted 3 (37.5%), 3 (37.5%) and 4 (50.0%) of the antibiotics used. The highest (11.8±1.4 mm) and least (0.8±10.0 mm) zones of inhibition by all five strains were recorded for streptomycin and augmentin, respectively whereas, all five uropathogen strains resisted cloxacillin, they were sensitive to gentamycin, cotrimoxazole, chloramphenicol and streptomycin. After treatment with 2000 to 2240 ug/ml laboratory dilutions of thioridaxine, ≤50.0% loss of resistance was recorded for each of all seven dilutions but only 2240 ug/ml dilution recorded mean±S.E. loss of 56.2±17.8% for gentamycin, cotrimoxazole and streptomycin after treatment of SA5 uropathogen. This was followed by resistance losses of 41.4±10.8 and 42.7±8.3% induced by 2080 and 2200 ug/ml dilutions, respectively. Cumulative effect of all dilutions resulted in 40.0±8.2 and 40.5±17.1% borderline resistance losses to cotrimoxazole and chloramphenicol, respectively. Minimum inhibitory concentration of chloramphenicol was lowered by 2080, 2160 and 2240 ug/ml dilutions of thioridazine by four-fold (7.5 ug), four-fold (7.5 ug) and two-fold (15 ug), respectively. Upon this, the medical/chemotherapeutic implications of these findings are discussed. Key words: In vitro, dilutions, thioridaxine, enhance, antibiotic, sensitivity, multidrug resistant Staphylococcus aureus. INTRODUCTION Antibiotics resistance is not a new phenomenon. However, the current magnitude and speed with which it is developing is a cause for global concern (Namita et al., 2012). According to WHO (2012), antimicrobial resistance is on the rise in Europe and all over the world with gradual loss of first line antimicrobials. Epidemiological studies have suggested that antibiotic resistance genes emerge in microbial populations within five years of the therapeutic introduction of an antibiotic (Chakrabarty et al., 1990). Hence, numerous classes of antimicrobial agents 836 Afr. J. Biotechnol. have become less effective as a result of the emergence of antimicrobial resistance often as a result of the selective pressure of their daily usage (Oskay et al., 2009). This selective pressure has been attributed to indiscriminate use of antibiotics, complex socio-economic behavioral antecedents and dissemination of drugs resistant pathogens in human medicine (Okeke et al., 1999). Moreover, the disappointing lack of new antimicrobial agents has led to overuse of existing ones thus leading to the emergence of multi-resistant pathogens (McGowan, 2006). Therefore, as the proliferation of multidrug resistant pathogens continue unavoidably within and around us, it is important that their resistance trend be put under check through intensive research and antibiotic surveillance (Akortha and Filgona, 2009). The primary causes of antibiotic resistance in bacteria are mobile elements called plasmids and conjugative transposons. Plasmids are extra chromosomal DNA elements that have the capacity to replicate independently of the chromosome of the bacterial cell (Madigan et al., 2003). Resistance plasmids or R plasmids code for enzymes that can inactivate antibiotics, prevent the uptake of an antibiotic or pump out the particular antibiotic (Neu, 1989). Other causes of antibiotic resistance are efflux pumps, mutation, under dosage or use of drugs without prescription (Amaral et al., 2013). Plasmids carry genes some of which code for beta-lactamase or extended spectrum beta lactamase which can inactivate or degrade drugs thus rendering them ineffective (Amaral et al., 2013). Curing is the process of removing plasmids from a bacterial cell (Trevors, 1986). The resulting bacteria then become sensitive to the selective agent and it was initially thought that this phenomenon would proffer solution in controlling the development of antibiotic resistance in formerly antibiotic susceptible bacteria. DNA intercalating dyes (ethidium bromide), sodium dodecyl sulphate (SDS), antibiotics, thymine starvation and elevated temperatures have been used as curing agents (Chakrabarty et al., 1984; Gupta et al., 1980; Obaseki-Ebor, 1984; Reddy et al., 1986). Novobiocin, ethidium bromide, acriflavine, acridine orange, ascorbic acid and elevated temperatures have been used as curing agents (Ramesh et al., 2000). Physical treatments, chemical compounds and growth conditions may increase the frequency of elimination of drug resistant R-plasmids, resulting in sensitive cells that were previously resistant to antibiotics (Lakshmi et al., 1981). It has been reported that phenothiazines have the ability to control overexpression of efflux pump systems and thus are able to remove or reduce antibiotic resistance (Viveiros et al., 2010; Amaral et al., 2013). Mukherjee et al. (2012) reported the use of 1000 to 3000 ug/ml dilutions of a type of phenothiazine and an anti-psychotic drug called thioridaxine to cure a multidrug resistant strain of Pseudomonas aeruginosa. Multidrug resistance is now common among familiar pathogens such as Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, P. aeruginosa to mention but a few (Nabeela et al., 2004). The enormous genetic plasticity of the organism assists it to endlessly evolve resistance mechanisms against existing antimicrobial agents thus necessitating the need to control the spread of resistant Staphylococcal isolates in hospitals and health care settings (Gomber and Saxena, 2007). Seventy percent to 90% of S. aureus strains demonstrate resistance to the penicillins and aminopenicillins and hence, infections are often difficult to treat because of widespread cross-resistance to aminoglycosides, macrolides, lincosamides, tetracyclines, cephalosporins, carbapenems, beta-lactamase inhibitor combinations, trimethoprim and sulphonamides (Nichols, 1999). While, vancomycin is often regarded as the last line of defense against nosocomial and community based S. aureus infections (Bhalakia, 2008), resistance has been reported and there is a major concern that total antibiotic resistant strains may emerge in the immediate future (Diekema et al., 2001). Soonafter, the use of penicillin, S. aureus was found to produce penicillinase (beta-lactamase). To overcome this situation, the antibiotic-methicillin was used to replace penicillin and S. aureus strains resistant to methicillin emerged very quickly (Woo et al., 2003). This same pattern was also seen following the use of vancomycin. Treatments that increase frequency of elimination of plasmids will certainly enhance sensitivity (effectiveness) of antibiotics in situ. There is no published current work on use of laboratory dilutions of thioridaxine in the treatment (curing) of a multidrug resistant S. aureus uropathogen. The focus of this work therefore, was the use of laboratory dilutions of thioridaxine to enhance the antibiotic sensitivity of multidrug resistant S. aureus uropathogen with the following objectives: 1) Determine the antibiograms of five selected S. aureus pure culture strains obtained from cultures of midstream urine samples after 37°C incubation for 24 h with the aim of selecting a multi-antibiotic resistant strain; 2) determine the antibiotic susceptibility profiles of a selected MDR S aureus strain in terms of ≤50% resistance loss after treatment with laboratory dilutions of thioridaxine (that is, 2000 to 2240 ug/ml); 3) show a summary of data of ≤50% resistance loss by thioridaxine dilutions after treatment on E-mail: fesdotaj@yahoo.com, dafotaj@hotmail.com. Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Abbreviations: MDR, Multidrug resistant; CLED, cystine lactose electrolyte deficient; SDS, sodium dodecyl sulphate. Otajevwo the MDR S. aureus strain; 4) determine thioridaxine dilutions’ effect(s) on the minimum inhibitory concentration (MIC) of a selected antibiotic that recorded borderline loss of resistance (that is, between 45 to 49% as borderline to ≤ 50%). MATERIALS AND METHODS Sampling Five pure (axenic) isolates (strains) of S. aureus were obtained from 24 h CLED agar plate cultures with appropriate labeling. The agar plate medium used was one of several agar plates which had been inoculated with freshly voided midstream urine samples by a graduating student working on urinary tract infection in the Microbiology and Biotechnology laboratory of Western Delta University, Oghara. The status of the S. aureus isolates (strains) was re-confirmed by aseptically inoculating representative colonies on sterile Mannitol Salt agar plates. Inoculated plates were incubated aerobically at 37°C for 24 h. Gram reaction, biochemical and sugar fermentation tests by standard methods were then carried out to identify the resulting colonies (Cowan and Steel, 1993). Catalase positive, coagulase positive, bright yellow smooth gram positive cocci in clusters which were confirmatory of S. aureus were then stocked on sterile nutrient agar slants and kept at 4°C in the refrigerator after appropriate labeling for further use. The five bacterial uropathogens were then subjected to antibiotic sensitivity testing before treatment with laboratory dilutions of thioridaxine. Antibiotic sensitivity testing Antibiotic sensitivity testing was carried out on the pure culture colonies of the five S. aureus strains using the agar disc diffusion method on sterile Mueller-Hinton agar (MHA) plates (Bauer et al., 1966). A loopful of each colony of the uropathogens was picked aseptically using a flamed wire loop and placed in the centre of the sterile MHA plates. This was then spread all over the plates applying the caution of not touching the edges of the plates. The seeded plates were allowed to stand for about 2 min to allow the agar surface to dry. A pair of forceps was flamed and cooled and used to pick an antibiotic multidisc (Abitek, Liverpool) containing augmentin (30 ug), gentamicin (10 ug), erythromycin (5 ug), tetracycline (25 ug), cotrimoxazole (25 ug), cloxacillin (5 ug), chloramphenicol (30 ug) and streptomycin (10 ug). The discs were placed at least 22.0 mm from each other and 14.0 mm from the edge of the plates (Ochei and Kolkhatkar, 2008). Antibiotic discs were selected on the basis of their clinical importance and efficacy on various pathogenic strains of S. aureus. The seeded plates were allowed to stand for 10 min before incubation (Mbata, 2007). At the end of incubation, the diameters of the zones of inhibition from one edge to the opposite were measured to the nearest millimeter using a transparent ruler (Byron et al., 2003). Strains that showed resistance against three antibiotics and above were termed multiple drug resistant strains (Jan et al., 2004) and were noted and used further. Preparation of laboratory dilutions of thioridaxine Thioridaxine (a phenothiazine also known as 2-methylmercapto-10(2-N-methyl-2-piperidyl-ethyl phenothiazine) dilutions of 2000 to 2240 ug/ml were chosen based on the lethal Dose-50 (LD50) of 956 to 1034 mg/kg administered orally on rats as reported by Barth et al. (2006) and in line with a similar study carried out by Mukherjee et al. (2011). Laboratory thioridaxine dilutions of 2000, 2040, 2080, 837 2120, 2160, 2200 and 2240 ug/ml were therefore prepared using RV/O where stock or original concentration of thioridaxine used was 50 mg tablet (Southwood Pharmaceuticals, UK). The 50 mg tablet was originally dissolved in 10 ml sterile water to give 5 mg/ml which is equivalent to 5000 ug/ml. To obtain 2000 ug/ml dilution, 2 ml of stock or original drug (5000 ug/ml thioridaxine) was mixed or diluted with 3 ml sterile water. To obtain 2040 ug/ml dilution, 5.1 ml of stock was mixed with 7.4 ml of sterile water. A mixture of 5.2 ml of stock drug solution with 7.3 ml of sterile diluent resulted in a dilution of 2080 and 2120 ug/ml dilution was obtained by mixing 5.3 ml of original drug solution with 7.2 ml of diluent (sterile water). To obtain 2160 ug/ml dilution, 5.4 ml stock drug solution was mixed with 7.1 ml of diluent, while a mixture of 1.1 ml of stock with 1.4 ml of diluent gave a dilution of 2200 ug/ml. Lastly, 2240 ug/ml was obtained by mixing 5.6 ml of stock with 6.9 ml of diluent. Growing broth culture of MDR Staphylococcus aureus (SA5) The stock culture of SA5 was selected from among the initial five stocked strains. An inoculum of SA5 was aseptically picked from its slant stock culture using flamed and cooled wire loop and inoculated into 10 ml sterile Nutrient broth (LabM, UK). The inoculated broth was incubated at 37°C for 18 h. The resulting turbid broth culture was then diluted according to a modified method of Shirtliff et al. (2006). Using a sterile pipette, 0.1 ml of broth culture was mixed with 19.9 ml (1:200 dilution) of sterile Nutrient broth. This was properly mixed and was used as working inoculum and should contain 105 to 106 organisms and used within 30 min (Ochei and Kolhatkar, 2008). Treatment of SA5 uropathogen with prepared thioridaxine dilutions The treatment of MDR S. aureus strain 5 with the prepared thioridaxine dilutions was done according to a modified method by Byron et al. (2003). Using a sterile pasteur pipette, 0.5 ml aliquot of the diluted overnight broth culture of SA5 uropathogen was added to 4.5 ml sterile molten Nutrient agar (LabM, UK) and mixed. The various prepared dilutions (one at a time) of thioridaxine were then added in 0.5 ml volume. The set up for each dilution was then poured on top of sterile hardened or set 2% Nutrient agar plates and left to set. The same antibiotic multidiscs used before treatment were then picked (using flamed and cooled pair of forceps) and impregnated on the set agar overlay plates. Plates were incubated at 37°C for 24 h. Measurement of diameter of zones of inhibition was taken and recorded (NCCLS, 2000). Determination of effect of thioridaxine dilutions treatment on MIC of chloramphenicol Serial doubling dilutions of chloramphenicol (using its MIC of 30 ug as a basis) was carried out. Chloramphenicol was chosen for this assay because it showed a mean ± S.E resistance loss of 40.5 ± 17.1 across all the dilutions (Table 3) and 45% is a borderline of ≤50.0% which is the benchmark for the purpose of this study. The idea is that any thioridaxine dilution that can reduce the MIC may enhance its sensitivity and therefore, loss of resistance is likely to shore up from 45%. Sterile cotton wool plugged test tubes numbering 11 (eleven) were set up on a test tube rack and labeled 1 to 11. Using a sterile pipette, 1 ml of sterile nutrient broth was dispensed into tubes 2 to 7. Two milliliters of Nutrient broth was dispensed into tube 8 as Nutrient broth control. Tubes 2 to 7 were then labeled with chloramphenicol concentrations of 120, 60, 30, 15, 7.5, 3.75 and 1.88 ug/ml. A 250 mg capsule of chloramphenicol 838 Afr. J. Biotechnol. Table 1. Sensitivity Profiles of five Staphylococcus aureus strains before treatment with laboratory dilutions of thioridaxine after incubation at 37°C for 24 h. Strain code SA1 SA2 SA3 SA4 SA5 Mean±S.E GEN 7.0 5.0 11.0 7.0 8.0 7.6±2.1 ERY 5.0 0.0 6.0 5.0 0.0 3.2±4.0 CXC 0.0 0.0 0.0 0.0 0.0 0.0 Antibiotic zones of inhibition (mm) AUG COT CHL 0.0 9.0 5.0 4.0 8.0 6.0 0.0 5.0 4.0 0.0 6.0 7.0 0.0 5.0 6.0 0.8±10.0 6.6±1.5 5.6±0.8 TET 0.0 6.0 0.0 7.0 0.0 2.6±3.3 STR 10.0 10.0 13.0 12.0 14.0 11.8±1.4 GEN = Gentamicin; ERY = erythromycin; CXC = cloxacillin; AUG = augmentin; TET = tetracycline; CHL= chloramphenicol; COT = cotrimoxazole; STR = streptomycin; SA1- SA5 = Staph aureus strains 1 to 5. was dissolved in 10 ml of sterile water and diluted to 240 ug/ml using RV/O in a sterile 200 ml transparent bottle. From this 240 ug/ml chloramphenicol preparation, 2 ml volume was pipetted into tube 1. From tube 1, one milliliter was pipetted into tube 2 and mixed and 1.0 ml was pipetted into tube 3 and mixed. From tube 3, 1.0 ml was pipetted into tube 4. Finally, 1.0 ml was pipetted into tube 7, mixed and 1.0 ml was pipetted out and discarded. The diluted S. aureus inoculum was then dispensed in 0.5 ml volume into tubes 2 to 7. Into tube 10, two milliliters of the diluted broth culture was dispensed. Into tube 9, two milliliters of the 240 ug/ml chloramphenicol diluted drug was dispensed. The first dilution of thioridaxine (2000 ug/ml) was then added (in 0.5 ml volume) to each tube and the content of each tube was properly mixed. The set up was repeated for each of the other dilutions of thioridaxine. All tubes were incubated in a water bath at 37°C for 24 h. The MICs as affected by each thioridaxine dilution were read and recorded. RESULTS Table 1 shows the antibiotic susceptibility pattern of S. aureus strains 1-5 isolated from mid-stream urine samples of which their sensitivity responses to gentamicin, tetracycline, chloramphenicol, augmentin, erythromycin, cloxacillin, cotrimoxazole and streptomycin are shown. S. aureus strains 1 and 3 resisted three antibiotics each (cloxacillin, tetracycline and augmentin), SA2 strain resisted two drugs (erythromycin and cloxacillin) while SA4 resisted two antibiotics which were cloxacillin and augmentin. Only S. aureus strain 5 (SA5) resisted 4 (50.0%) antibiotics and these were erythromycin, cloxacillin, augmentin and tetracycline. The highest (11.8±1.4 mm) and least (0.8±10.0 mm) zones of inhibition by all five strains were recorded for streptomycin and augmentin, respectively. All the five S. aureus uropathogens resisted cloxacillin. Because S. aureus strain 5 resisted more than three antibiotics, it was considered a multidrug resistant uropathogen and was used further in the study. Table 2 shows the sensitivity profile of SA5 (S. aureus strain 5) after treatment with thioridaxine dilutions. The uropathogen was resistant to erythromycin, tetracycline, cloxacillin and augmentin. The uropathogen SA5 was sensitive to gentamicin, cotrimoxazole, chloramphenicol, and streptomycin with 8.0, 5.0, 6.0 and 14.0 mm zones of inhibition, respectively (Table 1). Table 2 also shows data of zones of inhibition of S. aureus strain 5 after treatment with laboratory dilutions of thioridaxine. Zones of inhibition before and after treatment were also mathematically computed to obtain ≤50.0% loss in resistance (that is, improvement in sensitivity). Treatment with 2000 ug/ml thioridaxine recorded a 60.0% loss of resistance to cotrimoxazole. Sensitivity improvement or resistance losses of 50.0 and 107.1% were recorded for chloramphenicol and streptomycin, respectively, after treatment with 2040 ug/ml dilution of the chemical agent. After 2080 ug/ml thioridaxine treatment, 80.0 and 85.7% resistance losses were recorded for cotrimoxazole and streptomycin, respectively. The same curing treatment resulted in a less than 20% resistance loss to gentamycin and chloramphenicol, respectively. Resistance loss of 150.0% was recorded for chloramphenicol after the uropathogen was treated with 2120 ug/ml dilution of thioridaxine whereas 80.0% loss of resistance was recorded for cotrimoxazole after 2160 ug/ml thioridaxine treatment. For the same treatment, less than 15.0% loss was recorded for streptomycin. After 2200 ug/ml treatment, 87.5 and 83.3% loss of resistance were recorded for gentamycin and chloramphenicol, respectively, while 20.0% and less than 10% losses were recorded for cotrimoxazole and streptomycin, respectively. Lastly, resistance losses of 87.5, 60.0 and 78.5% were recorded for gentamicin, cotrimoxazole and streptomycin, respectively, after 2240 ug/ml thioridaxine treatment. Table 3 is a summary of ≤50% loss of antibiotic resistance after 2000 to 2240 ug/ml treatment with thioridaxine laboratory dilutions. With regard to Table 1, only gentamicin, cotrimoxazole, chloramphenicol and streptomycin recorded ≤50% loss in resistance. Only thioridaxine dilution of 2240 ug/ml recorded mean ±S.E loss of resistance for all the four antibiotics of 56.2±17.8%. Less than 45, 45, 40, 40 and 30% loss of resistance were effected by 2200, 2080, 2040, 2120, 2160 and 2000 ug/ml laboratory dilutions of thioridaxine, respectively, for all four antibiotics. All the dilutions put together recorded mean ±S.E loss of resistance of Otajevwo 839 Table 2. Thioridaxine dilutions that induced ≤50.0% loss in resistance after treatment on multidrug resistant SA 5 uropathogen. Thioridaxine dilutions ug/ml 2000 Selected antibiotics (% improvements in sensitivity) Treatment GEN ERY CXC AUG COT 8.0 0.0 0.0 0.0 5.0 Before 8.0 0.0 0.0 0.0 8.0 After (60.0)* (0.0) (0.0) (0.0) (0.0) CHL 6.0 6.0 (0.0) TET 0.0 0.0 (0.0) STR 14.0 14.0 (0.0) 2040 Before After 8.0 8.0 (0.0) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 5.0 5.0 (0.0) 6.0 9.0 (50.0) 0.0 0.0 (0.0) 14.0 29.0 (107.1)* 2080 Before After 8.0 9.0 (12.5) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 5.0 9.0 (80.0)* 6.0 7.0 (16.7) 0.0 0.0 (0.0) 14.0 26.0 (85.7) * 2120 Before After 8.0 9.0 (12.5) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 5.0 5.0 (0.0) 6.0 15.0 (150.0)* 0.0 0.0 (0.0) 14.0 15.0 (7.1) 2160 Before After 8.0 8.0 (0.0) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 5.0 9.0 (80.0)* 6.0 6.0 (0.0) 0.0 0.0 (0.0) 14.0 16.0 (14.1) 2200 Before After 8.0 15.0 (87.5)* 0.0 0.0 (0.0) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 5.0 6.0 (20.0) 6.0 11.0 (83.3)* 0.0 0.0 (0.0) 14.0 15.0 (7.1) 2240 Before After 8.0 15.0 (87.5)* 0.0 0.0 (0.0) 0.0 0.0 (0.0) 0.0 0.0 (0.0) 5.0 8.0 (60.0)* 6.0 8.0 (33.3) 0.0 0.0 (0.0) 14.0 25.0 (78.5)* *The values indicate the antibiotics to which the bacterial inoculum recorded equal to or more than 50% reduction in resistance after treatment with the corresponding concentration or dilution of the curing agent-thioridaxine. Table 3. Summary of ≤50% loss of resistance as induced by thioridaxine dilutions’ treatment on MDR SA5 uropathogen. Thioridaxine dilutions ug/ml 2000 2040 2080 2120 2160 2200 2240 Mean±S.E Antibiotics whose resistance was reduced by ≤50.0% GEN (%) COT (%) CHL (%) STR (%) Mean±S.E 0.0 60.0 0.0 0.0 15.0±8.4 0.0 0.0 50.0 107.1 39.3±12.1 41.4±10.8* 50.0 80.0 0.0 85.7 0.0 0.0 150.0 0.0 37.5±3.5 0.0 80.0 0.0 0.0 20.0±11.1 42.7±8.3* 87.5 0.0 83.3 0.0 56.2±17.8* 87.5 60.0 0.0 78.5 25.0±14.3 40.0±8.2* 40.5±17.1* 38.8±16.6 *The values indicate the antibiotics to which the bacterial inoculum recorded equal to or more than 50% reduction in resistance after treatment with the corresponding concentration or dilution of the curing agentthioridaxine. 40.5±17.1, 40.0±8.2, 38.8±16.6 and 25.0±14.3% in that descending order for chloramphenicol, cotrimoxazole, streptomycin and gentamycin, respectively. This means chloramphenicol and cotrimoxazole recorded borderline loss of resistance as compared with the benchmark of ≤50%. Data on the effect of thioridaxine dilutions on the minimum inhibitory concentration (MIC) of chloramphenicol on the multidrug resistant S. aureus strain 5 uropathogen are shown in Table 4. At the end of 24 h incubation at 37°C of the experimental set up, inoculum control tubes for all thioridaxine dilutions (2000 to 2240 ug/ml) showed turbidity (cloudiness) as expected. As expected also, sterile broth control and drug control tubes remained clear at the end of incubation. Laboratory dilutions of 2000, 2040, 2120l and 2200 ug/ml did not affect the minimum inhibitory concentration (MIC) of chloramphenicol as the MIC remained 30 ug. Reductions in MIC of chloramphenicol were however effected by 2080, 2160 and 2240 ug/ml thioridaxine dilutions. Thioridaxine dilutions of 2080 ug/ml and 2160 ug/ml reduced chloramphenicol MIC to 7.5 ug each which is a four-fold 840 Afr. J. Biotechnol. Table 4. The effect of thioridaxine dilutions on the minimum inhibitory concentration (MIC) of chloramphenicol on multidrug resistant Staphylococcus aureus strain 5 uropathogen after 24 h incubation at 37°C. Serial dilutions of chloramphenicol (ug/ml) Thioridaxine dilutions (ug/ml) New MIC after thioridaxine treatment 120.0 60.0 30.0 15.0 7.50 3.75 1.88 Inoculum control 2000 2040 2080 2120 2160 2200 2240 No change No change 7.5 ug (4-fold) No change 7.5 ug (4-fold) No change 15 ug (2-fold) - - - + + + + - + + + + + + + + + + + + + + + + + + + + + + + + + + reduction, while 2240 ug/ml reduced the MIC to 15 ug (a two-fold reduction). DISCUSSION This study has the underlining intent of making suggestions aimed at reclaiming some common old and not too old drugs which are losing therapeutic usefulness owing to ineffectiveness in terms of therapeutic outcome. The alternative is to replace the old drugs with new ones but it will be counter-productive because such new drugs may be more costly, may be toxic (that is, may have more adverse side effects), their use may need much longer stay in the hospital (or longer duration of treatment) and their use may require treatment in intensive care units. Antibiotic susceptibility profiles of all five strains (uropathogens) of S. aureus before thioridaxine treatment in this study showed that the five uropathogen strains were sensitive to gentamicin, cotrimoxazole, chloramphenicol and streptomycin with mean± SE zones of inhibition of 7. 6 ± 2.1, 6.6 ± 1.5, 5.6 ± 0.8 and 11.8 ± 1.4 mm, respectively. The implication of this is that 4(50.0%) of the antibiotics recorded positive reactions at the end of incubation. Whereas, the five uropathogen strains were resistant to cloxacillin, strains SA1 and SA3 resisted three antibiotics each which were cloxacillin, tetracycline and augmentin. Strain SA2 resisted erythromycin and cloxacillin while SA4 resisted cloxacillin and augmentin. The fact that SA5 strain resisted more than three antibiotics (that is, erythromycin, cloxacillin, augmentin and tetracycline) qualifies it as a multidrug organism (Jan et al., 2004; Otajevwo, 2012). Strain SA5 was sensitive to gentamycin, cotrimoxazole, chloramphenicol and streptomycin. Findings suggest that infections or diseases caused by MDR S. aureus strain 5 in the study environment and perhaps in other environments can be treated successfully with gentamicin/cotrimoxazole/ chloramphenicol/streptomycin (that is, any one of the four) only or in synergistic combination a physician may consider safe and potent. The privilege of choosing any Sterile broth control - Drug control - of the four (except streptomycin perhaps) will be cheering to low income patients in terms of cost and availability. The almost total resistance recorded against augmentin is worrisome because it is a drug that is used to treat a good number of human diseases. Some authors have also expressed similar worry over augmentin in terms of antibiotic susceptibility (Oluremi et al., 2011; Otajevwo, 2012; Otajevwo, 2014). It was not clear whether the site from where the pathogens were isolated had any direct or indirect effect on the antibiograms of the strains as recorded in this study. However, it may be possible that pH changes or variation from site and presence /absence of oxygen could affect the response of S. aureus (a facultative aerobe) to relevant antibiotics it is exposed to in vitro. The sensitivity profile obtained in this study however, is subject to verification and confirmation by other researchers. The fact that each of the five strains was resistant to two-four of the antibiotics used in this study may suggest that very large population of S. aureus organisms have been exposed to several antibiotics (Oluremi et al., 2011). Thioridaxine laboratory dilutions of 2000, 2040, 2080, 2120, 2160, 2200 and 2240 ug/ml were used to treat and cure five uropathogenic strains of S. aureus with the intent of reducing their resistance significantly or eliminating it completely. The loss of (≤50%) resistance after treatment with the stated dilutions of thioridaxine was used as the basis of establishing the curing effects of these dilutions. The use of 50% and above loss in resistance as a criterion to determine the extent of plasmid curing was according to the scheme provided by Akortha et al. (2011). Stanier et al. (1984) reported that the elimination of plasmids by dyes and other natural agents reflects the ability of such an agent to inhibit plasmid replication at a concentration that does not affect the chromosome. After treatment with 2000 to 2240 ug/ml thioridaxine dilutions, S. aureus strain 5 still remained completely resistant to erythromycin, cloxacillin, augmentin and tetracycline. This could be due to the fact that plasmids responsible for resistance to these drugs may be chromosome- mediated or non- conjugative plasmids (Akortha and Filgona, 2009). Many authors have Otajevwo profusely reported occurrence of multidrug resistant S. aureus in their studies (Gales, 2000). Thioridaxine dilution of 2000 ug/ml induced 60.0% loss of resistance of the uropathogen to cotrimoxazole. Also, only two antibiotics namely chloramphenicol and streptomycin recorded 50.0 and 107.1% resistance losses respectively after 2040 ug/ml thioridaxine treatment (Tables 2 and 3). In a similar study, some authors have used 2000 ug/ml thioridaxine dilution treatment to induce loss of resistance (enhance antibiotic sensitivity) in some multidrug resistant strains of Pseudomonas aeruginosa and recorded elimination (curing) of antibiotic resistance in thioridaxine treated strains (Mukherjee et al., 2012). It was concluded in their report that the antipsychotic drug-thioridaxine is a potent agent able to eliminate drug resistance plasmids which are much longer in size than the plasmids of other gram negative bacteria (Mukherjee et al., 2012). From these results, it seems thioridaxine dilution of 2240 ug/ml and perhaps, 2080 or 2200 ug/ml may possess the capacity to eliminate resistance put up by multidrug resistant strains of S. aureus and therefore, could be administered in the therapeutic control of various infections caused by such bacteria. According to Mukherjee et al. (2012), the simultaneous application of thioridaxine to patients may open up a new arena of therapy. The simultaneous application of thioridaxine may not only act as an additional antibacterial agent but may also help to eliminate the drug resistant plasmids from the infectious bacterial cells (Spendler et al., 2006). Hence, patients suffering from MDR S. aureus infections may be administered thioridaxine at standard human doses (using 2240 or 2080 or 2200 ug/ml as a basis) along with antibiotics especially gentamicin, chloramphenicol, cotrimoxazole or streptomycin. Also in this study, sensitivity enhancement effect of thioridaxine laboratory dilutions on the minimum inhibitory concentration (MIC) of chloramphenicol as it affected MDR S. aureus strain 5 uropathogen showed a four-fold (7.5 ug), four-fold (7.5 ug) and two-fold (15 ug) reductions in MIC of chloramphenicol as recorded for 2080, 2160 and 2240 ug/ml thioridaxine dilutions, respectively. Some authors had reported similar findings on MDR S. aureus strains (Otajevwo and Momoh, 2013) as well as on MDR strains of Pseudomonas aeruginosa using acridine orange (Otajevwo and Okungbowa, 2014). Otajevwo (2012) reported similar results using ethidium bromide dilutions on MDR strain of E. coli. A fast and accurate determination of MIC can ensure optimal effective treatment of patients while at the same time avoiding over-prescription. This will save money for healthcare providers as well as reduce development of resistance (NCCLS, 2000; McGowan and Wise, 2001). The MIC of chloramphenicol which is 30 ug (based on long standing research) was reduced to 7.5 ug (four-fold reduction), 7.5 ug (four-fold reduction) and 15 ug (twofold reduction) by thioridaxine laboratory dilutions of 2080, 841 2160 and 2240 ug/ml, respectively, as tested on multiple resistant drug strain of S. aureus isolated from the urinary tract of a patient. According to Dimitru et al. (2006), there is a significant correlation between MIC values and the inhibition zone diameters obtained by a 30 ug disc. The lower the MIC and the larger the zone of inhibition, the more susceptible the microorganism is to the antimicro-bial agent and conversely, the higher the MIC and smaller the zone of inhibition, the more resistant the microorganism (Dimitru et al., 2006). The medical implication therefore of the four-fold, fourfold and two-fold reduction of chloramphenicol MIC by thioridaxine dilutions of 2080, 2160 and 2240 ug/ml, respectively, is that when doses of one of these dilutions or a combination of any two are incorporated into the manufacture of chloramphenicol or any other related antibiotic and then administered to a patient diagnosed to be suffering from a disease caused by MDR S. aureus strain, a better result in terms of outcome (cure of the disease) may be achieved as it will require four times its concentration to function in vivo. In a related work, Kohler (2010) showed that the resistance of P. aeruginosa to tetracycline efflux was reduced from MIC 0.032 to 0.004 ug/ml (an eight- fold reduction) by treatment with phenothiazine. Crowle et al. (1992) demonstrated that non- toxic concentrations of phenothiazine in the lungs achieved complete elimination of Mycobacterium tubercolosis. In a related study, some workers had reported the capacity of an aqueous methanolic plant- extract- epidiosbulbin- E- acetate (EEA) to decrease the MIC of antibiotics against MDR bacteria thus making antibiotic treatment more effective (Shiram et al., 2008) Conclusion Thioridaxine laboratory dilution of 2040 ug/ml induced ≤50% resistance losses for gentamicin, cotrimoxazole, chloramphenicol and streptomycin. Also, 2080, 2160 and 2240 ug/ml thioridaxine dilutions effected chloramphenicol MIC reductions by four-fold, four-fold and two-fold, respectively. Hence, patients suffering from MDR S. aureus infections may be administered thioridaxine at standard human doses (using 2080, 2160 and or 2240 ug/ml as a basis) along with any of the above antibiotics (singly or in combination). It is hoped that this simultaneous or part application of thioridaxine with antibiotics will eliminate plasmids while enhancing the penetration of antibiotics into pathogenic bacterial cells especially those of MDR S. aureus. The likely effect of this is that patient recovery will be facilitated and hospital stay and hospital cost would be drastically reduced. Conflict of interests The author did not declare any conflict of interest. 842 Afr. J. Biotechnol. REFERENCES Akortha EE, Aluyi HAS, Enerijiofi KE (2011). Transfer of amoxicillin resistance gene among bacteria isolates from sputum of pneumonia patients attending the University of Benin Teaching Hospital, Benin City, Nigeria. J. Med. Sci. 2(7):1003-1009. Akortha EE, Filgona J (2009). Transfer of gentamicin resistance genes among enterobacteriaceae isolated from the outpatients with urinary tract infections attending three hospitals in Mubi, Adamawa State. Sci. Res. Essay 4(8):745-752. Amara L, Spendler G, Martins A, Molnar J (2013). Efflux pumps that bestow multidrug resistance of pathogenic gram negative bacteria. Biochem. Pharmacol. J. 2(3):119-121. Barth VN, Charnet E, Martin LJ, Need AB (2006). Comparison of rat dopamine D2 receptor occupancy for a series of anti-psychotic drugs like thioridaxine. Life Sci., 78(26):3007-3019. Bhalakia N (2008). Isolated and plasmid analysis of vancomycin resistant Staph. aureus. J. Young Investigators. 18:1-5. Bauer AW, Kirby WMM, Sherris JC, Turk M (1966). Antibiotic susceptibility testing by a standardized single disc method. Am.J.Clin. Pathol. 45:493-496. Byron F, Brehm S, Eric AJ (2003). Sensitization of Staphylococcus aureus and Escherichia coli to antibiotics by these sesquiterpenoids. Antimicrob. Agents Chemother. 47(10):3357-3360. Chakrabarthy PK, Mishra AK, Chakrabarti SK (1984). Loss of plasmidlike drug resistance after treatment with iodo-deoxyuridine. Indian J. Expt. Biol. 22: 333-334. Crowle AJ, Douvas SG, May MH (1992). Chlorpromazine: a drug potentially useful for treating Mycobacterial infections. Chemotherapy 38:410-419. Diekema DJ, Pfaller MA, Schmitz FJ (2001). Survey of infections due to Staphylococcus spp: Frequency occurrence and antimicrobial susceptibility of isolates collected in the United States, Canada, Latin America, Europe and the Western Pacific region for the SENTRY antimicrobial surveillance programme. Clin. Infect. Dis. 32(2):51145132. Dimitru G, Poiata A, Tuchilus C, Buiuc D (2006). Correlation between linezolid zone diameter and minimum inhibitory concentration valves determined by regression analysis. Rev. Med. Chir. Soc. 110(4):1016-1025. Gomber C, Saxena S (2007). Anti-Staphylococcal potential of callistemon rigidus. Cent. Eur. J. Med. 2:79-88. Gupta TD, Bandyopathy T, Dastidar SG, Bandopadhyay M, Mistra A, Chakrabarty AN (1980). R- plasmids of Staphylococci and their elimination by different agents. Indian J. Expt. Biol. 18:478-481. Jan MB, John DT, Sentry P (2004). High prevalence of oxacillin resistant Staph aureus isolates from hospitalized patients in AsiaPacific and South Africa: Results from SENTRY antimicrobial surveillance program. 1998-1999. Antimicrob. Agent Chemother. 46:879-881. Lakshmi VV, Padma S, Polasa H (1989). Loss of plasmid antibiotic resistance in Escherichia coli on treatment with some compounds. FEMS Microbiol. Letts. 57:275-278 Kohler NO (2010). Non- antibiotics Reverse Resistance of Bacteria to Antibiotics in vivo. J. Antimicrob. Chemother. 24(5):751-754. Madigan M, Martinko J, Parker J (2003). Brock Biology of Microorganisms (10th edn). Prentice Hall, Upper Saddle River, NJ., USA. 500p. Mbata TI (2007). Prevalence and antibiogram of UTI among prisons Inmates in Nigeria Inter. J. Microbiol. 3(2):10-15. McGowan JE (2006). Resistance in non-fermenting gram negative bacteria: multidrug resistance to the maximum. Am. J. Infect. Control 34:29-37. McGowan AP, Wise R (2001). Establishing MIC breakpoints and the interpretation of in vitro susceptibility tests. J. Antimicrob. Chemother. 48:17-28. Mukherjee S, Chaki S, Das S, Sen S, Datta SK, Dastidar SG (2011). Distinct synergistic action of piperacillin and methylglyoxal against Pseudomonas aeruginosa. Indian J. Exp. Biol. 49:447-551. Mukherjee S, Chaki S, Barman S, Das H, Koley, Dastidar SG (2012). Effective elimination of drug resistance genes in pathogenic Pseudomonas aeruginosa by an antipsychotic agent–thioridaxine. Curr. Res. Bacteriol. 5:36-41. Namita J, Pushpa S, Lalit S (2012). Control of multidrug resistant bacteria in a tertiary care hospital in India. Antimicrob. Resistance & Infection Control. 1:23-30. NCCLS (2000). Methods for dilution, Antimicrobial Susceptibility Tests for bacteria that grow aerobically. Approved Standard (5th edition). Wayne, PA, USA. Neu HC (1989). Overview of mechanisms of bacterial resistance. Diagnost. Microbiol. Infect. Dis. 12:109-116. Obaseki-Ebor EE (1984). Rifampicin curing of plasmids in Escherichia coli K12 rifampicin resistant host. J. Pharm. Pharmacol. 36: 467-470. Ochei J, Kolhhatkar A (2008). Medical Laboratory: Theory and practice, 10th edition. New Delhi: Tata McGraw-Hill Publishing Company. 1338p. Okeke IN, Lamikanra A, Edelman R (1999). Socio-economic and behavioural factors leading to acquired bacterial resistance to antibiotics in developing countries. Emerg. Infect. Dis. 5:18-27. Oluremi BB, Idowu AO, Olaniyi JF (2011). Antibiotic susceptibility of common bacterial pathogens in urinary tract infections in a Teaching Hospital in Southwestern Nigeria. Afr. J. Microbiol. Res. 5(22):36583663. Oskay M, Oskay D, Kalyoneu F (2009). Activity of some plant extracts against multidrug resistant human pathogens. Iranian J. Pharm. Res. 8(4): 293-300. Otajevwo FD, Momoh SA (2013). Resistance marker loss of multi-drug resistant (MDR) Staphylococcus aureus strains after treatment with dilutions of acridine orange. J. Med. Med. Sci. 2(2):43-62. ISSN: 2241-2328. Otajevwo FD, Okungbowa A (2014). A study on resistance loss of multidrug resistant (MDR) Pseudomonas aeruginosa strains after treatment with dilutions of acrdine orange. Intl. J. Med. Med. Sci. 6(1):24-33. Otajevwo FD. (2012). Sensitivity enhancement of multidrug resistant urinary tract Escherichia coli isolate to some commonly used Antibiotics after treatment with non-toxic laboratory concentrations of homodium bromide. IOSR J. Pharm. 2(3): 540-568 Ramesh A, Halami PM, Chandrasekhar A (2000). Ascorbic acid induced loss of a pediocin-encoding plasmid in Pediococcus acidilactici CFR K7. World J. Microbiol. Bio. 16:695-697. Reddy G, Shridhar P, Polasa H (1986). Elimination of Col. E1 (pBR322 and pBR329) plasmids in Escherichia coli on treatment with hexamine ruthenium III chloride. Curr. Microbiol. 13: 243-246. Shiram V, Jahagirdar S, Latha C, Kumar V, Puranik V, Rojatkar S (2008). A potential plasmid curing agent, 8-epidiosbulbin E acetate from Dioscorea bulbifera L against multidrug resistant bacteria. Intl. J. Antimicrob. Agents. 32(5): 405-410 Stanier RY, Adelberg EA, Ingraham JL (1984). General Microbiology, 4th edn. The Macmillan Press Ltd, Basingstoke London. Trevors JT (1986). Plasmid curing in bacteria. FEMS Microbiol. Rev. 32(3):149-157. Viveiros M, Jesus A, Brito M, Leandro C, Martins M. (2010). Inducement and reversal of tetracycline resistance in Escherichia coli K12 and expression of proton gradient-dependent multidrug efflux pumps genes. Antimicrob. Agents Chemother. 49:3578-3582. Woo PCY, Lau, SKP, Yeun KY (2003). Facilitation of horizontal transfer of antimicrobial resistance by transformation of antibiotic-induced cell wall- deficient bacteria. Med. Hypot. 61(4):503-508. World Health Organization. (2012). Antimicrobial resistance in the European Union and the World. Lecture delivered by Dr Margaret Chan, Director-General of WHO at the Conference on combating antimicrobial resistance: time for action. Copenhagen, Denmark, March 14th, 2012. African Journal of Biotechnology Related Journals Published by Academic Journals Biotechnology and Molecular Biology Reviews African Journal of Microbiology Research African Journal of Biochemistry Research African Journal of Environmental Science and Technology African Journal of Food Science African Journal of Plant Science Journal of Bioinformatics and Sequence Analysis International Journal of Biodiversity and Conservation
© Copyright 2024