1. health and fitness
2. disease

Aan mijn mama, Emelda en mijn papa, Roger
Kaftinformatie: De afbeelding is getekend door Sarah Jonker
Druk: DCL Print & Sign, Zelzate, www.dclsigns.be, kris.hemeryck@dclsigns.be
The author and the promoter give the authorisation to consult and to copy parts of this work for
personal use only. Every other use is subject to the copyright laws. Permission to reproduce any
material contained in this work should be obtained from the author.
Characterization of an intravenous LPS inflammation
model in broilers with respect to the
pharmacokinetics and pharmacodynamics of
nonsteroidal anti-inflammatory drugs
Sandra De Boever
Thesis submitted in fulfilment of the requirements for the degree of
Doctor in Veterinary Sciences (PhD),
Faculty of Veterinary Medicine, Ghent University, 2009.
Promotors:
Prof. dr. S. Croubels
Prof. dr. P. De Backer
Faculty of Veterinary Medicine
Department of Pharmacology, Toxicology and Biochemistry
We are prone to see what lies behind our eyes, rather than what appears before them.
Thomas Huxley
Contents
List of Abbreviations............................................................................................................................. 7
Part I
Introduction .................................................................................................................. 11
1.1
1.2
1.3
Inflammation, pain and animal welfare ....................................................................................... 12
Inflammation models ................................................................................................................... 13
Lipopolysaccharide ...................................................................................................................... 15
1.3.1 Structure of lipopolysaccharide ...................................................................................... 15
1.3.2 Cellular interaction of lipopolysaccharide ...................................................................... 18
1.4 Cytokines and fever ..................................................................................................................... 20
1.5 General aspects of nonsteroidal anti-inflammatory drugs ........................................................... 25
1.5.1 Pharmacodynamics of nonsteroidal anti-inflammatory drugs ........................................ 25
1.5.2 Pharmacokinetics of nonsteroidal anti-inflammatory drugs ........................................... 27
1.6 Nonsteroidal anti-inflammatory drugs in broilers ........................................................................ 34
1.7 Regulatory aspects of NSAIDs in veterinary medicine ............................................................... 35
References ............................................................................................................................................. 37
Part II
Aims ............................................................................................................................... 47
Part III
Development of an intravenous LPS inflammation model in chickens ................... 51
Chapter 1
Factors influencing the response to LPS .................................................................... 52
Chapter 2
Identification of appropriate housekeeping genes in an intravenous LPS
inflammation model in chickens .................................................................................. 72
Chapter 3
Flow cytometric differentiation of avian leukocytes and analysis of
intracellular IL-1β and IL-6 expression ..................................................................... 88
Chapter 4
Characterization of an intravenous lipopolysaccharide inflammation model
in chickens................................................................................................................... 105
Part IV
Nonsteroidal anti-inflammatory drugs ..................................................................... 135
Chapter 1
Pharmacokinetics of tepoxalin and its active metabolite ........................................ 137
Chapter 2
Pharmacodynamics and pharmacokinetics of tepoxalin, ketoprofen and
sodium-salicylate in an intravenous LPS inflammation model in broiler
chickens........................................................................................................................ 151
General discussion ............................................................................................................................. 181
Summary ............................................................................................................................................ 197
Samenvatting ..................................................................................................................................... 201
Curriculum Vitae .............................................................................................................................. 205
Bibliography ...................................................................................................................................... 206
Dankwoord......................................................................................................................................... 213
5
6
List of Abbreviations
α, β
hybrid constants for the first and second distribution phase in a three compartmental open model; β = hybrid constant for the elimination in a two
compartmental open model
γ
hybrid constant for the elimination phase in a three compartmental open
model
µg
microgram
µl
microliter
5-HPETE 5-hydroxyperoxyeicosatetraenoic acid
APC
allophycocyanin
AUC
area under the curve
BBB
blood brain barrier
BLAST
basic local alignment search tool
bp
base pares
BW
body weight
cAMP
cyclic adenosine monophosphate
Cl
total body clearance
Cmax
maximum concentration
COX
cyclo-oxygenase
Cp
crossing point
DNA
deoxyribonucleic acid
EMEA
European Medicines Evaluation Agency
7
F
bioavailability
g
gravity
G6PDH
glucose-6-phosphate dehydrogenase
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
h
hours
HPLC
high performance liquid chromatography
IC50
half maximal inhibitory concentration
Ig
immunoglobulin
IL
interleukin
IS
internal standard
ke
elimination rate constant
kg
kilogram
LOD
limit of detection
LOQ
limit of quantification
LPS
lipopolysaccharide
ml
milliliter
mM
millimolar
MRL
maximum residue limit
mRNA
messenger ribo nucleic acid
MRT
mean residence time
MS
mass spectrometry
MyD88
myeloid differentiation primary-response protein 88
NCBI
national center for biotechnology information
NF
normalization factor
ng
nanogram
NO
nitric oxide
NSAID
nonsteroidal anti-inflammatory drug
OVLT
organum vasculosum laminae terminalis
PE
phycoerythrin
PCR
polymerase chain reaction
PG
prostaglandin
PMN
polymorphonuclear leukocyte
8
rpm
rotations per minute
RT
reverse transcription
S
second
t½
half-life of elimination
TIR
Toll like receptor and interleukin-1 receptor homology domain
Tmax
maximum time
TL1A
tumor necrosis factor-like factor 1A
TLR
Toll-like receptor
TNF
tumor necrosis factor
TRAM
TRIF-related adaptor molecule
TRIF
TIR-domain-containing adapter-inducing interferon-β
TXA2
thromboxane A2
UB
ubiquitin
UV
ultraviolet
V
variation
Vd
volume of distribution
9
10
Part I
Introduction
11
1.1 Inflammation, pain and animal welfare
Inflammation is a complex homoeostatic process designed to protect humans and
animals against trauma and infection caused by chemical, biological and physical
stimuli. Inflammation serves to destroy, dilute, or wall off the injurious agent, but in
turn it sets into motion a series of events that, as far as possible, heal and reconstitute
the damaged tissue (Cotran et al., 1989, Lees et al., 1991). Inflammation is mostly
divided into an acute and chronic phase. The major signs of the acute phase were described in the 1st century AD as calor (heat), rubor (redness), tumor (swelling) and
dolor (pain). Later, in the 19th century functio laesa (loss of function) was added by
Virchow. Inflammation becomes chronic if the inflicting stimulus persists (Ringler,
1996).
Pain has been defined by the International Association for the Study of Pain as “an
unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage” (IASP, 1979). During the last two
decades there has been a gradual evolution in veterinary management of animal pain.
The increased use of analgesics has been accompanied by improvements in our ability
to assess pain in animals, and by the introduction of a range of analgesic compounds
for veterinary use. However, the main areas of use continue to be companion animals
and horses. Some of the reasons underlying the low use of analgesics in farm animals
include economical and practical considerations such as the low cost of individual
animals relative to the cost of treatments and the paucity of licensed analgesic agents
for use in animals intended for human consumption, as well as concerns about drug
residues in foods of animal origin and the need to observe withdrawal periods (Viñuela-Fernández et al., 2007; Flecknell, 2008).
12
1.2 Inflammation models
Different methods and models have been used to study inflammation. It can be initiated by using mechanical, thermal, chemical, immunological and infectious stimuli.
The vascular and cellular responses in punched wounds of the chicken skin was studied by Katiyar et al. (1992). Thermal injury by applying a copper rod maintained at
65°C on the chicken skin during 30 seconds was examined by Awadhiya et al. (1980).
Chemical injury is often induced by turpentine. The turpentine model of leukocytosis
is consistent with the haematological response to acute staphylococcal tenosynovitis
and coccidiosis in chickens (Harmon, 1998). Turpentine has been injected intradermally, intramuscularly, intraperitoneally and in a subcutaneous pouch (Jain, 1982;
Tohjo et al., 1995; Jain, 1995; Takahashi et al., 1995). Other chemical products that
have been used to induce inflammation are: xylol, carrageenan, concanavalin A, histamine, 5 hydroxytryptamine, bradykinin, phytohaemogglutinin, bovine serum albumine, dextran sulphate, tryptan blue, Freund‟s complete adjuvant, talcum, dinitrochlorobenzene and urate crystals (Seegmiller et al., 1962; Awadhiya et al., 1980;
Sinha et al., 1987; Vegad & Katiyar, 1995). Also anaphylactic reactions, arthus reactions, delayed hypersensitivity reactions and the inflammatory response of skin autografting have been studied in chickens (Vegad & Katiyar, 1995; Shrivastava et al.,
1997). The use of parasitic stimuli to induce inflammation is rare. Nair (1973) seems
to be the only investigator who inoculated larvae of Ascaris suum and Toxocara canis
in the chicken. On the other hand, reports on infectious stimuli to induce an acute
phase response are numerous. Not only live bacteria have been inoculated in the air
sacs, intra-articular, intranasal, intramuscular, subcutaneous and into wing webs in
domestic fowl but also parts of bacteria are used (Carlson, 1972; Nair, 1973; Christie
& Halliday, 1979; Edens et al., 1984; Gentle et al., 2003). Lipopolysaccharide (LPS),
a component of the cell wall of Gram-negative bacteria such as Escherichia coli and
Salmonella, is commonly used to induce an inflammatory reaction because of its proinflammatory properties (Skarnes et al., 1981; Morimoto et al., 1987; Klosterhalfen et
13
al., 1992; Erroi et al., 1993; Semrad, 1993; Franco et al., 2000; Maxwell et al., 2002;
Haudek et al., 2002). Systemic and central injections of gram-negative bacteriaderived LPS induce sickness behaviour including lethargy, anorexia, adipsia, and reduced social activity, fever, weakness, listlessness, somnolence, hyperalgesia, inability to concentrate, hypotension (Lenczowski et al., 1997; Sell et al., 2001, Dantzer,
2006). The signals triggering this response are the pro-inflammatory cytokines such as
interleukin- 1 (IL-1), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α) and interferon (IFN), released primarily by activated monocytes and macrophages (Dantzer,
2006).
The LPS endotoxemia model has the advantage of being a sterile condition without
the additional untoward effects of actively invading and growing microorganisms as
in sepsis. There is a general agreement among researchers that LPS injection may
serve as a model for endotoxic shock but not for sepsis (Poli-de-Figueiredo et al.,
2008). Furthermore, acute endotoxemia represents an adequate tool for understanding
inflammatory processes (Remick and Ward, 2005).
14
1.3 Lipopolysaccharide
1.3.1 Structure of lipopolysaccharide
Bacteria, like all other cells, consist of a cytoplasm bounded by a membrane. Immediately adjacent and external to this cytoplasmic membrane is the peptidoglycan or rigid
layer that gives shape and strength to the cell. In Gram-negative organisms such as
Escherichia coli the rigid layer is surrounded by a complex envelope containing proteins, glycerophospholipids, and LPS (Wright and Kanegasaki, 1971). LPS was first
known as endotoxin, a term introduced in the late 19th century to describe the component of Gram-negative bacteria responsible for the pathophysiological phenomena
associated with Gram-negative infections (Mayeux, 1997). More than 100 years ago it
was distinguished from the actively secreted exotoxins (Rietschel et al., 1993). LPS
extracted from strains of E. coli and SalmonellaTyphimurium consists of three distinct
domains. The outermost sugars, referred to as the O antigens, the core domain and the
lipid A domain as illustrated in Figure 1.
Figure 1: A schematic diagram of the structure of LPS. The number (n) of repeating subunits
in the O-antigen is quite variable and may be > 20 (Tobias et al., 1999).
15
The O antigen consists of repeating oligosaccharide units, the number varying from 0
to 50 per molecule. The nature, ring form, anomeric configuration and type of substitution of the individual monosaccharide residues, as well as their sequence within a
repeating unit, is characteristic and unique for a given LPS an its parental bacterial
strain i.e. bacterial serotype (or species). The core domain is a non repeating spacer
oligosaccharide, connecting the O antigen and the lipid A domain. LPS can occur as
so-called smooth- or rough-form lipopolysaccharides, based on the presence of this
polysaccharide region. The lipid A domain makes up the outer monolayer of the outer
membrane of the bacterium (Raetz et al., 1988; Rietschel et al., 1993, 1994; Holst,
2007).
This outer membrane is particularly important for the bacteria since it inhibits the entrance of toxic compounds, such as some antibiotics. It is also involved in nutrient
transport, and it mediates physiological and pathophysiological interactions of the
bacteria with host organisms (Rietschel et al., 1994; Holst, 2007).
The lipid A was proven to represent the toxic principle of endotoxic active lipopolysaccharides, however its toxicity depends not only on its structure but also on that of
the core region (Holst, 2007). The bioactivities of lipid A are summarized in Table 1.
16
Table 1: Bioactivities of LPS or Lipid A (Takada and Kotani, 1989)
Lethal toxicity
Pyrogenicity
Preparative and provocative activity for local Schwartzman reaction
Induction of hypothermia in mice
Induction of leukocytosis
Induction of bone marrow necrosis
Depression of blood pressure
Toxicity enhanced by
- BCG
- Adrenalectomy
- Galactosamine
Enhanced dermal reactivity to epinephrine
Platelet aggregation
Complement activation
Hageman factor activation
Induction of plasminogen activator
Embryonic bone resorption
Type C RNA virus release from mouse spleen cells
Induction of
- tumor necrosis factor (TNF)
- interferon (IFN)
- colony stimulating factor (CSF)
- prostaglandin (PG) synthesis
Activation of
- B lymphocytes (mitogenic activity)
- Macrophages
- Polymorphonuclear leukocytes
- Endothelial cells
Somnogenic effect
Analgesic effect
Adjuvant (immunomodulating) activity
Increase of non-specific resistance to infection
Induction of tumor necrosis
Induction of tolerance to endotoxin
Induction of early refractory state to temperature change
Induction of mouse liver pyruvate kinase
Inhibition of phosphoenolpyruvate carboxykinase
17
1.3.2 Cellular interaction of lipopolysaccharide
The unravelling of the interaction of LPS with the immune system begun with the
recognition of the Toll protein of Drosophila melanogaster, originally described by
Hashimoto et al., 1988. Only in 1996, Lemaitre et al. described the essential role of
the receptor in the fly‟s immunity to fungal infection. Since then, Toll-like receptors
(TLRs) have been identified in humans and animal species. TLRs comprise a family
of cell-surface and endosomally expressed receptors that recognize conserved products unique to microorganisms, such as LPS, leading to the activation of the innate
and adaptive immune systems (Ulevitch, 2004). The description below, dealing with
the interaction of LPS with the cells, is a general one. Only recently, researchers began to study the differences in LPS signalling between mammals and birds. The characteristics of the interaction between LPS and the avian cells, known to date, are highlighted in the text.
The binding of lipid A to lipopolysaccharide binding protein (LBP) is important for
the activation of a wide variety of cells, such as mononuclear cells, endothelial and
smooth muscle cells, polymorphonuclear granulocytes, and thrombocytes (Rietschel
et al., 1994). In mammals, LBP is a 60-kD glycoprotein synthesized in the liver having a dual role in interactions with LPS. At low concentrations it enhances the LPS
signalling by extracting it from the bacterial membranes and transferring it to CD14.
In aqueous solutions, LPS exists as aggregate micelles that bind poorly to monocytes
and macrophages. LBP appears to serve as a transport protein affording the presentation of LPS monomers. At high concentrations of LPS, it inhibits signalling by shuttling the LPS to the serum lipoproteins and by formation of aggregates with LPS
(Mayeux, 1996; Sass et al., 2002; Jerala, 2007).
To our knowledge, LBP is not yet characterized in chickens and since LBP is required
for LPS-induced signal transduction in case of low LPS doses but not when high
doses are administered (Sass et al., 2002), this could be one of the explanations why
chickens belong the more resistant species to LPS.
When the complex of endotoxin and LBP interacts with CD14 on the surface of the
mononuclear phagocyte, the cell becomes activated and produces a variety of proinflammatory mediators. Alternatively, endotoxin and LBP may interact with a solu18
ble form of CD14 in circulation and then activate cells lacking membrane bound
CD14 (Moore and Barton, 1998). CD14 presents the LPS/LBP complex to the MD2/Toll-like receptor 4 (TLR4) complex. MD-2 is a protein that binds to the ectodomain of TLR4. However, CD14 is not required for the myloid differentiation primaryresponse protein 88 (MyD88)-dependent activation of TLR4 by the rough types of
LPS (Jiang et al., 2005). In chickens, the MyD88-independent route, the TLR4/TRIFrelated adaptor molecule (TRAM)/TIR-domain-containing adaptor-inducing interferon-β (TRIF) pathway, is apparently absent, indicating a different evolution of the
LPS response compared with mammalian species (Keestra & van Putten, 2008). Furthermore, chicken CD14 appears to be a trans-membrane protein instead of a glycosylphosphatidylinositol (GPI) anchored protein as it is in mammals. This could have
the consequence that chicken CD14 is less mobile in the cell membrane, which could
also explain why chickens are less responsive to LPS (Wu et al., 2008). TLRs couple
ligand binding to cell activation through members of the MyD88–adaptor family as
illustrated in Figure 2 (Ulevitch, 2004).
Figure 2: Detection of lipid A endotoxin by animal cells and function of the signaling receptor TLR-4 in
innate immunity. The above paradigm is based mainly upon studies of human, mouse and hamster cells
(Medzhitov et al., 1997; Poltorak et al., 1998; Hoshino et al., 1999). The TLR-4 receptor may be oligomerized upon binding of lipid A. As indicated by the upper arrow, cell activation can occur without CD14, but
requires several orders of magnitude more lipid A. Overproduction of TNF-a and IL-1β during a severe
infection can damage small blood vessals, causing fluid leakage and shock. Synthetic lipid A analogues and
certain precursors are potent endotoxin antagonists via TLR-4 (Golenbock et al., 1991; Chow et al., 1999;
Lien et al., 2000; White et al., 1997). (Duke University, Durham, NC, USA)
19
Depending on the LPS chemotype, TLR4 can signal through both MyD88-dependent
and –independent pathways in mammals (Zughaier et al., 2005). The TLR4 receptor
complex requires supportive molecules for optimal response to its ligand LPS (Martin
and Wesche, 2002). MD-2 is essential for LPS signalling and is the last LPS-binding
protein before the signal transduction across the cell membrane (Jerala, 2007).
Recognition of microbial components by TLRs triggers a cascade of cellular signals
that culminates in the activation of NF-κB which leads to inflammatory gene expression and clearance of the infectious agent. NF-κB is a transcription factor regulated by
an inhibitory molecule called inhibitory κB (IκB) which retains NF-κB in the cytoplasm under normal conditions. Upon cellular stimulation IκB releases NF-κB allowing NF-κB to translocate into the nucleus where it binds to its target promoters (Doyle
and O‟Neill, 2006).
This leads to an increase in transcription rate of many different proteins, including the
pro-inflammatory cytokines, TNF-α, IL-1β, IL-6, inducible NO synthase (iNOS),
cyclooxygenase 2 (COX-2), phospholipase A2 and others (Witkamp & Monshouwer,
2000).
1.4 Cytokines and fever
With a few exceptions, both endothermic and ectothermic vertebrates (as well as invertebrates) develop fever in response to injections of endotoxin or other substrates
pyrogenic to mammals. The body temperature of these animals rise as a result of their
“feeling” cold and therefore selecting a warmer microclimate. It even appears to exist
in the single-celled paramecium and is generally believed to be a host defense response which decreases morbidity and mortality (Kluger et al., 1998). The increase in
body temperature has several advantages during infections: it results in inhibition of
bacterial growth, increased bactericidal activities of neutrophils and macrophages,
stimulation of acute-phase protein synthesis and iron sequestration (Netea et al.,
2000). Exposure of leukocytes and other cell types to a pathogen is followed by the
appearance of pyrogenic cytokines or endogenous pyrogens in the circulation among
which IL-1 and IL-6 and TNF-α are considered the most important.
20
Cytokines are small, non-structural proteins with molecular weights ranging from
8000 to 40000 dalton. These soluble polypeptides play an important role in the initiation, maintenance and termination of inflammatory reactions. A practical classification is into the effector cytokines and the chemokines. The effector cytokines can be
further divided into three categories: growth factors such as IL-2, IL-3, IL-4… , proinflammatory cytokines including TNF-α, IL-1β and IL-6 and anti-inflammatory cytokines e.g. IL1-receptor antagonist and IL-10 (Dinarello, 2000, Witkamp & Monshouwer, 2000).
IL-1 exists as at least two biochemically distinct gene products, IL-1α and IL-1β. Although both forms share limited identity, they appear to have similar biological activity. IL-1β is produced by many types of phagocytic cells, including monocytes,
macrophages and macrophage cell lines, T- and B- cells, keratinocytes, endothelial
cells, astrocytes and other cells (Kluger, 1991). The two classic activities associated
with IL-1β are fever production and lymphocyte activation (Morrison & Ryan, 1987).
IL-6 is synthesized by different cell types. It can induce the generation of fever, anorexia, fatigue, elevation of the basal metabolic rate and decrease of serum lipid concentration. Furthermore, IL-6 is implicated in the regulation of the synthesis of acute
phase proteins in the liver and stimulates the hypothalamo-hypophysis-adrenal axis
(Kluger, 1991; Jacab & Kalabay, 1998).
In mammals, TNF-α is considered one of the first mediators that is released during
inflammation, and promotes the production of IL-1β and IL-6. It is produced by
monocytes and macrophages, T- and B-cells, neutrophils, mast cells, tumour cells,
fibroblasts, astrocytes and perhaps many other cell types (Witkamp & Monshouwer,
2000). To date, TNF-α has not been identified in the chicken, but the chicken TL1A
shows large similarity with TNF-α. TL1A belongs to the TNF ligand superfamily and
injection of recombinant chicken TL1A in chickens decreases feed intake, increases
rectal temperature and expression of iNOS and COX-2 (Takimoto et al., 2008).
These cytokines signal the brain, where the level of prostaglandin E2 (PGE2) is elevated. Prostaglandin E2 is recognized as key mediator in the brain ensuing upward
adjustment of the “set point” for thermoregulation to produce fever (Coceani &
Akarsu, 1998; Netea et al., 2000).
21
PGE2 is formed in a series of steps as illustrated in Figure 3. The phospholipase A2
reaction is initiated by stimuli including pyrogens. Cyclooxygenase, an enzyme essential in the production of PGs, exist in two isoforms. COX-1 is expressed constitutively
in most tissues where it plays a wide range of housekeeping roles. COX-2 transcripts
are barely detectable in most quiescent cells but robustly upregulated by a variety of
stimuli, including LPS (Tegender et al., 2001; Ivanov et al., 2002). The brain however
is an exception in having both COX enzymes expressed constitutively (Coceani &
Akarsu, 1998).
Phospholipids from the cell membrane
Phospholipase A2
Arachidonic acid
Cyclo-oxygenase
Lipo-oxygenase
PGG2
5-HPETE
PHH2
Chemotaxis
TXA2 PGI2
Leukocyte
infiltration
PGE2
PGF2
PGD2 Destruction of
leukocytes
Production of
leukotriëns
Free radicals
Inflammation
Figure 3: Formation of PGE2 from arachidonic acid (PGG2: prostaglandin G2,5-HPETE: 5hydroxyperoxyeicosatetraenoic acid, TXA2: thromboxane A2, PGI2: prostaglandin I2, PGF2: prostaglandin F2, PGD2: prostaglandin D2)
22
The mechanism by which blood-borne cytokines act on the brain and promote PGE2
synthesis is not yet fully elucidated. The cerebral capillaries are considered to be
structural impermeable to peptides and the transport system for IL-1 and IL-6 across
the capillary wall has a low efficiency. Several mechanisms have been proposed to
explain how circulating cytokines can influence the brain. Although the transport rates
of IL-6 by the active transport mechanisms are low, this may be sufficient to activate
the central nervous system (Luheshi, 1998; Coceani & Akarsu, 1998, Netea et al.,
2000; Matsumura & Kobayashi, 2004). Other hypotheses include the passage of cytokines from the periphery via the organum vasculosum laminae terminalis (OVLT)
which is devoid of the blood brain barrier (BBB), activation of cytokine receptors present on endothelial cells of the BBB which then transduce the signal to the brain via
other mediators. Cytokines and their receptors are also expressed within the brain and
are modulated by peripheral stimuli such as LPS or other cytokines. Neuronal afferents were suggested as alternative or additional signals from the periphery to the brain
(Luheshi, 1998; Coceani & Akarsu, 1998).
The vascular nature of the OVLT is fenestrated. The endothelial cells of the OVLT
offer a unique pathway for peripheral pyrogens to affect the thermoregulatory center.
Pyrogens arriving from the carotid artery activate their respective receptors on the
endothelial cells releasing arachidonic acid, which is rapidly converted to PGE 2. It is
likely that PGE2 and other metabolites of arachidonic acid are released from the brain
side of the endothelial cells and subsequently induce the release of neurotransmitters
in the brain. PGE2 is known to increase levels of cyclic adenosine monophosphate
(cAMP), which has neurotransmitter properties in brain tissue and has been implicated
in fever production. As the raised set point increases, core temperature increases via
vasoconstriction by peripheral efferent pathways, which reduces heat loss (Dinarello,
2004). These pathways are illustrated in Figure 4.
23
1 Local or systemic infection, Gr+ ot Gr- bacteremia,
endotoxins and enterotoxins
2
Cortex
Thermoregulatory
Center
6
Circulation
5
3 Phagocytic cells,
endothelium,
T-cells
behavioural changes
cAMP
COX-2
PGE2
OVLT
TLR
4
circulation
IL-1β, TNF-α, IL-6
Core temperature
increases
cytokine receptor
7
Peripheral
efferent
nerves
8 Vasoconstriction,
Decreased heat loss
Figure 4: Pathways for fever in bacterial infections. 1. Infection can be local or systemic in which Gram-positive or Gram-negative organisms release cell-wall
products such as endotoxins, peptidoglycans, teichoic acids and others. 2. Gaining access to the circulation, microbial products reach the organum vasculosum
laminae terminalis (OVLT) of the hypothalamus. The endothelium of the OVLT expresses TLR. 3. Microbial products also bind to TLR on phagocytic cells or endothelial cells. Pyrogenic cytokines are released into the circulation. 4. Pyrogenic cytokines bind to their respective cytokine receptors on the OVLT. 5. Induction
of COX-2 resulting in synthesis of PGE2 on the brain side of the OVLT. PGE2 stimulates the release of cAMP to raise the hypothalamic thermostatic set point. 6.
Neuronal signals to the cortex initiate behavioural changes to conserve body heat. 7. Hypothalamic signals activate peripheral efferent nerves to blood vessels via
the sympathetic pathways. 8. Vasoconstriction decreases heath loss and core temperature increases. (Dinarello, 2004).
24
1.5 General aspects of nonsteroidal anti-inflammatory
drugs
Non-steriodal anti-inflammatory drugs (NSAIDs) have three major pharmacologically
desirable actions, which are:
an anti-inflammatory action meaning the modification of the inflammatory reaction,
an analgesic action with the reduction of certain sorts of pain by less sensation of nociceptive nerve endings to inflammatory mediators such as bradykinin and 5- hydroxytryptamine and an antipyretic effect (Rang et al., 2003).
In the Belgian veterinary compendium, NSAIDs are devided into the following
groups: pyrazolon derivatives, nicotin acid derivatives and fenamates, arylpropionic
acid derivatives and the oxicam group. Tepoxalin and firocoxib are two NSAIDs for
veterinary use in Belgium, not belonging to the former mentioned groups.
1.5.1 Pharmacodynamics of nonsteroidal anti-inflammatory drugs
All the above mentioned actions mainly result from the inhibition of cyclooxygenase
in inflammatory cells. Aspirin and conventional NSAIDs are nonselective inhibitors
of cyclooxygenase-1 and -2 enzymes, responsible for the biosynthesis of prostaglandins. Prostaglandins from COX-1 are responsible for a variety of normal physiologic
effects such as protection of gastrointestinal mucosa, hemostasis and maintenance of
renal blood flow. COX-2, the inducible isoform, is responsible for prostaglandin production during inflammation. The ratio of COX-2 to COX-1 describes the amount of
drug necessary to inhibit the respective isoform of COX in an experimental environment. Inhibition of COX-1 is considered to be responsible for the side-effects caused
by NSAIDs such as gastrointestinal bleeding, indeed, the most potent inhibitors of
COX-1 such as asperin, indomethacin and piroxicam, are the NSAIDs that cause the
most damage to the stomach. NSAIDs which preferably inhibit COX-2, are nowadays
desired, so the COXIBs were developed which have the desirable COX-2/COX-1 ra25
tio of less than 1 (Vane and Botting, 1998; Osiri and Moreland, 1999; Boothe, 2001).
Salicylates lack the acetyl group of acetyl salicylic acid, they are believed to be ineffective as direct cyclooxygenase (COX) inhibitor, but they are nevertheless able to
reduce inflammation indirectly through inhibition of Nuclear Factor – κB (NF- κB)
transcription factor activation, which mediates COX-2 expression (Tegeder et al.,
2001; D‟Acquisto et al., 2002). Guiliano and Warner (1999), were unable to establich
half maximal inhibitory concentrations (IC50) values for salicylate for COX-1 nor
COX-2. Ketoprofen is a nonselective COX inhibitor, although it appears to be relatively COX-1 selective in dogs. Also tepoxalin inhibits both COX-1 and COX-2
(Curry and Cook, 2005). The COX-2/COX-1 ratio of some NSAIDs is given in Table
2. Unfortunately, in humane medicine the use of selective COX-2 inhibitors was associated with a higher risk of hypertension, myocardial infarction and stroke. In recent
years, some studies have also pointed out that COX-2 may also have antiinflammatory properties. Inhibition of PGE2 synthases, that catalyze the last step of
PGE2 biosynthesis, could represent a safer anti-inflammatory strategy (Pecchi et al.,
2009).
Besides inhibition of COX, some NSAIDs have also been attributed other antiinflammatory mechanisms.
Reduction of neutrophils functions such as inhibition of generation of superoxide ions
and the release of lysosomal enzymes has been noticed for piroxicam (Weissmann,
1991).
Activation of arginine vasopressin V1-type receptors within the ventral septal area of
the brain is an antipyretic mechanism attributed to salicylate and indomethacin (Wilkinson & Kasting, 1990).
Several NSAIDs have an effect on pro-inflammatory cytokine expression. Reduction
of inflammatory cytokine release in activated neutrophils is reported for nimesulide
(Kimura et al., 2003). Upregulation of mRNA expression produced by T helper 1 cells
and downregulation of cytokines produced by T helper 2 cells by indomethacin, diclofenac and ketoprofen has been described (Tsuboi et al., 1995). Inhibition of IL-6
production has been mentioned for aspirin, ibuprofen and carprofen (Komatsu et al.,
1991; Armstrong & Lees, 2002).
26
For some NSAIDs this influence on pro-inflammatory cytokine expression is due to
their inhibitory effect on the activation of transcription factor NF-κB. This is reported
for aspirin, salicylates, ibuprofen, acetaminophen, sulindac and tepoxalin (D‟Aquisto
et al., 2002).
Other beneficial aspects of several NSAIDs are their chemopreventive and therapeutic
effects in cancertherapy among which their antiproliferative effects, induction of
apoptosis and the affection of the DNA mismatch-repair system (Elwood et al., 2009).
Table 2: COX-2/COX-1 ratio of NSAIDs
Drug
COX2/COX1 ratio
Species
Acetyl salicylic acid
> 2.92
Dog
Carprofen
0.18
Cat and Dog
Carprofen
0.64
Horse
Carprofen
50
Human
Celecoxib
0.12
Dog
Indomethacin
17
Dog
Indomethacin
11.94
Horse
Indomethacin
46
Human
Ketoprofen
4.3
Dog
Meloxicam
0.33
Cat
Meloxicam
0.34
Dog
Tepoxalin
30
Sheep
(Ricketts et al., 1998; Brideau et al., 2001; Lees et al., 2004a; Lees et al., 2004b; Curry and
Cook, 2005)
1.5.2 Pharmacokinetics of nonsteroidal anti-inflammatory drugs
Pharmacokinetics is the science that studies the relationship between the movement of
a drug through the body and the processes affecting it. It describes the time-course of
the movement of a drug into (absorption), around (distribution) and out of the body
(elimination → metabolism and/or excretion). Additionally, it studies the relationship
27
of these processes with regards to the intensity and duration of characteristic effects of
drugs (Clark & Smith, 1993; Baggot, 1995).
Mathematical models are used to describe changes in drug concentration in the body.
These changes can obey first order or zero order rates. In a first order process, the actual rate of the process varies in direct proportion to the mass of the compound. In a
zero order process, the rate of drug movement is fixed and thus independent of the
amount of the compound available (Riviere, 1999).
Following a single intravenous (i.v.) bolus injection, the decline in plasma concentration of the drug can be plotted graphically by a mono-, bi-, or even multiple-phasic
disposition curve as illustrated in Figure 5.
Figure 5: Schematic illustration of mono-exponential decline (left, one-compartment model)
and multi-exponential decline (right, multi-compartment model) after intravenous bolus administration (Gabrielsson & Weiner, 2006).
Compartment analysis, in which the body is conceived as consisting of distribution
compartments interconnected by first order rate constants defining drug transfer, is
used to describe the pharmacokinetic behaviour of drugs. These compartments have
no physiologic counterparts, but are considered as a tissue or group of tissues that
have similar blood flow and drug affinity. The models are all open models, since there
is irreversible elimination of the drug, which can only take place from the central
compartment (Gibaldi & Perrier, 1975; Riviere, 1991, 1999; Rowland & Tozer, 1995).
28
The concentration-time curves can be described using the following mathematical
equations:
For a one compartmental open model: C = C(0)e-kt
For a two compartmental open model: C = A1e-αt + A2e-βt
For a three compartmental open model: C = A1e-αt + A2e-βt + A3e-γt
In these equations C represents the plasmaconcentration, C(0) is the extrapolated initial
concentration, k is the elimination rate constant, A1, A2 and A3 are the preexponential coefficients, α represents the distribution constant, β is the elimination
rate constant, γ is the elimination constant in a three compartmental open model and t
is the time (Gibaldi & Perrier, 1975).
Recently, a simpler and more convenient approach has been introduced to calculate
pharmacokinetic parameters. Noncompartmental analysis does not require the assumption of a specific compartmental model, in fact it can be applied to any compartmental model providing linear pharmacokinetics are present (Riviere, 1999;
Mahmood, 2005; Gabrielson & Weiner, 2006).
29
1.5.2.1
Bioavailability
A drug can be administered either orally or parenterally, e.g. intravenous, intramuscular, subcutaneous. The parental route has the advantage of bypassing the gastrointestinal tract. From the site of administration, a variable degree of absorption takes place,
depending on the formulation and on the drug itself (Holford & Sheiner, 1987;
Brown, 2001). In general, acidic NSAIDs are well absorbed from the gastrointestinal
tract (Swan et al., 1995). The injection of a drug directly into the bloodstream has the
advantage that the drug is completely systemic available. Orally administered drugs,
on the other hand, undergo three events before entering systemic circulation: release
from the solid form (except for water medication), diffusion and/or transport across
the gastrointestinal mucosal barrier into the portal circulation and passage through the
liver as illustrated in Figure 6 (Gibaldi & Perrier, 1975; Rowland & Tozer, 1995;
Brown, 2001; Tozer & Rowland, 2006).
Figure 6: The figure shows where metabolism occurs during the absorption process. The fraction of the initial dose appearing in the portal vein is the fraction absorbed, and the fraction
reaching the blood circulation after the first-pass through the liver defines the bioavailability
(van de Waterbeemd & Gifford, 2003).
30
Passage through the liver can include biotransformation of the drug. Biotransformation is the formation of metabolites that have physicochemical properties favourable
to their excretion and can lead to activation or inactivation. Apart from the liver, metabolism also can take place in blood, lung, kidney, lumen of the gut, etc. Generally,
biotransformation reactions can be divided into phase I and phase II. Phase I consists
of reactions classified as oxidative, reductive and hydrolytic, while the second phase
(phase II) includes conjugations with endogenous substances (glucuronic acid, acetate, sulphate, amino acids,….) (Riviere, 1999; Doherty & Charman, 2002). Polar
drugs and compounds with low lipid solubility are eliminated mainly by excretion,
which can occur in the kidney, bile, lung, sweat glands, etc. (Baggot, 1995). Both
hepatic metabolism and renal/or biliary excretion are involved in terminating the action of NSAIDs. In some instances, the metabolites are themselves anti-inflammatory,
analgesic and/or antipyretic (Swan et al., 1995).
Bioavailability (denoted as F and generally expressed as a percentage, F%) is a key
parameter which expresses the proportion of a drug administered by any nonvascular
route that gains access to the systemic circulation. It can be adequately characterized
by termination of three parameters from the plasma drug concentration-time profile:
peak plasma concentration (Cmax), time taken to reach peak concentration (Tmax) and
area under the curve (AUC) (Rowland & Tozer, 1995; Toutain & Bousquet-Mélou,
2004a).
31
1.5.2.2
Half-life of elimination, volume of distribution and clearance
The plasma half-life (half-life of elimination or half-life of the terminal phase) is the
most frequently reported of all pharmacokinetic parameters. It is the time required to
divide the plasma concentration by two after reaching pseudo-equilibrium. The halflife is (apparently) easy to compute and it is often the only reported pharmacokinetic
parameter. In some circumstances, it is the only parameter that can be computed, e.g.
for a drug metabolite or any analyte disposition when the dose is unknown (Toutain &
Bousquet-Mélou, 2004b). Although there are no definite rules regarding the exact
number of half-lives needed to clear a drug from the body, it is generally safe to assume that an administered dose will be cleared from the system when 99.9% of the
dose has been eliminated after about seven times the half-life of elimination (Martinez, 1998). The decay of a drug following first-order pharmacokinetics being exponential, the terminal half-life is obtained from the following equation:
where 0.693 is the natural logarithm of 2 and ke is the elimination rate constant (Toutain & Bousquet-Mélou, 2004b).
Large variations exist in the half-lives of elimination of NSAIDs between species, as
was summarized by Lees et al. (1991) which should be kept in mind to avoid overdosing.
32
Volumes of distribution are proportionality constants between total amount of drug in
the body and plasma concentrations. Several volumes of distribution have been defined. the two most relevant are the volume of distribution at equilibrium (Vss), and
the volume of distribution during pseudo-equilibrium (Varea) (Toutain & BousquetMélou, 2004c). A higher volume of distribution reflects the more extensive distribution from the plasma into the tissues (Brown, 2001). All volumes of distribution correspond to the ratio of an amount (A) of drug in the body at a given time (At), and
plasma (blood) concentration at that time (Toutain & Bousquet-Mélou, 2004c):
In contrast to elimination half-life, there is a high degree of consistency in volume of
distribution for NSAIDs. Distribution volumes range from approximately 0.15 – 0.3
l/kg for the different drugs, regardless of the species under consideration (Swan et al.,
1995).
The distribution of a drug can be restricted by plasma protein binding, which can also
influence the elimination of the drug. Albumin is the main plasma protein to which
the drugs bind. Only the lipid soluble, non-ionized moiety of a drug that is free (unbound) in the plasma can penetrate cell membranes or diffuse into transcellular fluids.
Drug binding is usually classified as extensive when >80%, moderate when 50-80%
and low when <50% (Riviere, 1999). All NSAIDs (except salicylate) exhibit a high
degree of plasma protein binding in all species, which limits their passage from
plasma into interstitial and intracellular fluids but facilitates passage into inflammatory exsudate (Lees et al., 2004a).
33
Plasma clearance is a very important of all pharmacokinetic parameters. Plasma clearance is determined by all the individual metabolizing/eliminating organ clearances
and involves mainly liver and kidney clearances. It expresses the overall ability of the
body to eliminate a drug by scaling the drug elimination rate (amount per time) by the
corresponding plasma concentration level as illustrated in the following equation
(Toutain & Bousquet-Mélou, 2004d):
where dx/dt (amount per time) is the rate of drug elimination at a given time t and
C(t), the corresponding driving concentration.
The kidneys are primarily responsible for excreting unchanged drug and metabolites.
Non-renal excretory pathways may be important in some species , such as equines
(Swan et al., 1995).
1.6 Nonsteroidal anti-inflammatory drugs in broilers
In birds, several NSAIDs have been tested for various indications.
Reduced weight gain and feed conversion are major sources of economic losses from
avian coccidiosis. Experiments were conducted to determine possible involvement of
upregulation of COX activity during coccidian infections that might contribute to reduced weight gain (Allen, 2000; Vermeulen et al., 2004).
Ascites syndrome is a metabolic disease in broilers which causes considerable economic loss. Piroxicam was able to lower the thiobarbituric acid reactive substances,
which are an index of lipid peroxidation and oxidative stress, in lung, liver and heart
of broilers with ascites syndrome (Valle et al., 2001).
The modern broiler chicken has been extensively selected for rapid growth rates and
increased muscle mass that has placed increasing demands on skeletal integrity.
Lameness is common in broiler chickens and it has been assumed that conditions
34
causing lameness are painful (Hocking et al., 2001). Carprofen, flunixin and ketoprofen were tested in the microcrystalline sodium urate model of articular pain. For carprofen, lame birds selected significantly more drugged feed than sound birds and as
the severity of lameness increased the amount of drugged feed consumed, increased
(McGeown et al., 1999; Danburry et al., 2000; Hocking et al., 2005).
Indomethacin, ascorbic acid and acetylsalicylic acid were examined to test their ability to alleviate the effects of heat stress, such as reduced feed consumption, feed efficiency and growth rate and elevated body temperature. Body temperature is controlled
by balancing heat loss against heat production. Taking elevated body temperature as
an indicator, heat stress occurs when the sum of heat production plus heat gain from
the environment becomes greater than the animal‟s ability to lose heat. Under these
conditions, mortality increases and growth rate is reduced in broilers. There is no clear
evidence that heat stress hyperthermia is related to prostaglandin synthesis as occurs
during the febrile response. From the performed experiments could be concluded that
the use of COX inhibitors is not recommended to block heat stress induced effects
(Stilborn et al., 1988; Furlan et al., 1998).
1.7 Regulatory aspects of NSAIDs in veterinary medicine
The European Union requires by law that foodstuffs (such as meat, milk or eggs) obtained from animals treated with veterinary medicines not to contain any residue that
might represent a hazard to the health of the consumer. Before a veterinary medicinal
product intended for food-producing animals can be authorised in the EU, the safety
of its pharmacologically active substances and their residues must first be evaluated
and included in Annex I, II or III of Council Regulation (EEC) No 2377/90.
Annex I includes substances for which final maximum residue limit, or MRL has
been established.
Annex II of the Regulation includes the substances for which it is not considered necessary for the protection of public health to establish MRL values. These substances
are allowed to be used in veterinary medicinal products for food producing species for
35
the animal species identified and according to the conditions established, if any (e.g.
specific route of administration). It should be noted that an entry in Annex II is not
equivalent to the status “generally recognised as safe”.
Annex III includes substances with provisional MRLs. When not all aspects of the
substance have been fully addressed at the time of the approval, provisional MRLs
can be set for a defined period not exceeding five years, provided that there are no
grounds for supposing that residues of the substance at the level proposed will present
a hazard to the health of the consumer.
The following nonsteroidal anti-inflammatory drugs (NSAIDs) have been assigned a
MRL (Annex I): carprofen (equine, bovine), diclofenac (bovine, porcine), firocoxib
(equine), flunixin (bovine, porcine, equine), meloxicam (bovine, porcine, equine),
tolfenamic acid (bovine, porcine), vedaprofen (equine), metamizole (bovine, equine,
porcine).
Acetylsalicylic acid, sodium acetylsalicylate, acetylsalicylic acid DL-lysine, carbasalate calcium, ketoprofen and paracetamol are currently included in Annex II but only
the first four substances can be administered to broilers according to the European
legislation.
In Belgium, products from the following groups are marketed for use in veterinary
medicine: salicylates, pyrazolonderivatives, nicotine acid derivatives and fenamates,
arylpropionic acid derivatives, the group of enolic acids and also tepoxalin and firocoxib. However, from these NSAIDs, none have been registered for poultry in Belgium, so according to the Belgian law, no NSAIDs can be used in avian species.
The registration procedure is important to control a drug‟s quality, safety and efficacy
and requires, among other things, information on pharmacokinetics and pharmacodynamics of the drug in the species in question. When attempting to evaluate the efficacy of a NSAID, appropriate parameters need to be considered. For example, the antipyretic effect of a NSAID can be assessed in an Escherichia coli endotoxin-induced
fever model, measuring the rectal temperature (EMEA/CVMP/237/01-FINAL).
36
References
Allan P. Effects of treatments with cyclooxygenase inhibitors on chickens infected
with Eimeria acervulina. Poultry Science (2000) 79: 1251-1258.
Armstrong S & Lees P. Effects of carprofen (R and S enantiomers and racemate) on
the production of IL-1, IL-6 and TNF-alpha by equine chondrocytes and synoviocytes. Journal of Veterinary Pharmacology and Therapeutics (2002) 25: 145153.
Awadhiya R., Vegad J. & Kolte G. A topographical study of increased vascular permeability in acute inflammatory reaction in the chicken skin. Research in Veterinary Science (1980) 29: 203-210.
Baggot J. Pharamcokinetics: Disposition and Fate of Drugs in the body. In „Veterinary
Pharmacology and Therapeutics‟, 7th edition, ed. R. Adams, Iowa State University Press, Ames (1995) 18-52.
Boothe D. The analgesic, antipyretic, anti-inflammatory drugs. In „Veterinary Pharmacology and Therapeutics‟, 8th edition, Adams H. (Ed.), Iowa State University
Press, Ames, USA (2001) 433-451.
Brideau C., Van Staden C. & Chung Chan C. In vitro effects of cyclooxygenase inhibitors in whole blood of horses, dogs and cats. American Journal of Veterinary
Research (2001) 62: 1755-1760.
Brown S. Pharmacokinetics: disposition and rate of drugs in the body, In: Veterinary
Pharmacology and Therapeutics, 8th Edition, Adams H.R. (Ed.), Iowa State University Press, Ames, USA (2001) 15-57.
Carlson H. The acute inflammatory reaction in the chicken breast muscle. Avian Diseases (1972) 16: 553-58.
Coceani F. & Akarsu E. Prostaglandin E2 in the pathogenesis of fever An update. Annals New York Academy of Science (1998) 76-82.
Cotran R., Kumar V. & Robbins S.. Inflammation and Repair. In: Robbins Pathologic
Basis of Disease 4th edition, ed. Cotran, Kumar, Robbins. WB Saunders Company, Philadelphia, US (1989) 39-86.
Clark B. & Smith D. An introduction to pharmacokinetics, second edition. Blackwell
Scientific Publications (1993).
37
Christie G. & Halliday W.. Haematological and biochemical aspects of an E. coli septicaemia in brown leghorn chickens. Avian Pathology (1979) 8: 45-55.
Chow J., Young D., Golenbock D., Christ W. & Gusovsky F. Toll-like receptor-4
mediates lipopolysaccharide-induced signal transduction. The Journal of Biological Chemistry (1999) 274: 10689-10692.
Curry S. & Cook S. Nonsteroidal anti-inflammatory drugs: a review. Journal of the
American Animal Hospital Association (2005) 41: 298-309.
D‟Acquisto F., May M. & Ghosh S. Inhibition of Nuclear Factor Kappa B (NFκB): an emerging theme in anti-inflammatory therapies. Molecular Interventions (2002) 2: 22-35.
Dantzer R. Cytokine-induced sickness behaviour: mechanisms and implictions.
Neurologic Clinics (2006) 24: 222-234.
Dinarello C. Proinflammatory cytokines. Chest (2000) 118: 503-508.
Danburry T., Weeks C., Chambers J., Waterman-Pearson A. & Kestin S. Selfselection of the analgesic drug carprofen by lame broiler chickens. The Veterinary Record (2000) 146: 307-311.
Doherty M. & Charman W. The mucosa of the small intestine – how relevant as an
organ of drug metabolism. Clinical Pharmacokinetics (2002) 41: 235-253.
Doyle S. & O‟Neill L. Toll-like receptors: from the discovery of NF-κB to new
insights into transcriptional regulations in innate immunity. Biochemical
Pharmacology (2006) 72: 1102-1113.
Duke University, Durham, NC, USA, www.biochem.duke.edu/assets/426/Fig3.jpeg
Edens F., McCorkle F. & Simmons D.. Body temperature response of turkey poults
infected with Alcaligenes faecalis. Avian Pathology (1984) 13: 787-795.
Elwood P., Gallagher A., Duthie G., Mur L. & Morgan G. Aspirin, salicylates, and
cancer. Lancet (2009) 373: 1301-1309.
Erroi A., Fantuzzi G., Mengozzi M., Sironi M., Orencole S., Clark B., Dinarello C.,
Isetta A., Gnocchi P., Giovarelli M. & Ghezzi P. Differential regulation of cytokine production in lipopolysaccharide tolerance in mice. Infection and Immunity
(1993) 61: 4356-4359.
38
Franco R., de Jonge E., Dekkers P., Timmerman J., Spek C., van Deventer S., van
Deursen P., van Kerkhoff L., van Gemen B., ten Cate H., van der Poll T.,
Reitsma P.H. The in vivo kinetics of tissue factor messenger RNA expression
during human endotoxemia: relationship with activation of coagulation. Blood
(2000) 96: 554-559.
Furlan R., Macari M., Malheiros E., Secato E. & Guerreiro J. Effect of indomethacin
on hyperthermia induced by heat stress in broiler chickens. International Journal of Biometereorology (1998) 42: 73-76.
Gabrielsson J. & Weiner D. Pharmacokinetic & Pharmacodynamic. Data analysis:
Concepts and applications, Fourth edition (2006). Swedish Pharmaceutical
Press, Stockholm.
Gentle M., Bradbury J. & Wilson S. Sensory properties of articular afferents following Mycoplasma arthritis in the chicken. Brain Research (2003) 968: 26-34.
Gibaldi M. & Perrier D. Pharmacokinetcs, Marcel Dekker Inc., New York, USA
(1975).
Golenbock D., Hampton R., Qureshi N., Takayama K. & Raetz C. Lipid A-like molecules that antagonize the effects of endotoxins on human monocytes. The Journal of Biological Chemistry (1991) 266: 19490-19498.
Guiliano F. & Warner T. Ex vivo assay to determine the cyclooxygenase selectivity of
nonsteroidal anti-inflammatory drugs. British Journal of Pharmacology (1999)
126: 1824-1830.
Harmon B. Avian heterophils in inflammation and disease resistance. Poultry Science
(1998) 77: 972-7.
Haudek S., Natmessing B., Fürst W., Bahrami S., Schlag G. & Redl, H. Lipopolysaccharide dose response in baboons. Shock (2003) 20: 431-436.
Hocking P., Robertson G. & Gentle M. Effects of anti-inflammatory steroid drugs on
pain coping behaviours in a model of articular pain in the domestic fowl. Research in Veterinary Science (2001) 71: 161-166.
Hocking P., Robertson G. & Gentle M. Effects of nonsteroidal anti-inflammatory
drugs on pain-related behaviour in a model of articular pain in the domestic
fowl. Research in Veterinary Science (2005) 78: 69-75.
39
Holford N. & Sheiner L. Understanding the dose-effect relationship: clinical application of pharmacokinetic-pharmacodynamic models. Clinical Pharmacology
(1981) 6: 429-453.
Holst O. The structure of core regions from enterobacterial lipopolysaccharide – an
update. FEMS Microbiology Letters (2007) 271: 3-11.
Hoshino K., Takeuchi O., Kawai T., Sanjo H., Ogawa T., Takeda Y., Takeda K. &
Akira S. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product.
Journal of Immunology (1999) 162: 3749-3752.
IASP. The need of a taxonomy. Pain (1979) 6: 247-252.
Jacab L. & Kalabay L. The acute phase reaction syndrome: the acute phase reactants.
Acta Microbiologica et Immunologica Hungarica (1998) 45: 409-418.
Jain N., Vegad J., Katiyar A. & Awadhiya R. Effects of anti-inflammatory drugs on
increased vascular permeability in acute inflammatory response in the chicken.
Avian Pathology (1995) 24: 723-729.
Jain N., Vegad J. & Awadhiya R. Studies on acute inflammation in the chicken using
turpentine-induced pleuroperitonitis as a test system. Veterinary Record (1982)
110: 421-422.
Jerala R. Structural biology of the LPS recognition. International Journal of Medical
Microbiology (2007) 29: 353-363.
Katiyar A., Vegad J. & Awadhiya R. Pathology of inflammatory-reparative response
in punched wounds of the chicken skin. Avian Patholology (1992) 21: 471-80.
Keestra A. & van Putten J. Unique properties of the chicken TLR4/MD-2 complex:
selective lipopolysaccharide activation of the MyD88-dependent pathway. The
Journal of Immunology (2008) 181: 4354-4362.
Kimura T., Iwase M., Kondo G., Watanabe H., Ohashi M., Ito D. & Nagumo M. Suppressive effect of selective cyclooxygenase-2 inhibitor on cytokine release in
human neutrophils. International Immunopharmacology (2003) 3: 1519-1528.
Klosterhalfen B., Hörstmann-Jungemann K., Vogel P., Flohé S., Offner F., Kirkpatrick C., Heinrich P. Time course of various inflammatory mediators during recurrent endotoxemia. Biochemical Pharmacology (1992) 43: 2103-2109.
40
Kluger M. Fever: role of pyrogens and cryogens. Physiological Reviews (1991) 71:
93-127.
Kluger M., Kozak W., Conn C., Leon L. & Soszynski D. Role of fever in disease. Annals New York academy of sciences (1998) 224-233.
Komatsu H., Yaju H., Chiba K. & Okumoto T. Inhibition by cyclo-oxygenase inhibitors of interleukin-6 production by human peripheral blood mononuclear cells.
International Journal of Immunopharmacology (1991) 13: 1137-1146.
Lien E., Means T., Heine H., Yoshimura A., Kusumoto S., Fukase K., Fenton M., Oikawa M., Qureshi N., Monks B., Finberg R., Ingalis R. & Golenbock D. Tolllike receptor 4 imparts ligand-specific recognition of bacterial lipopolysaccharide. The Journal of Clinical Investigation (2000) 105: 497-504.
Lees P., May S. & McKellar Q. Pharmacology and therapeutics of nonsteroidal antiinflammatory drugs in the dog and cat: 1 General pharmacology. Journal of
Small Animal Practice (1991) 32: 183-193.
Lees P., Landoni M., Giraudel J. & Toutain P. Pharmacodynamics and pharmacokineticsof nonsteroidal anti-inflammatory drugs in species of veterinary interest.
Journal of Veterinary Pharmacology and Therapeutics (2004a) 27: 479-490.
Lees P., Landoni M., Giraudel J. & Toutain P. PK-PD integration and PK-PD modeling of nonsteroidal anti-inflammatory drugs: principles and applications in veterinary pharmacology. Journal of Veterinary Pharmacology and Therapeutics
(2004b) 27: 491-502.
Lenczowski M., Van Dam A., Poole S., Larrick J. & Tilders F. Role of circulating
endotoxin and interleukin-6 in the ACTH and corticosterone response to intraperitoneal LPS. American Journal of Physiology (2007) 273: 1870-1877.
Luheshi G. Cytokines and fever Mechanisms and sites of action. Annals New York
Academy of Sciences (1998) 83-89.
Mahmood I. Introduction to pharmacokinetics, In: Interspecies Pharmacokinetic
Scaling-principles and Application of Allometric Scaling, Mahmood I. (Ed.),
Pine House Publishers, Rockville, USA (2005) 1-14.
Martinez M. use of pharmacokinetics in veterinary medicine – volume, clearance
and half-life. Journal of the American Veterinary Medical Association (1998)
213: 122-1127.
41
Matsumura K. & Kobayashi S. Signaling the brain in inflammation: the role of endothelial cells. Frontiers in Bioscience: a journal and virtual library (2004)
9: 2819-2826.
Maxwell J., Ruby C., Kerkvliet N. & Vella A. Contrasting the role of costimulation
and the natural adjuvant lipopolysaccharide during the induction of T cell
immunity. Journal of Immunology (2002) 168: 4372-4381.
Mayeux P. Pathobiology of lipopolysaccharide. Journal of Toxicology and Environmental Health (1997) 51: 415-435.
McGeown D., Danburry T., Waterman-Pearson A. & Kestin S. Effect of carprofen
on lameness in broiler chickens. The Veterinary Record (1999) 144: 668-671.
Medzhitov R., Preston-Hurlburt P. & Janeway C. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature (1997) 388:
394-397.
Morimoto, A., Murakami, N., Nakamori, T., Watanabe, T.. Evidence for separate
mechanisms of induction of biphasic fever inside and outside the blood-brain
barrier in rabbits. Journal of Physiology (1987) 383: 629-637.
Morrison D. & Ryan J. Endotoxins and disease mechanisms. Annual Review of Medicine (1987) 38: 417-432.
Nair M. The early inflammatory reaction in the fowl. A light microscopical, ultrastructural and audiographic study. Acta Veterinaria Scandinavica supplementum
(1973) 1-103.
Netea M., Kullberg B. & Van der Meer J. Circulating cytokines as mediators of fever.
Clinical Infectious Diseases (2000) 31: S178-184.
Osiri M. & Moreland L. Specific cyclo-oxygenase 2 inhibitors: a new choice of nonsteroidal anti-inflammatory drug therapy. Arthritis Care and Research (1999)
12: 351-362.
Pecchi E., Dallaporta M., Jean A., Thirion S. & Troadec J. Prostaglandins and sickness behavior: old story, new insights. Physiology & behavior (2009) 97: 279292.
Poli-de-Figueiredo L., Garrido A., Nakagawa N. & Sannomiya P. Experimental models of sepsis and their clinical relevance. Shock (2008) 30: 53-59.
42
Pollock C., Carpentier J., Koch D. & Hunter R. Single and multiple-dose pharmacokinetics of tepoxalin and its active metabolite after oral administration to rabbits
(Oryctolagus cuniculus). Journal of Veterinary Pharmacology and Therapeutics
(2008) 31: 171-174.
Poltorak A., He X., Smirnova I., Liu M., Huffel C., Du X., Birdwell D., Alejos E.,
Silva M., Galanos C., Freudenberg M., Ricciardi-Castagnoli P., Layton B. &
Beutler B. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science (1998) 282: 2085-2088.
Raetz C., Brozek K., Clementz T., Coleman J., Galloway S., Golenbock D. & Hampton R. Gram-negative endotoxin: A biologically active lipid. Cold Spring Harbor Symposia on Quantitative Biology (1988) LIII: 973-982.
Remick D. & Ward P. Evaluation of endotoxin models for the study of sepsis. Shock
(2005) 24: 7-11.
Rietschel E., Kirikae T., Schade F., Ulmer A., Holst O., Brade H., Schmidt G., Mamat
U., Grimmecke H., Kusumoto S. & Zähringer U. The chemical structure of bacterial endotoxin in relation to bioactivity. Immunobiology (1993) 187: 169-190.
Rietschel E., Kirikae T., Schade F., Mamut U., Schmidt G., Loppnow H. Ulmer A.,
Sähringer U., Seydel U., Di Padova F., Schreier M. & Brade H. Bacterial endotoxin: molecular relationship of structure to activity and function. FASEB Journal (1994) 8: 217-225.
Ringler D. Inflammation and repair. In: Veterinary pathology sixth edition, ed. Jones
TC, Hunt RD, King NW. Williams & Wilkins, Maryland, US (1996) 113.
Sass G., Heinlein S., Agli A., Bang R., Schümann J & Tiegs G. Cytokine expression
in three mouse models of experimental hepatitis. Cytokine (2002) 19: 115-120.
Stillborn H., Harris G., Bottje W. & Waldroup P. Ascorbic acid and acetylsalicylic
acid (aspirin) in the diet of broilers maintained under heat stress conditions.
Poultry Science (1988) 67: 1183-1187.
Rang H., Dale M., Ritter J. & Moore P. Pharmacology, fifth edition, ed. Hunter L.,
Churchill Livingstone, Elsevier Science, London, UK (2003).
Rickets A., Lundy K. & Seibel S. Evaluation of selective inhibition of canine cyclooxygenase 1 and 2 by carprofen and other nonsteroidal anti-inflammatory
drugs. American Journal of Veterinary Research (1998) 59: 1441-1446.
43
Riviere J. Comparative pharmacokinetics – Principles, technique and applications,
Iowa State University Press, Ames, USA (1999).
Riviere J. Craigmill A. & Sundlof S. Handbook of comparative pharmacokinetics and
residues of veterinary antimicrobials, Boca Raton, Florida, USA (1991) 1-27.
Rowland M. & Tozer T. Clinical pharmacokinetics – Concepts and applications, 3th
Edition, Williams and Wilkins, Hagerstown, USA (1995).
Sell K.M., Crowe S.F. & Kent S. Lipopolysaccharide induces memory-processing
deficits in day-old chicks. Pharmacology, Biochemistry and Bevaviour
(2001) 68: 497-502.
Semrad S. Comparative efficacy of flunixin, ketoprofen, and ketorolac for treating
endotoxemic neonatal calves. American Journal of Veterinary Research
(1993) 54: 1511-1516.
Shrivastava A., Vegad J. & Katiyar A. Inflammatory response of skin autografting in
the chicken. Indian Journal of Animal Sciences (1997) 67: 387-390.
Sinha B., Vegad J., Awadhiya R. Pathology of concanavalin A-induced cutaneous
reaction in the chicken. Research in Veterinary Science (1987) 42: 365-372.
Skarnes R., Brown S., Hull S., McCracken J. Role of prostaglandin E in the biphasic
fever response to endotoxin. The Journal of Experimental Medecine (1981) 154:
1212-1224.
Swan G., Short C. & Tubbesing U. Nonsteroidal anti-inflammatory drugs in domestic
animals: II disposition and clinical indications. Journal of the South African Veterinary Association (1995) 66: 35-41.
Takada H. & Kotani S. Structural requirements of lipid A for endotoxicity and other
biological activities. CRC Critical Reviews in Microbiology (1989) 16: 477-523.
Takimoto T., Sato K., Akiba Y. & Takahashi K. Role of chicken TL1A on inflammatory responses and partial characterization of its receptor. The Journal of Immunolgy (2008) 180: 8327-8332.
Takahashi K., Yodogawa S. & Akiba Y. Effect of dietary protein concentration on
responses to Escherichia coli endotoxin in broiler chickens. British Journal of
Nutrition (1995) 74: 173-182.
Tegeder I., Pheilschifter J. & Geisslinger G. Cyclooxygenase-independent actions of
cyclooxygenase inhibitors. The FASEB Journal (2001) 15: 2057-2072.
44
Tobias P., Tapping R. & Gegner J. Endotoxin interactions with lipopolysaccharideresponsive cells. Clinical Infectious Diseases (1999) 28: 476-481.
Tohjo H, Miyoshi F, Uchida E, Niyama M. Polyacrylamide Gel Electrophoretic Patterns of Chicken Serum in Acute inflammation induced by intramuscular injection of Turpentine. Poultry Science (1995) 74: 648-655.
Toutain P. & Bousquet –Mélou A. Bioavailability and its assessment. Journal of Veterinary Pharmacology and Therapeutics (2004a) 27: 455-466.
Toutain P. & Bousquet –Mélou A. Plasma terminal half-life. Journal of Veterinary
Pharmacology and Therapeutics (2004b) 27: 427-439.
Toutain P. & Bousquet –Mélou A. Volumes of distribution. Journal of Veterinary
Pharmacology and Therapeutics (2004c) 27: 441-453.
Toutain P. & Bousquet –Mélou A. Plasma clearance. Journal of Veterinary Pharmacology and Therapeutics (2004d) 27: 415-425.
Tozer T. & Rowland M. Introduction to pharmacokinetics and pharmacodynamics:
the quantitative basis of drug therapy, William and Williams, Hagerstown, USA
(2006).
Tsuboi I., Tanaka H., Nakao M., Shigeki S. & Itoh K. Nonsteroidal anti-inflammatory
drugs differentially regulate cytokine production in human lymphocytes: upregulation of TNF, IFN-γ and IL-2, in contrast to downregulation of IL-6 production. Cytokine (1995) 4: 372-379.
Ulevitch R. Therapeutics targeting the innate immune system. Nature (2004) 4: 512520.
Vegad JL, Katiyar AK. The acute inflammatory response in the chicken. Veterinary
Bulletin (1995) 65: 399-409.
Valle K., Diaz-Cruz A., Avila E., Guinzberg R. & Piña E. Antioxidant action of piroxicam on liver, heart and lung in broiler chicks. Journal of Veterinary Pharmacology and Therapeutics (2001) 24: 291-293.
van de Waterbeemd H. & Gifford E. ADMET is silico modelling: towards prediction
paradise? Nature Reviews Drug Discovery (2003) 2: 192-204.
Vane J. and Botting R. Mechanism of action of nonsteriodal anti-inflammatory drugs.
The American Journal of Medicine (1998) 104: 2-8
45
Vermeulen B., Peek H., Remon J. & Landman W. Effect of ibuprofen on coccidiosis
in broiler chickens. Avian Diseases (2004) 48: 68-76.
Veys E. 20 years‟ experience with ketoprofen. Scandinavian Journal of Rheumatology
(1991) 90: 3-44.
Weissmann G. The actions of NSAIDs. Hospital Practice (1991) 15: 60-76.
White K., Kaltashov I., Cotter R. & Raetz C. A mono-functional 3-deoxy-D-mannooctulosonic acid (Kdo) transferase and a Kdo kinase in extracts of Haemophilus
influenzae. The Journal of Biological Chemistry (1997) 272: 16555-16563.
Wilkinson M. & Kasting N. Central vasopressin V1-blockade prevents salicylate but
not acetaminophen antipyresis. Journal of applied physiology (1990) 68: 17931798.
Witkamp R. & Monshouwer M. Signal transduction in inflammatory processes, current and future therapeutic targets: a mini review. The Veterinary Quarterly
(2000) 22: 11-16.
Wright A. & Kanegasaki S. Molecular aspects of lipopolysaccharides. Physiological
Reviews (1971) 4: 748-784.
46
Part II
Aims
47
48
Aims of the study
In Belgium nonsteroidal anti-inflammatory drugs are not available for poultry. Although in practice, some NSAIDs are used in avian species to prevent heat stress or
reduction of feed intake in case of illness. However, the benefit of these treatments is
difficult to evaluate due to lack of validated pharmacological studies. A commonly
used model in human and veterinary research to understand the inflammatory process
and to study the pharmacodynamic properties of NSAIDs, is a lipopolysaccharide induced inflammation model. This model can be influenced by several factors like, the
age of the animal, environment and dose of LPS, so standardization is a key feature to
develop a reproducible inflammation model. Furthermore, reliable parameters need to
be determined to identify the mediators involved in inflammation and to evaluate the
effects of NSAIDs.
The first aim of this thesis was to develop a reproducible LPS inflammation model in
broiler chickens and to identify the influence of age and repeated contact with LPS on
this model.
Since few tools are commercially available for poultry it was a challenge to develop
appropriate analytical methods for analysis of cytokines in the LPS inflammation
model. Using the developed techniques, we aimed to further characterize the inflammation model.
For an NSAID to optimally exert its anti-inflammatory effect, it should be administered at a correct time and dose. Therefore, our next goal was to determine the pharmacokinetic properties of the NSAIDs which can be used in the model.
Finally, we intented to test the pharmacodynamic properties of some NSAIDs in the
inflammation model.
49
50
Part III
Development of an intravenous
LPS inflammation model in chickens
51
Chapter 1 Factors influencing the response to
LPS
Adapted from
De Boever S., Beyaert R., Vandemaele F., Baert K., Duchateau L., Goddeeris B.,
De Backer P. & Croubels S. The influence of age and repeated lipopolysaccharide
administration on body temperature and the concentration of interleukin-6 and IgM
antibodies against lipopolysaccharide in broiler chickens. Avian Pathology (2008) 37:
39-44.
52
Abstract
Our objective was to create a standardized and reproducible inflammation model in
chickens in order to study the pharmacodynamics of several anti-pyretic and antiinflammatory drugs.
We studied the influence of age and repeated lipopolysaccharide (LPS) administration
on body temperature and the correlation of this with concentrations of interleukin 6
(IL-6) and IgM antibodies against LPS in plasma of chickens. Three and five week
old broilers were injected intravenously with LPS from Escherichia coli O127: B8 at
a dose of 1 mg/kg. LPS administration was repeated after 2 or 7 days. After the first
dose of LPS, the body temperature was initially decreased below normal and then
later increased above normal. The second dose of LPS reduced the level of hypothermia and the duration of the febrile phase. Three-week-old birds responded to LPS
with a higher maximum body temperature and a greater area under the body temperature versus time curve than five-week-old chickens (P<0.05). Interleukin-6 reached its
highest concentration 3 hours after LPS administration and returned to baseline levels
after 9 hours. A second dose of LPS resulted in a significantly lower peak in IL-6.
Significant higher levels of antibodies against LPS could be detected 7 days after LPS
administration. However, there appeared to be no correlation between the reduced
response to LPS and the presence of antibodies.
53
1.
Introduction
Our objective was to create a standardized and reproducible inflammation model in
chickens in order to study the pharmacodynamics of several anti-pyretic and antiinflammatory drugs.
Lipopolysaccharide (LPS), a component of the cell wall of Gram-negative bacteria, is
commonly used to induce an acute phase reaction in humans and animals because of
its proinflammatory properties (Skarnes et al., 1981; Morimoto et al., 1987; Klosterhalfen et al., 1992; Erroi et al., 1993; Semrad, 1993; Franco et al., 2000; Maxwell et
al., 2002; Haudek et al., 2002). LPS, in combination with CD14, interacts with TollLike Receptor 4 (TLR4), leading to the activation of Nuclear Factor κB and expression of inflammatory genes (Dil and Qureschi, 2002; Doyle and O‟Neill, 2006). Several parameters can be determined to evaluate the progress of an acute phase reaction,
including body temperature, and cytokine and acute phase protein concentrations.
Body temperature responses after LPS administration can vary dramatically. Jones et
al. (1981) and Baert et al. (2005) described a biphasic temperature reaction after LPS
administration in 5 week old commercial broilers. Leshchinsky and Klasing (2001)
found a significant difference in the body temperature responses after LPS administration between broilers and layers. Smith et al. (1978) injected 14-day-old chickens with
LPS for one, three or six consecutive days. Body temperature was measured at 1, 2, 3,
4, 6, 24 and 48 hours after the last injection and the patterns seen included hypothermia, hypothermia followed by hyperthermia, and hyperthermia without hypothermia,
respectively. These variations could be attributable to differences in ambient temperature, dosage, prior sensitization, age, route of administration or genetic line (Jones et
al., 1983; Cheng et al., 2004). Significantly, higher concentrations of interleukin-6
(IL-6) in plasma, and IL-6, IL-8, IL-18, IL-1β, myelomonocytic growth factor (MGF)
and interferon-γ (IFNγ) in spleen cells, can be seen after LPS administration (Nakamura et al., 1998; Xie et al., 2000; Sijben et al., 2003; Leshchinsky & Klasing, 2003).
Alpha-1 acid glycoprotein, ceruloplasmin, transferrin, fibronectin and serum amyloid
A are important acute phase proteins in serum that are known to increase in concentration in poultry during an inflammatory response (Curtis & Butler, 1980; Nakamura et
al., 1998; Takahashi et al., 1998; Chamanza et al., 1999). Repeated administration of
54
LPS reduces the response, but the mechanisms responsible for this phenomenon have
not yet been elucidated. Several mechanisms have been suggested, including the suppression of activation of NF-κB and a high proportion of non-transactive p50
homodimers, upregulation of soluble TNF receptor 1, which binds and clears TNF,
modulation of Toll-Like Receptor expression, and increased expression of intracellular mediators involved in negative regulation of TLR signalling as well as a decrease
in TLR4 tyrosine phophorylation (Qu et al., 2003; Wang et al., 2004; Medvedev et
al., 2006; Medvedev et al., 2007). The reduced response to LPS comprises two
phases: the early phase, which is a refractory state evident within hours after LPS administration and which lasts for up to one week, and the late phase, which occurs only
after weeks to months and which is restricted to the LPS serotype used for initial injection. Experiments in guinea pigs and rats demonstrate that attenuation of the febrile
response after repeated LPS administration is associated with reduced production of
cytokines, such as IL-1β, IL-6 and TNF-α (Zeisberger & Roth, 1998; Medvedev et al.,
2006).
The aims of this study were to investigate the influence of age and repeated LPS administration on body temperature and the correlation of this with concentrations of IL6 and anti-LPS IgM antibodies in the plasma of unvaccinated broiler chickens.
55
2.
Materials and methods
2.1. Animals
Sixty one-day-old, unvaccinated, Ross chicks of both sexes were obtained from a
commercial hatchery. For the first two weeks all chicks were housed together. Temperature and relative humidity accorded with the requirements of young chickens and
temperature was adjusted to prevent huddling (ETS 123, 2004). Just before the start of
the experiment, the chickens were placed into 5 cages, with each cage containing
twelve randomly selected birds. The cages had a floor area of 1 m² and had a 1 m high
wooden frame covered with wire. The concrete floor was covered with wood shavings, which were changed every 2 days. Before entering the room containing the
cages, staff decontaminated their footwear and put on a clean laboratory coat. The
lighting schedule consisted of 12 hours dark and 12 hours light. Commercial pullet
feed and spring water were available ad libitum. All experiments and procedures were
approved by the Ethics Committee of the Faculty of Veterinary Medicine (EC
2005/06).
2.2. Experimental design
The experiment was designed as a split plot, with the cage being a block. Each block
(cage) contained 12 animals, 6 three-week-old chickens and 6 five-week-old chickens.
Within each of the two age groups, two animals were assigned to receive LPS at day 0
and day 2, two animals were assigned to receive LPS at day 0 and day 7, one control
animal received saline at day 0 and day 2, and a second control animal received saline
at day 0 and day 7.
LPS from Escherichia coli O127: B8 (Sigma-Aldrich, Bornem, Belgium) dissolved in
0.9% saline was administered by intravenous injection at a dose of 1 mg/kg. The control animals were injected with the same amount of saline. Freshly dissolved LPS
from the same batch was used for each experiment. The endotoxin level in this batch
was 1,500,000 units/mg. Body temperature was measured by inserting a thermocouple
probe (Physitemp Instruments Inc., Clifton, NJ, USA) 5 cm into the cloaca, before and
at 1, 2, 3.5, 5, 6.5, 8, 12 and 24 h after LPS administration. The reading was taken
after one minute contact with the mucosa. The area under the body temperature versus
56
time curve (AUC0→24h) was calculated in order to evaluate possible effects of age
and/or treatment. Other responses calculated were the mean body temperature
(meanT), the maximum temperature (maxT) and the time at which the maximum temperature was reached (Tmax).
Blood was withdrawn into heparinised tubes (Venoject®, Terumo Corp., Tokyo, Japan) from the leg vein before and at 3, 6, 9, 12 and 24 h after LPS administration to
determine IL-6 concentrations. Just before the first and second LPS dose, blood was
withdrawn for the determination of the concentration of IgM antibodies against LPS.
Plasma was separated by centrifugation (1100g for 10 min. at 5°C) and samples were
stored at -20°C until assayed.
2.3. Measurement of IL-6
Concentrations of IL-6 were measured using IL-6 dependent murine 7TD1 hybridoma
cells (Van Snick et al., 1986). Briefly, cells were cultured in 96 well microtitre plates
for 72 h in medium containing different dilutions of the plasma samples. A colorimetric hexosaminidase assay was used to assess the number of living cells, which is related to the amount of IL-6 in the media (Landegren, 1984). The concentration of IL-6
in plasma samples was calculated from a standard curve obtained using dilutions of
recombinant mouse IL-6. The results were corrected for differences in the responses
of the 7TD1 cells to mouse and chicken IL-6 standards, with mouse IL-6 being twice
as active as chicken IL-6 (data not shown). The IL-6 data were logarithmically transformed to normalise the distribution (Snedecor & Cochran, 1989). The plasma IL-6
concentrations were compared 3 h after the administration of LPS or saline, as this
was the time point at which the IL-6 concentration was highest.
2.4. Measurement of anti-LPS IgM antibodies
ELISA plates containing 150 µl LPS solution per well (30 µg/ml in bicarbonate buffer
at pH 9.6, using the same LPS that was used to inoculate the birds) were incubated
overnight at 4 °C. Plates were washed three times with PBST (phosphate buffered
saline (PBS) containing 0.01 % (v/v) Tween 20) and blocked with 5 % bovine serum
albumin (BSA) in PBS for 1 h at 37 °C. Plates were washed and plasma from experimental birds (at 1/100 and 1/400 dilutions in 0.5 % BSA-PBST) added to the wells,
57
then incubated for 1 h at room temperature. Subsequently, the plates were washed
three times with PBST and horseradish peroxidase (HRP)-labelled goat-anti-chicken
IgM antibody added to each well (Bethyl, Montgommery Texas, USA; 1/5000 in 0.5
% BSA-PBST), and incubated for 1 h at room temperature. After washing, bound
HRP was detected using 2,2'-azino-di(3-ethylbenzythiazolin-6-sulfinic) acid (ABTS)
(KPL, Gaithersburg, Maryland, USA) and absorbances were measured at 405 nm using a Titertek microplate reader (MCC/340 Multiskan, Titertek, Alabama, USA).
Negative controls (no chicken plasma, 0.5% BSA-PBST) were included on each plate.
The mean of duplicate wells was determined and the value obtained for the negative
control was subtracted from this.
2.5. Statistical analysis
All analyses of the different body temperature variables (AUC0→24h , meanT, maxT
and Tmax), IL-6 (log transformed) and IgM were based on a mixed model with cage
and animal within cage as the random effect and treatment, age and their interaction
as categorical fixed effects (SAS Version 9.1). The treatment factors included saline at
day 0, saline at day 2, saline at day 7, LPS at day 0, LPS at day 2 and LPS at day 7. A
global test was performed at the 5% significance level for the treatment and age effects and their interaction. If the interaction was significant, separate analyses were
performed for the two age categories. The following contrasts were of interest: the
overall difference between controls and LPS treated birds, the difference between controls and LPS treated birds at day 0, the difference between controls and LPS treated
birds at day 2, between controls and LPS treated birds at day 7, between birds treated
with LPS at day 0 and day 2, between birds treated with LPS at day 0 and day 7 and
between birds treated with LPS at day 2 and day 7. Each of these comparisons was
tested within the framework of the mixed model at a comparison wise Bonferroniadjusted significance level of 0.0071 (0.05/7). The use of the mixed model implies
that the contrasts are tested at the appropriate level. For example, the effect of age is
tested by comparing chickens of different ages using cage as a block factor, whereas
the difference between LPS administration at day 0 and day 2 is tested within a
chicken, as these two treatments were applied to the same chicken. Additional analy-
58
ses, also based on the mixed model, were done to investigate whether IgM concentrations at day 0 differed significantly between three- and five-week-old chickens.
3.
Results
The global statistical analysis revealed a significant influence of the age of the birds
on the reaction to LPS (P<0.05). Therefore, more detailed analyses were performed
for each of the two age categories.
3.1. Body temperature
After LPS administration, the body temperature was initially below normal and then
was later above normal after both the first and second LPS doses in both three- and
five-week-old birds. The second LPS administration reduced the hypothermic phase
of the temperature curve and the duration of the fever phase, as shown in Figure 1.
The graph of the body temperature of the control birds was obtained by averaging the
measurements for all three-week-old control birds. Although similar results were obtained for both age groups, three-week-old birds had a higher maxT after LPS administration. The AUC0→24h and maxT of three-week-old and five-week-old birds are
shown in Tables 1 and 2.
Figure 1: Mean (+ SD) body temperature versus time plot after a first and second dose of
LPS in chickens at the age of 3 weeks (1st challenge n=20, 2nd challenge n=10, control n=
20). The second dose of LPS was administered 2 or 7 days after the first dose of LPS.
59
Table 1: Differences in AUC0→24h and maxT after the first and second dose of LPS in chickens
at the age of 3 weeks.
AUC0→24h ± SD (°C x h)
Day 0
maxT ± SD (°C)
LPS
Control
LPS
Control
1002.9 ± 1.1A
994.6 ± 1.5C
42.39 ± 0.06A
41.85 ± 0.08C
992.8 ± 1.6B
993.6 ± 2.1B
42.03 ± 0.09B
41.64 ± 0.11C
996.7 ± 1.5B
992.8 ± 2.1B
42.34 ± 0.08A
41.56 ± 0.11C
(n=20)
Day 2
(n=10)
Day 7
(n=10)
Means with different superscript letters are significantly different at P<0.0071 (0.05/7)
Table 2: Differences in AUC0→24h and maxT after a first and second LPS challenge in chickens at
the age of 5 weeks.
AUC0→24h ± SD (°C x h)
Day 0
maxT ± SD (°C)
LPS
Control
LPS
Control
995.1 ± 1.0A
987.9 ± 1.5B
42.16 ± 0.06A
41.55 ± 0.08B
995.5 ± 1.5A
993.4 ± 2.1A
42.08 ± 0.08A
41.75 ± 0.11A
992.0 ± 1.5A
989.3 ± 2.1A
42.15 ± 0.08A
41.62 ± 0.11B
(n=20)
Day 2
(n=10)
Day 7
(n=10)
Means with different superscript letters are significantly different at P<0.0071 (0.05/7)
60
3.2. IL-6
The concentrations of IL-6 in plasma after the first and second doses of LPS in threeweek-old birds are shown in Figure 2. The graph of IL-6 concentrations in control
birds was obtained by averaging the measurements for all three-week-old control
birds.
The concentration of IL-6 was significantly higher after the first dose of LPS, peaking
3 h after administration and returning to baseline levels 9 h after administration in
both three-week-old and five-week-old birds (P<0.0001). As three h was the first
sampling point, this may not be the true peak for IL-6. IL-6 concentrations were significant lower after the second dose of LPS in both ages of birds, irrespective of
whether the LPS was administered after a 2 or 7 day interval.
*
*
Figure 2: Plasma IL-6 concentrations (mean + SD) after a first and second dose of LPS in chickens at the age of 3 weeks (1st challenge n=20, 2nd challenge n=10, control n= 20). Means with an
asterisk differ significantly from those of the control group (P<0.0001). The second LPS dose was
administered 2 or 7 days after the first dose.
61
3.3. IgM concentrations
Significantly higher concentrations of IgM antibodies against LPS could be detected 7
days after the first dose of LPS in both age groups (P<0.0001). Before the first dose of
LPS three-week-old birds did not have detectable concentrations of IgM against LPS,
with the absorbances in the ELISA below the threshold level of 0.222. Two days after
the first dose there was a detectable increase in IgM antibodies against LPS, although
the concentrations were not significantly different from those seen in the control
group.
Before the second dose at day 7 the three-week-old control birds had detectable concentrations of IgM against LPS. The five-week-old birds had detectable concentrations of IgM against LPS before the first dose of LPS was administered.
62
4.
Discussion
Intravascular administration of minimal doses of LPS elicits monophasic fevers, a
moderate dose is known to produce biphasic fevers, and high doses of endotoxin elicit
persistent hypothermia (Skarnes et al., 1981; Lang et al., 1985; Morimoto et al., 1987;
Massart-Leën et al., 1992). Chickens are very resistant to the deleterious effects of
LPS and since ambient temperature, dosage, prior sensitization, age, route of administration, serotype and genetic line may be involved in the febrile response to endotoxin, it is very difficult to compare different studies (Berczi et al., 1966; Adler &
Damassa, 1978; Jones et al., 1983; Dogan et al., 2000; Cheng et al., 2004).
Smith et al. (1978) reported the attenuation of hypothermia after repeated intravenous
injection of 14 day old chickens with endotoxin from Salmonella gallinarum at a dose
of 15 mg/kg. The first injection of LPS produced hypothermia. When LPS was given
for 3 consecutive days, hypothermia was followed by hyperthermia. After six consecutive doses of LPS there was no hypothermia, only hyperthermia. A fall in body
temperature was also demonstrated by Pittman et al. (1976) after intravenous administration of endotoxin from Salmonella abortus equi to female Leghorn chickens, but
the temperature was only recorded for 180 min after administration. Jones et al.
(1981) injected five-week-old commercial broiler cockerels intravenously with LPS
from the same serotype of E. coli that we used in our study and demonstrated a biphasic febrile response. Baert et al. (2005) saw similar response. Fraifeld et al. (1995)
saw a peak in body temperature 3 hours after intraperitoneal administration of 1 mg of
E. coli O127:B8 LPS (corresponding to 0.8 mg/kg) to three-week-old chickens. In our
study the same serotype and dose of LPS as was used by Jones et al. and Baert et al.
was injected into broiler chickens. In contrast to their findings, we saw a monophasic
febrile response that was preceded by hypothermia. After the second dose of LPS, the
hypothermia, and the length of the febrile phase, was attenuated. A possible explanation for these differences could be variation in the endotoxin concentration in the different batches of LPS. The concentration of endotoxin in LPS from E. coli O127:B8
(Sigma-Aldrich) can vary from 500,000 to 2,250,000 units per mg. For this reason we
used LPS from the same batch for the whole experiment. The febrile response following endotoxin administration is also affected by age. In the study of Jones et al. (1983)
63
broiler cockerels of 1-8 weeks of age received an intravenous injection of E. coli
O127:B8. Seven and eight week old birds developed the highest and most persistent
fever. Younger birds had lower increases in body temperature, after an initial hypothermic response. In contrast we found that older birds had a less pronounced reaction
to LPS. Gregorut et al. (1992) injected 10- to 50-day-old birds with LPS from E. coli
O122:B8 and S. typhimurium. They found no significant effect of age on the febrile
response, but there was a slight tendency towards a reduced peak in fever and a more
rapid response with increasing age.
In our study, ambient temperature was adjusted according to animal behaviour and
ethical guidelines. Three-week-old chickens housed at temperatures below their thermoneutral zone did not develop fever (unpublished data).
Repeated administration of LPS results in a reduced response, characterized by a decrease in immune responses (e.g. the production of a variety of cytokines) and metabolic changes (e.g. fever, weight loss, shock and mortality). The reduced response to
LPS comprises two phases. The early phase results in a down-regulation of monocyte
and macrophage function and is evident within hours after LPS administration. Repeated administration of LPS leads to attenuation of almost all pathophysiological
effects mediated by proinflammatory cytokines. In guinea pigs and rats, the reduced
response to LPS consists of attenuation of the febrile response and is associated with a
reduced production of cytokines (Zeisberger & Roth, 1998; Medvedev et al., 2006).
IL-6, IL-1β and TNF-α have been implicated as key mediators of fever in several
animal models. IL-1β, IL-6 and other cytokines have been characterized as endogenous pyrogens or fever-inducers (Leon et al., 1999). Changes in IL-6 concentration
are believed to follow the course of the body temperature changes. In guinea-pigs the
peak of the IL-6 activity and the febrile phase coincide (Roth et al., 1994). In our
study the concentration of IL-6 peaked at 3 hours after LPS administration and preceded the febrile phase, returning to baseline concentrations 9 hours after LPS administration. The peak IL-6 concentration in plasma was significantly lower after the
second dose of LPS, demonstrating a reduced response to LPS. Nakamura et al.
(1998) injected 2 week old birds with LPS from E. coli and detected the highest concentrations of IL-6 at 3 h after LPS administration, but the concentrations remained
high for 2 days after LPS administration. After administration of LPS from S. typhi64
murium at a dose of 5 mg/kg to broiler chickens, the IL-6 concentration in plasma was
elevated at 12 and 24 hours (Xie et al., 2000). The attenuation of the IL-6 concentrations in plasma in LPS-tolerant chickens is similar to that seen in LPS-tolerant mice,
in which the induction of IL-6 and other cytokines is extremely low (Erroi et al.,
1993). In guinea-pigs repeated intramuscular injection of LPS reduced the peak in IL6 concentrations in plasma at 3 hours after administration (Roth et al., 1994).
The late phase is characterized by the production of anti-LPS antibodies and occurs
weeks or months after LPS administration. The antibodies are directed against the O
chain of LPS, so in the late phase there is no cross-tolerance between different LPS
serotypes (Zeisberger & Roth, 1998; Medvedev et al., 2006). In our study, the first
dose of LPS induced the production of IgM antibodies in plasma. The five-week-old
birds had IgM antibodies against LPS prior to administration of LPS. These antibodies
were most probably induced by intestinal E. coli, which are present in every animal.
The existence of such naturally occurring antibodies against LPS has been demonstrated in several animal species, including chickens and mice (Reid et al., 1997;
Hangalapura et al., 2003; Siwek et al., 2006), with the concentration increasing with
age (Parmentier et al., 2004). Siwek et al. (2006) demonstrated an increase in antibodies against LPS between the ages of 5 and 18 weeks in layer birds. This is in accordance with our findings in three- and five-week-old broilers. These antibodies are often dismissed in immunological analyses as “background” and their role remains unclear. One of the possibilities is that they may be involved in the clearance of LPS
(Ochsenbein et al., 1999). However, in our experiment there seemed to be no correlation between the reduced response to LPS and the presence of antibodies, as a second
dose of LPS reduced the reaction against LPS irrespective of whether it was administered after 2 or 7 days. As in mice, it could be suggested that factors other than antibodies play a critical role in this reduced response against endotoxin, including the
production of anti-inflammatory cytokines and upregulation of inhibitory molecules
that prevent intracellular Toll-Like receptor 4 signalling (Cavaillon & Adib-Conquy,
2006).
65
In conclusion, we developed a reproducible and standardized model of LPS-induced
inflammation in broiler chickens. A second administration of LPS reduced the hypothermic phase of the body temperature-time curve and the duration of the febrile
phase, at both three and five weeks of age. Moreover, after a second challenge with
LPS the peak in concentration of IL-6 was significantly decreased. Antibodies did not
seem to play a role in the reduced response to LPS.
Acknowledgements
The authors would like to thank Wilma Burm and Aeke Vandenbroeke for the help
with the IL-6 assay and Dieter De Clercq for excellent technical assistance in the animal experiments.
66
References
Adler H.E. & Damassa A.J. Toxicity of endotoxin to chicks. Avian Diseases (1978)
23 : 174-178.
Baert K., Duchateau L., De Boever S., Cherlet M. & De Backer P. Antipyretic effect
of oral sodium salicylate after an intravenous E. coli LPS injection in broiler
chickens. British Poultry Science (2005) 46: 137-143.
Berczi I., Bertόk L. & Bereznai T. Comparative studies on the toxicity of Escherichia
coli lipopolysaccharide endotoxin in various animal species. Canadian Journal
of Microbiology (1966) 12: 1070-1071.
Cavaillon J.M. & Adib-Conquy M. Bench-to-bedside review: Endotoxin tolerance as
a model of leukocyte reprogramming in sepsis. Critical Care (2006) 10: 233.
Chamanza R., Toussaint M.J.M., van Ederen A.M., van Veen L., Hulskamp-Koch C.
& Fabri T.H.F. Serum amyloid A and transferring in chicken. A preliminary envestigation of using acute-phase variables to assess diseases in chickens. Veterinary Quarterly (1999) 21: 158-162.
Cheng H.W., Freire R. & Pajor E.A. Endotoxin stress responses in chickens from different genetic lines. 1. Sickness, behavioural, and physical responses. Poultry
Science (2004) 83: 707-715.
Curtis M.J. & Butler E.J. Response of caeruloplasmin to Escherichia coli endotoxins
and adrenal hormones in the domestic fowl. Research in Veterinary Science
(1980) 28: 217-222.
Dil N. & Qureshi M.A. Involvement of lipopolysaccharide related receptors and nuclear factor kappa B in differential expression of inducible nitric oxide synthase
in chicken macrophages from different genetic bachgrounds. Veterinary Immunology and Immunopathology (2002) 88: 149-161.
Dogan M.D., Ataoglu H. & Akarsu E.S. Effects of different serotypes of Escherichia
coli lipopolysaccharide on body temperature in rats. Life Sciences (2000) 67:
2319-2329.
Doyle S.L. & O'Neill L.A. Toll-like receptors: from the discovery of NFkappaB to
new insights into transcriptional regulations in innate immunity. Biochemical
Pharmacology (2006) 72: 1102-1113.
67
Erroi A., Fantuzzi G., Mengozzi M., Sironi M., Orencole S.F., Clark B.D., Dinarello
C.A., Isetta A., Gnocchi P., Giovarelli M. & Ghezzi P. Differential regulation of
cytokine production in lipopolysaccharide tolerance in mice. Infection and Immunity (1993) 61: 4356-4359.
ETS 123 Draft Appendix A of the European Convention for the Protection of Vertebrate Animals used for Experimental and other Scientific Purposes (ETS No.
123). (2004) Guidelines for accommodation and care of animals (Article 5 of the
Convention).
Fraifeld V., Blaicher-Kulick R., Allan Degen A. & Kaplanski J. Is hypothalamic prostaglandin E2 involved in avian fever? Life Sciences (1995) 56: 1343-1346.
Franco R.F., de Jonge E., Dekkers P.E.P., Timmerman J.J., Spek C.A., van Deventer
S.J.H., van Deursen P., van Kerkhoff L., van Gemen B., ten Cate H., van der
Poll T. & Reitsma P.H. The in vivo kinetics of tissue factor messenger RNA expression during human endotoxemia: relationship with activation of coagulation.
Blood (2000) 96: 554-559.
Gregorut F.P., Baptista L.C., Paulim A.S., Guerreiro J.R., Secato E.R. & Macari M.
Influence of age on the febrile response to E. coli and S. typhimurium endotoxins in growing pullets. British Poultry Science (1992) 33: 769-774.
Hangalapura B.N., Nieuwland M.G.B., de Vries Reilingh G., Heetkamp M.J.W., van
den Brand H., Kemp B. & Parmentier H.K. Effects of cold stress on immune responses and body weight of chicken lines divergently selected for antibody responses to sheep red blood cells. Poultry Science (2003) 82: 1692-1700.
Haudek S.B., Natmessing B.E., Fürst W., Bahrami S., Schlag G. & Redl H. Lipopolysaccharide dose response in baboons. Shock (2003) 20: 431-436.
Jones C.A., Edens F.W. & Denbow D.M. Influence of age on the temperature response of chickens to Escherichia coli and Salmonella typhimurium endotoxins.
Poultry Science (1983) 62: 1553-1558.
Jones C.A., Edens F.W. & Denbow D.M. Rectal temperature and blood chemical responses of young chickens given E. coli endotoxin. Poultry Science (1981) 60:
2189-2194.
68
Klosterhalfen B., Hörstmann-Jungemann K., Vogel P., Flohé S., Offner F., Kirkpatrick C.J. & Heinrich P.C. Time course of various inflammatory mediators during recurrent endotoxemia. Biochemical Pharmacology (1992) 43: 2103-2109.
Landegren U. Measurement of cell numbers by means of the endogenous enzyme
hexosaminidase. Applications of detection of lymphokines and cell surface antigens. Journal of Immunological Methods (1984) 67: 379-388.
Lang C.H., Bagby G.J. & Spitzer J.J. Glucose kinetics and body temperature after
lethal and nonlethal doses of endotoxin. American Journal of Physiology (1985)
248: R471-8.
Leon L.R., Kozak W., Rudolph K. & Kluger M.J. An antipyretic role for interleukin 10 in LPS fever in mice. American Journal of Physiology (1999) 276: R81-89.
Leshchinsky T.V. & Klasing K.C. Divergence of the inflammatory response in two
types of chickens. Developmental & Comparative Immunology (2001) 25: 629638.
Leshchinsky T.V. & Klasing K.C. Profile of chicken cytokines induced by lipopolysaccharide in modulated be dietary α-tocopharyl acetate. Poultry Science (2003)
82: 1266-1273.
Massart-Leën A.M., Burvenich C., Vandeputte-Van Messom G. & Hilderson H. Partial prostaglandin-mediated mechanism controlling the release of cortisol in
plasma after intravenous administration of endotoxins. Domestic Animal Endocrinology (1992) 9: 273-283.
Maxwell J.R., Ruby C., Kerkvliet N.I. & Vella A.T. Contrasting the role of costimulation and the natural adjuvant lipopolysaccharide during the induction of T cell
immunity. Journal of Immunology (2002) 168: 4372-4381.
Medvedev A.E., Sabroe I., Hasday J.D. & Vogel S.N. Tolerance to microbial TLR
ligands: molecular mechanisms and relevance to disease. Journal of Endotoxin
Research (2006) 12: 133-150.
Medvedev A.E., Piao W., Shoenfelt J., Rhee S.H., Chen H., Basu S., Wahl L.M., Fenton M.J. & Vogel S.N. Role of TLR4 tyrosine phophorylation in signal transduction and endotoxin tolerance. The Journal of Biological Chemistry (2007) 282:
16042-16053.
69
Morimoto A., Murakami N., Nakamori T. & Watanabe T. Evidence for separate
mechanisms of induction of biphasic fever inside and outside the blood-brain
barrier in rabbits. Journal of Physiology (1987) 383: 629-637.
Nakamura K., Mitarai Y., Koizumi N., Shibahara T. & Nakajima Y. Serum levels of
interleukin-6, α1-acid glycoprotein and corticosterone in two-week-old chickens
inoculated with Escherichia coli lipopolysaccharide. Poultry Science (1998) 77:
908-911.
Ochsenbein A.F., Fehr T., Lutz C., Suter M., Brombacher F., Hengartner H. & Zinkernagel R.M. Control of early viral and bacterial distribution and disease by
natural antibodies. Science (1999) 286: 2156-2159.
Parmentier H.K., Lammers A., Hoeckman J.J., De Vries Reilingh G., Zaanen I.T.A. &
Saverkoul H.F.J. Different levels of natural antibodies in chickens divergently
selected for specific antibody response. Developmental & Comparative Immunology (2004) 28: 39-49.
Pittman Q.J., Veale W.L., Cockeram W. & Cooper K.E. Changes in body temperature
produced by prostaglandins and pyrogens in the chicken. American Journal of
Physiology (1976) 230: 1284-1287.
Qu J., Zhang J., Pan J., He L., Ou Z., Zhang X. & Chen X. Endotoxin tolerance inhibits lipopolysaccharide-initiated acute pulmonary inflammation and lung injury in
rats by the mechanism of Nuclear Factor – κB. Scandinavian Journal of Immunology (2003) 58: 613-619.
Reid R.R., Prodeus A.P., Khan W., Hsu T., Rosen F.S. & Carroll M.C. Endotoxin
shock in antibody-deficient mice. Journal of Immunology (1997) 159: 970-975.
Roth J., McClellan J.L., Kluger M.J. & Zeisberger E. Attenuation of fever and release
of cytokines after repeated injections of lipopolysaccharide in guinea-pigs.
Journal of Physiology (1994) 477: 177-185.
Semrad S.D. Comparative efficacy of flunixin, ketoprofen, and ketorolac for treating
endotoxemic neonatal calves. American Journal of Veterinary Research (1993)
54: 1511-1516.
Sijben J.W.C., Klasing K.C., Schrama J.W., Parmentier H.K., van der Poel J.J., Savelkoul H.F. & Kaiser P. Early in vivo cytokine genes expression in chickens after challenge with Salmonella typhimurium lipopolysaccharide and modulation
70
by dietary n-3 polyunsaturated fatty acids. Developmental & Comparative Immunology (2003) 27: 611-619.
Siwek M., Buitenhuis B., Cornelissen S., Nieuwland M., Knol E.F., Crooijmans R.,
Groenen M., Parmentier H. & van der poel J. Detection of QTL for innate: Nonspecific antibody levels binding LPS and LTA in two independent populations
of laying hens. Developmental & Comparative Immunology (2006) 30: 1-8.
Skarnes R.C., Brown S.K., Hull S.S. & McCracken J.A. Role of prostaglandin E in
the biphasic fever response to endotoxin. The Journal of Experimental Medecine
(1981) 154: 1212-1224.
Smith I.M., Licence S.T. & Hill R. Haematological, serological and pathological effects in chicks of one or more intravenous injections of Salmonella gallinarum
endotoxin. Research in Veterinary Science (1978) 24: 154-160.
Snedecor G.W. & Cochran W.G. Statistical methods, Eight edition. (1989) Blackwell
publishing.
Takahashi K., Miyake N., Ohta T., Akiba Y. & Tamura K. Changes in plasma α1-acid
glycoprotein concentration and selected immune response in broiler chickens injected with Escherichia coli lipopolysaccharide. British Poultry Science (1998)
39: 153-155.
Van Snick J., Cayphas S., Vink A., Uyttenhove C., Coulie P.G., Rubira M.R. & Simpson R.J. Purification and NH2-terminal amino acid sequence of a T-cell-derived
lymphokine with growth factor activity for B-cell hybridomas. Proceedings of
the National Academy of Science of the United States of America (1986) 83:
9679.
Wang M., Meng X., Tsai B., Wang J., Turrentine M., Brown J.W. & Meldrum D.R.
Preconditioning up-regulates the soluble TNF receptor I response to endotoxin.
Journal of Surgical Research (2004) 121: 20-24.
Xie H., Rath N.C., Huff G.R., Huff W.E. & Balog J.M. Effects of Salmonella typhimurium lipopolysaccharide on broiler chickens. Poultry Science (2000) 79: 3340.
Zeisberger E. & Roth, J. Tolerance to pyrogens. Annals of the New York Academy of
Science (1998) 856: 116-131.
71
Chapter 2 Identification of appropriate housekeeping genes in an intravenous LPS inflammation
model in chickens
Adapted from
De Boever S.1, Vangestel C.1, De Backer P., Croubels S. & Sys S.U. Identification
and validation of housekeeping genes as internal control for gene expression in an
intravenous LPS inflammation model in chickens. Veterinary Immunology and Immunopathology (2008) 122: 312-317.
1
Both authors SDB and CV contributed equally to this article
72
Abstract
Real-time PCR has become a powerful tool for the detection of inflammatory parameters, including cytokines. Reference or housekeeping genes are used for the normalization of real-time RT-PCR results. In order to obtain reliable results, the stability of
these housekeeping genes needs to be determined. In this study the stability of five
genes, including β-actin, GAPDH, HPRT, ubiquitin (UB) and G6PDH, was determined in a lipopolysaccharide inflammation model in chickens. β-actin appeared to be
the most stable single gene in our model. Because the use of a single gene for normalization can lead to relatively large errors, the use of the geometric mean of multiple reference genes or normalization factor is preferred. The most stable combination
for gene expression analysis in this lipopolysaccharide inflammation model in chickens is G6PDH and UB, since their correlation coefficients were 0.953 and 0.969, respectively, (BestKeeper) and an M-value of 0.34 and a low V2/3 value of 0.155 (geNorm) were obtained. The use of HPRT and GAPDH should be avoided. The stable
housekeeping genes, G6PDH and UB together, can be used to normalize the expression of pro-inflammatory cytokines in a lipopolysaccharide inflammation model in
chickens.
73
1.
Introduction
In the characterization of the course of an inflammatory reaction, real-time PCR has
become a powerful tool for the detection of inflammatory parameters, including cytokines. This tool is particularly useful in chickens since commercial species-specific
antibodies directed against avian cytokines are not commonly available. Real-time
PCR is the most sensitive technique for the detection of often rare mRNA targets.
This technique combines accuracy, sensitivity, dynamic range and reproducibility
with speed and potential for high throughput (Bustin, 2000). However, in addition to a
careful reaction setup and optimization, accurate and reliable normalization to some
standard is strongly recommended (Bustin, 2002). Normalization is needed to control
for experimental error induced during the successive steps of RNA extraction and
processing (Huggett et al., 2005, Hendriks-Balk et al., 2007). One of the most common strategies for normalization is the use of an internal reference gene that is assumed to be stable between experimental groups. If the chosen reference gene has a
large variability or is altered by the experiment, however, then small changes may
remain undetected or the results obtained may be entirely incorrect. Consequently, the
use of a single reference gene is nowadays discouraged by more and more authors
(Vandesompele et al., 2002, Tricario et al., 2002, Huggett et al., 2005). Therefore, the
validation of potential reference genes is essential (Dheda et al., 2005).
The geNorm® program, developed by Vandesompele et al. (2002), calculates the
gene-stability measure M of one gene on the basis of the average pairwise variation
between all genes studied. BestKeeper, another Excel-based tool, calculates gene expression variation on the basis of raw crossing points (Cp) (Pfaffl et al., 2004).
The aim of the present study was to identify suitable housekeeping genes as an internal control to normalize the expression of genes of interest in an intravenous lipopolysaccharide (LPS) inflammation model in chickens. Two out of five candidate reference genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin had
been previously used in avian cytokine expression studies; glucose-6-phosphate dehydrogenase (G6PDH) and ubiquitin (UB) appeared stable in chickens after virus infection; and hypoxanthine phophoribosyl-transferase (HPRT) is a commonly used reference gene in several species (Xing and Schat, 2000; Rath et al., 2003; Li et al., 2006;
74
Hong et al., 2006). To determine the optimal combination of these candidate reference
genes, blood samples were analysed from LPS treated animals at 6 time points after
administration. This enabled us to follow the course of the inflammatory reaction
within the same bird.
2.
Materials and methods
2.1. Animals
Ten one-day-old Ross chicks of both sexes were obtained from a commercial hatchery. Since LPS is a common adjuvant in vaccines, non-vaccinated chicks were used to
avoid previous contact with LPS. The relative humidity accorded with the requirements of young chickens and the temperature was adjusted according to the animal‟s
behaviour.
The lighting schedule consisted of 12 hours dark and 12 hours light. Commercial pullet feed and spring water were available ad libitum during the experiment. Normal
hygienic measures were taken to avoid contact with pathogens. All experiments and
procedures were approved by the Ethics Committee of the Faculty of Veterinary
Medicine (2006/036).
2.2. Experimental design
The chickens were divided into 2 groups. At the age of 3 weeks, both groups were
injected with LPS of Escherichia coli O127: B8 (Sigma-Aldrich, Bornem, Belgium)
dissolved in NaCl 0.9% at a dose of 1.5 x 106 units/kg BW. Blood was withdrawn into
®
citrate containing tubes (Venoject , Terumo Corp., Tokyo, Japan) from the leg vein
after LPS administration. From the first group (n=5), 0.5 ml of blood was withdrawn
at 0.5, 1.5 and 2.5 hours after LPS administration. From the second group (n=5),
blood was withdrawn at 1, 2 and 3 hours after LPS administration.
2.3. RNA extraction from chicken whole blood
A volume of 0.5 ml blood was transferred into an Eppendorf (Novolab, Geraardsbergen, Belgium) containing 1 ml of RNA/DNA stabilization reagent for blood/bone
75
marrow (Roche Diagnostics, Vilvoorde, Belgium) and frozen at -20°C until RNA extraction.
Total RNA was extracted using a High Pure RNA Isolation Kit (Roche Applied Science, Vilvoorde, Belgium) according to the manufacturer‟s instructions. The RNA
concentration was measured by absorbance at 260 nm and the purity of the RNA sample was monitored by inspection of the 260/280 nm ratio using a spectrophotometer of
the type DU640B (Beckman, Suarlée, Belgium).
2.4. RT-PCR
The reverse transcription was performed using the Reverse Transcriptase Core kit
(Eurogentec, Seraing, Belgium), following the manufacturer‟s instructions. A fixed
amount of RNA (600 ng) from each sample was converted into cDNA in 30 µl, using
the random nonamer as priming method in the PTC-100 DNA engine (Bio-Rad Laboratories, Nazareth Eke, Belgium). As control samples, similar amounts of total RNA
of each sample were subjected to the cDNA synthesis protocol without the reverse
transcriptase. These are the minus RT control samples used in the real-time RT-PCR
assay to assess potential residual DNA contamination of each sample, despite the
DNase digestion of each sample. Genomic DNA contamination was assessed by a
real-time RT-PCR assay for UB on the minus RT samples.
2.5. Primer design
The primers were designed with the LightCycler Probe Design Software 2.0 (Roche
Applied Science) using the GenBank sequences for GAPDH, HPRT, β-actin and
G6PDH. The specific primer sequences are listed in Table 1. The primer for UB was
based on the sequences used by Lit et al. (2006). The primers were designed such that
the annealing temperatures were 60°C and compatible for forward and reverse primer
(each within 1°C of the other) and the amplicon length was limited between 60 and
200 bp. The length of the primers was from 17- to 25-mer and the GC content was
between 41 and 60%. The specificity of the primers was tested by performing a
BLAST search against the genomic NCBI database.
76
Table 1: Housekeeping genes and primer sequences used for real-time RT-PCR analysis
Gene
Accession
Primer sequence
MgCl2
Primer
Primer
Amplicon
annealing
elongation
size
5 mM
60°C
3s
61 bp
3 mM
60°C
3s
66 bp
4 mM
60°C
4s
101 bp
5 mM
65°C
5s
122 bp
4 mM
62°C
6s
147 bp
no.
GAPDH
K01458
Forward: GGCACGCCATCACTATC
Reverse: CCTGCATCTGCCCATTT
HPRT
AJ132697
Forward: CCCAAACATTATGCAGACGA
Reverse: TGTCCTGTCCATGATGAGC
β-actin
L08165
Forward: CACAGATCATGTTTGAGACCTT
Reverse: CATCACAATACCAGTGGTACG
G6PDH
AI981686
Forward: CGGGAACCAAATGCACTTCGT
Reverse: CGCTGCCGTAGAGGTATGGGA
UB
M11100
Forward: GGGATGCAGATCTTCGTGAAA
Reverse: CTTGCCAGCAAAGATCAACCTT
77
2.6. LightCycler real-time RT-PCR
Real-time RT-PCR was performed using a LightCycler 2.0 System (Roche Applied
Science). Each RNA sample was first controlled for genomic DNA contamination by
running the no-RT samples. For the real-time RT-PCR reaction, a master mix containing the following components was prepared: 2.0 µl LightCycler® FastStart DNA Master SYBR Green I (Roche Applied Science), 1.0 µl forward primer (500 nM), 1.0 µl
reverse primer (500 nM), 0.8 µl MgCl2 (2mM) and 13.2 µl nuclease-free water. The
optimal MgCl2 concentration (ranging between 2 and 5 mM) for each primer was
tested, and is listed in Table 1. For each gene, the optimal MgCl2 concentration produced the amplification plot with the lowest crossing point (Cp), the highest fluorescence intensity and the steepest amplification plot slope. LightCycler master mix (18
µl) was pipetted into the LightCycler glass capillaries and 2 µl cDNA was added as
PCR template. The capillaries were closed, centrifuged and placed in the LightCycler
rotor with spaces for 32 samples. Each run contained 21 randomly selected samples
and 5 standard curve points in duplicate. A no template control of nuclease-free water
was included to exclude DNA contamination in the PCR mix. The following system
protocol was run: denaturation program (95°C for 10 min), amplification program (5 s
at 95°C, then 5 s at a primer dependent temperature ranging from 60 to 62°C, and then
several seconds at 72 °C [the number of seconds depending on the length of the amplicon (bp)/25] – this procedure being repeated for 40 cycles and with single fluorescence measurement), melting curve program (55 – 95°C with a heating ramp of 0.1°C
per second and continuous fluorescence measurement), and then a cooling step to
40°C. The data on the expression levels of the 5 housekeeping genes were obtained as
Cp values based on the „second derivative maximum‟ (= automated method) as computed by the LightCycler 2.0 software. For each of the five genes, the reactions were
run in duplicate. All assays were quantified by including a standard curve in the realtime RT-PCR analysis. For the first point of the standard curve, eight µl of each sample was taken. The next 4 points of the standard curve were prepared by a 1:10 dilution. Each point of the standard curve was included in duplicate. The remaining samples were diluted 1:3. A graph of Cp vs log10 concentrations was produced by the
LightCycler software and the efficiencies were calculated as 10[-1/slope]. The specificity
of the amplified real-time RT-PCR products was verified by melting curve analysis
78
(60 to 95 °C) after 40 cycles, which should result in a number of different specific
products, each with a specific melting temperature. In addition, an agarose gel electrophoresis followed by ethidium bromide staining was performed and the identities
of the PCR products were positively confirmed by sequencing using an ABI PrismTM
Genetic Analyzer 3100 (Applied Biosystems, Foster City, California, USA). Realtime RT-PCR efficiency (E) values for the five genes were as follows: GAPDH,
1.916; HPRT, 1.962; β-actin, 1.863; G6PDH, 1.964 and UB, 1.960.
2.7. Data analysis
To calculate the stability of the candidate genes, the geNorm (version 3.4) and BestKeeper (version 1) software were used. Briefly, geNorm calculates the gene expression stability value M for a reference gene as the average pair-wise variation V of that
gene with all other reference genes tested. Stepwise exclusion of the least stable gene
(with highest M value) allows ranking of the tested genes according to their expression stability and determines the most stable genes. Efficiencies, obtained from the
standard curves calculated for each reaction, were used to transform the Cp values
into concentrations. These concentrations were put into the data file of the geNorm
software.
BestKeeper calculates the gene expression variation for all individual housekeeping
genes based on Cp values. Gene stability can be deducted from the calculated standard
deviation and coefficient of variance. To estimate inter-gene relations, pair-wise correlation analyses were performed by calculating the Pearson correlation coefficient.
All housekeeping genes were combined into an index (BestKeeper) and the correlation between each gene and the index was calculated.
79
3.
Results and discussion
Real-time RT-PCR is a standard technique for sensitive and accurate quantification of
messenger RNA. However, to use this method in an appropriate way, normalization
strategies are necessary to correct for experimental error during the procedures of extraction and processing of the RNA (Bustin et al., 2000, 2002 and 2004). Several
methods can be chosen, including normalization to sample size, total RNA, targeting
genomic DNA, incorporation of an artificial molecule and measuring of an internal
reference or housekeeping gene. The use of a reference gene for normalization has the
advantage that the measured reference gene variability represents the cumulative error
of the entire process (Huggett et al., 2005). Validation of housekeeping genes is
highly specific for a particular experimental model and is crucial in assessing a new
model (Dheda et al., 2004). Commonly used housekeeping genes include: GAPDH,
G6PDH, 18/28S rRNA, β-actin, HPRT and ubiquitin C. There is much literature,
however, that shows that expression levels of commonly used housekeeping genes can
vary between different tissues, cell types, experimental treatments and diseases (Thellin et al., 1999, Schmittgen et al. 2000, Dheda et al., 2004). The selected housekeeping genes consisted of genes previously used as an internal control in experimental
systems similar to ours and regulating divers critical cell functions in order to prevent
co-regulation of the reference genes. The stability of the 5 housekeeping genes was
analysed by geNorm and BestKeeper. According to the expression stability, geNorm
sorted the genes from least to most stable: GAPDH, HPRT, G6PDH, UB and β-actin.
The respective individual M values compared to all other tested genes were 1.217,
1.172, 1.006, 0.978 and 0.830, respectively. β-actin has the lowest individual M-value
and is the most stable gene in our inflammation model. This was confirmed by BestKeeper. However, BestKeeper assigned the highest variation to G6PDH and UB. Table 2 reports the stability of the tested genes according to BestKeeper.
80
Table 2: Stability of possible housekeeping genes according to BestKeeper
G6PDH
UB
β-actin
HPRT
GAPDH
n
21
21
21
21
21
geo Mean [CP]
29.81
23.38
24.09
23.38
24.05
ar Mean [CP]
29.87
23.45
24.10
23.40
24.07
min [CP]
27.78
20.94
22.94
22.27
22.61
max [CP]
34.28
27.05
25.64
25.58
26.71
std dev [CP]
1.61
1.59
0.53
0.77
0.88
CV [% CP]
5.40
6.77
2.21
3.29
3.66
Abbreviations: geo Mean [CP]: geometric Mean of CP, ar Mean [CP]: arithmetic Mean of CP,
min [CP] and max [CP]: the extreme values of CP, std dev [CP]: the standard deviation of the
CP, CV [% CP]: the coefficient of variance expressed as a percentage of the CP level
In chickens, the β-actin gene, decoding for a cytoskeletal protein, is commonly used
as an internal control for normalization of cytokine expression in several experimental
designs (Xing and Schat, 2000; Sijben et al., 2001; Laurent et al., 2001; Rath et al.,
2003; Nishimichi et al., 2005; Sundaresan et al., 2007). GAPDH, a key enzyme in the
glycolytic pathway, had the least stable expression as calculated by geNorm. Although GAPDH is commonly used as a reference gene, it is known that GAPDH
mRNA levels can be influenced by experimental conditions, both in vitro and in vivo
(Suziki et al., 2000; Stürzenbaum et al., 2001). In chickens, GAPDH transcription can
alter by nutritional manipulations and is upregulated with advancing age (Mozdziak et
al., 2003).
Vandesompele et al. (2002) demonstrated that the conventional use of a single gene
for normalization may lead to relatively large errors. Therefore, normalization by multiple control genes instead of by a single one is recommended to measure expression
levels accurately. This implies the calculation of a normalization factor based on the
expression levels of the best-performing housekeeping genes to remove all nonspecific variation. By stepwise exclusion of the genes with the highest M value, geNorm determined that the combination of the two genes UB and G6PDH leads to
more accurate normalization (M= 0.34) than using β-actin alone (M= 0.45). The M
81
values for GAPDH and HPRT were > 0.5, indicating that these two genes are not suitable as reference genes in this experimental set-up. To determine how many reference
genes should be used to accurately measure the expression level, normalisation factors
based on the geometric mean of the expression levels of the n best reference genes are
calculated by stepwise inclusion of an extra, less stable reference gene. The pairwise
variation Vn/(n+1) between two sequential normalization factors NFn and NFn+1 are
shown in Figure 1.
Figure 1: Determination of the optimal number of control genes for normalization by pairwise
variation analysis between the normalisation factors NFn and NFn+1. According to geNorm, the
inclusion of a third gene has no significant effect.
A large variation means that the added gene has a significant effect and should best be
included for calculation of the normalization factor. The results indicate that the use of
two reference genes is sufficient, since the inclusion of a third gene has no significant
effect (low V2/3 value) on the normalization factor. Furthermore, the cut-off value of
0.15 was reached with 2 genes. In conclusion, a V2/3 value of 0.155 was calculated for
the combination of G6PDH and UB, indicating that these genes are recommended as
normalising controls. Anew, BestKeeper confirmed that G6PDH and UB is the best
combination for defining a robust standardising index. Despite the fact that these
genes showed a high Cp variation, which could be a reason for exclusion, they correlated best with the combined BestKeeper index. Correlation coefficients of the tested
genes according to BestKeeper are represented in Table 3.
82
Table 3: Repeated pairwise correlation analysis and correlation analysis of candidate housekeeping genes. (A) Genes are pairwise correlated one with another, (B1) Genes are pair-wise
correlated with the BestKeeper index (n = 5), (B2) After removal of HPRT and GAPDH, the
correlation between G6PDH and UB and the index increased.
Pearson correlation coefficient ( r )
G6PDH
UB
β-actin
HPRT
GAPDH
UB
0.871
-
-
-
-
p-value
0.001
-
-
-
-
β-actin
0.715
0.735
-
-
-
p-value
0.001
0.001
-
-
-
HPRT
-0.391
-0.408
0.014
-
-
p-value
0.080
0.066
0.953
-
-
GAPDH
-0.396
-0.472
0.065
0.827
-
p-value
0.076
0.031
0.783
0.001
-
BestKeeper vs.
G6PDH
UB
β-actin
HPRT
GAPDH
coeff. of corr. [r]
0.792
0.780
0.906
0.147
0.128
p-value
0.001
0.001
0.001
0.523
0.582
BestKeeper vs.
G6PDH
UB
β-actin
coeff. of corr. [r]
0.953
0.969
0.820
p-value
0.001
0.001
0.001
(A)
vs.
(B1)
(B2)
83
HPRT and GAPDH showed the lowest correlation with the BestKeeper index. After
exclusion of these two genes, the correlation between G6PDH and UB and the BestKeeper index increased (0.953<r<0.969). Li et al. (2006) tested the stability of 28
cellular genes in chicken embryo cell cultures after infection with infectious bursal
disease virus. In this experimental set-up, the expression of G6PDH and UB also
proved to be stable.
In conclusion, we are reporting an experiment that was performed in order to identify
appropriate housekeeping genes to be used for relative gene quantification by realtime RT-PCR in an intravenous LPS inflammation model in chickens. G6PDH and
UB proved to be the optimal gene combination in our experimental model.
Acknowledgements
The authors would like to thank Eva Neirinckx, Dieter De Clercq and Karl Jonckheere
for their excellent technical assistance. The help of Margo Baele in the sequencing of
the cDNA products was also greatly appreciated.
84
References
Bustin S.A. Absolute quantification of mRNA using real-time reverse transcription
polymerase chain reaction assays. Journal of Molecular Endocrinology (2000)
25: 169-193.
Bustin S.A. Quantification of mRNA using real-time reverse transcription PCR (RTPCR): trends and problems. Journal of Molecular Endocrinology (2002) 29: 2339.
Bustin S.A. & Nolan T. Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction. Journal of Biomolecular Techniques (2004) 15: 155-66.
Dheda K., Huggett J.F., Bustin S.A., Johnson M.A., Rook G. & Zumla A. Validation
of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques (2004) 37: 112-4, 116, 118-9.
Dheda K., Hugget J.F., Chang J.S., Kim L.U., Bustin S.A., Jonhnson M.A., Rook
G.A.W. & Zumla A. The implication of using an inappropriate reference gene
for real-time reverse transcription PCR data normalization. Analytical Biochemistry (2005) 344: 141-143.
Hendriks-Balk M., Michel M. & Alewijnse A. Pitfalls in the normalization of realtime polymerase chain reaction data. Basic Research in Cardiology (2007) 102:
195-197.
Hong Y.H., Lillehoj H.S., Lee S.H., Dalloul R. & Lillehoj E.P. Analysis of chicken
cytokine and chemokine gene expression following Eimeria acervulina and
Eimeria tenella infections. Veterinary Immunology and Immunopathology
(2006) 114: 209-223.
Huggett J., Dheda K., Bustin S. & Zumla A. Real-time RT-PCR normalization; strategies and considerations. Genes and Immunity (2005) 6: 279-284.
Laurent F., Mancassola R., Lacroix S., Menezes R. & Naciri M. Analysis of chicken
mucosal immune response to Eimeria tenella and Eimeria maxima infection by
quantitive reverse transcription –PCR. Infection and Immunity (2001) 25272534.
85
Li Y.P., Handberg K.J., Juul-Madsen H.R., Zhang M.F. & Jørgensen P.H. Transcriptional profiles of chicken embryo cell cultures following infection with infectious bursal disease virus. Archives of Virology (2007) 152: 463-478.
Mozdziak P.E., Dibner J.J. & McCoy D.W. Glyceraldehyde-3-phosphate dehydrogenase expression varies with age and nutrition status. Nutrition (2003) 19: 438440.
Nishimichi N., Aosasa M., Kawashima T., Horiuchi H., Furusawa S. & Matsuda H.
Biological activity of recombinant chicken interleukin-6 in chicken hybridoma
cells. Veterinary Immunology and Immunopathology (2005) 106: 97-105.
Pfaffl M.W., Tichopad A., Prgomet C. & Neuvians T.P. Determination of stable
housekeeping genes, differentially regulated target genes and sample integrity:
BestKeeper-Excel-based too using pair-wise correlations. Biotechnology Letters
(2004) 26: 509-515.
Rath N.C., Parcells M.S., Xie H. & Santin E. Characterization of a spontaneously
transformed chicken mononuclear cell line. Veterinary Immunology and Immunopathology (2003) 96: 93-104.
Robinson T.L., Sutherland I.A. & Sutherland J. Validation of candidate bovine reference genes for use with real-time PCR. Veterinary Immunology and Immunopathology (2007) 115: 160-165.
Schmittgen T.D. & Zakrajsek B.A. Effects of experimental treatment on housekeeping
gene expression: validation by real-time, quantitative RT-PCR. Journal of Biochemical and Biophysical Methods (2000) 46: 69-81.
Sijben J.W.C., Schrama J.W., Parmentier H.K., van der Poel J.J. & Klasing K.C. Effects of dietary polyunsaturated fatty acids on in vivo splenic cytokine mRNA
expression in layer chicks immunized with Salmonella typhimurium lipopolysaccharide. Poultry Science (2001) 80: 1164-1170.
Sundaresan N.R., Anish D., Sastry K.V.H., Saxena V.K., Mohan J. & Ahmed K.A.
Cytokines in reproductive remodelling of molting White Leghorn hens. Journal
of Reproductive Immunology (2007) 73: 39-50.
Suzuki T., Higgins P.J. & Crawford D.R. Control selection for RNA quantitation. Biotechniques (2000) 29: 332-337.
86
Stürzenbaum S.R. & Kille P. Control genes in quantitative molecular biological techniques: the variability of invariance. Comparative Biochemistry and Physiology
part B Biochemistry and Molecular Boilogy (2001) 130: 281-289.
Thellin O., Zorzi W., Lakaye B., De Borman B., Coumans B., Hennen G., Grisar T.,
Igout A. & Heinen E. Housekeeping genes as internal standards: use and limits.
Journal of Biotechnology (1999) 75: 291-5.
Tricarico C., Pinzani P., Bianchi S., Paglierani M., Distante V., Pazzagli M., Bustin
S.A. & Orlando C. Quantitative real-time reverse transcription polymerase chain
reaction: normalization to rRNA or single housekeeping genes is inappropriate
for human tissue biopsies. Analytical Biochemistry (2002) 309: 293-300.
Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A. &
Speleman F. Accurate normalization of real-time quantitative RT-PCR data by
geometric averaging of multiple internal control genes. Genome Biology (2002)
3: 0034.1-0034.11.
Xing Z. & Schat K. Expression of cytokines genes in Marek‟s disease virus-infected
chickens and chicken embryo fibroblast cultures. Immunology (2000) 100: 70-76
87
Chapter 3 Flow cytometric differentiation of
avian leukocytes and analysis of intracellular
IL-1β and IL-6 expression
Adapted from
De Boever S., Croubels S., Demeyere K., Lambrecht B., De Backer P. &
Meyer E.
Flow cytometric differentiation of avian leukocytes and analysis of their intracellular
cytokine expression. Avian Pathology, in press.
88
Abstract
A flow cytometric method for the identification of chicken blood leukocyte subpopulations and thrombocytes was developed. An anti-chicken CD45 phycoerythrinlabelled antibody was used to separate leukocytes from red blood cell nuclei. Leukocytes and thrombocytes were identified using a combination of their CD45-positivity
and their typical side scatter properties. The identity of the CD45-positive cells was
confirmed by sorting the subpopulations and subsequent light microscopic evaluation.
In these differentiated cell populations, intracellular expression analysis of the proinflammatory cytokines interleukin-1β and IL-6 was subsequently optimised on whole
blood after in vitro stimulation with lipopolysaccharide from Escherichia coli strain
O127:B8.
89
1.
Introduction
Flow cytometry is a preferred method to phenotype ex vivo derived individual leukocytes from various species (Bohls et al., 2006). The flow cytometric differentiation of
avian leukocytes has been described for monocytes (Mast et al., 1998), lymphocyte
subpopulations (Fair et al., 2008) and thrombocytes (Viertlboeck and Göbel, 2007).
Uchiyama et al. (2005) used an aspecific fluorescent lipophilic dye DiOC6(3) for differentiation and counting of quail and chicken blood cells.
In mammals, the common leukocyte antigen CD45 is a haemopoietic cell-specific
surface glycoprotein with a cytoplasmic tyrosine phosphatase domain that is believed
to play a role in T- and B cell antigen receptor signal transduction (Tchilian and Beverly, 2006). Various isoforms are expressed on different types of lymphohematopoietic cells, while it is absent on mammalian platelets and mature erythrocytes. The
avian CD45 homolog is expressed on all chicken leukocytes but not on erythroid cells
(Paramithiotis et al., 1991). Chicken thrombocytes, which are the equivalent of
mammalian platelets, also express the CD45 antigen although at consistently lower
levels in comparison to lymphocytes (Horiuchi et al., 2004; Viertlboeck and Göbel,
2007).
Avian heterophils, which are the equivalent of mammalian neutrophils, blood monocytes, and thrombocytes, release a cascade of cytokines upon stimulation with various
infectious or non-infectious agents such as lipopolysaccharide (LPS) (Rhind et al.,
2001; Kogut et al., 2005; Scott et al., 2008; Ferdous et al., 2008). LPS is commonly
used to induce an acute phase reaction in humans and animals because of its proinflammatory properties (Skarnes et al., 1981; Klosterhalfen et al., 1992; Erroi et al.,
1993; Franco et al., 2000; Maxwell et al., 2002; De Boever et al., 2008). LPS interacts with the innate immune system through Toll-like receptor 4 (TLR4), a member of
the family of cell-surface and endosomally expressed receptors that recognize conserved molecular patterns unique to microorganisms (Palsson-Mcdermott and O‟Neill,
2004; Janssens and Beyaert, 2003). Recognition of microbial components by TLRs
triggers a cascade of cellular signals that culminates in the activation of Nuclear Factor - κB which leads to inflammatory gene expression (Verstrepen et al., 2008). Acute
90
endotoxemia represents an adequate tool for gaining insight in inflammatory processes (Remick and Ward, 2005). Furthermore, such a controlled inflammation model
is of interest to test the pharmacodynamic properties of anti-inflammatory drugs. To
be able to monitor the progress of the inflammatory response and evaluate the immune-modulatory effect of anti-inflammatory drugs, several parameters can be determined including body temperature, blood pressure, cytokine expression and the production of acute phase proteins. Of relevance in this context is that the cytokines IL1β and IL-6 have been characterized as major endogenous pyrogens or fever-inducers
using several animal models (Kluger, 1991; Jakab and Kalabay, 1998; Leon et al.,
1999). Flow cytometry is a powerful analytical technique allowing the quantitative
assessment of cytokine production at the single cell level. Using multiple colourlabelling, the simultaneous identification of different selected parameters can be performed (Bueno et al., 2001; Schultz et al., 2002; Schuerwegh et al., 2003).
In this paper we describe a flow cytometric method for the identification of avian leukocyte subpopulations and thrombocytes based on their combined CD45 positivity
and side scatter properties. The major advantage of this technique is the use of a single
antibody directed against a common leukocyte antigen for the identification of the
leukocyte subpopulations and thrombocytes. Furthermore, intracellular detection of
IL-1β and IL-6 was performed in these different leukocyte subpopulations. This new
tool allows us to monitor the cytokine expression after in vivo LPS administration in
broiler chickens.
The aim of this study was two-fold, i.e. to develop a straightforward method to differentiate avian white blood cells and to enable the subsequent assessment of their individual intracellular cytokine expression after LPS challenge.
91
2.
Materials and methods
2.1.
Blood samples
Blood samples (0.5 ml) were collected from the leg vein from laying hens, kept as
®
blood donors, into heparin containing tubes (Venoject , Terumo Corp., Tokyo, Japan). This procedure was approved by the Ethics committee of the Faculty of Veterinary Medicine (EC 2006/035).
2.2.
Reagents and antibodies
The phycoerythrin (PE) conjugated Cell Lab mouse monoclonal anti-chicken CD45
antibody, isotype IgMκ was purchased at Analis (Gent, Belgium).
Two polyclonal IgG antibodies, both raised in rabbits and directed against chicken IL1β (AHP941Z) and IL-6 (AHP942Z), respectively, were used as primary antibodies
(AbD Serotec, Cergy Saint-Christophe, France). An allophycocyanin (APC)conjugated fragment F(ab‟)2 of a goat antibody to rabbit immunoglobulin (Santa Cruz
biotechnology Inc., Heidelberg, Germany) was used as secondary antibody.
Goat serum, RPMI 1640 and bovine serum albumin (BSA) were purchased at Invitrogen (Merelbeke, Belgium). BD FACS Lysing solution, BD FACS Permeabilizing solution 2 and BD CellFIX were purchased from BD Biosciences (Erembodegem, Belgium).
LPS of Escherichia coli strain O127:B8 was purchased at Sigma-Aldrich (Bornem,
Belgium).
2.3. Staining procedure and flow cytometric analysis
Chicken leukocytes and thrombocytes were obtained from whole blood after lysis of
the erythrocytes. For this purpose, 4.5 ml of BD FACS Lysing solution, 1/10 diluted
in distilled water, was added to 0.5 ml of blood in a falcon tube for 10 minutes (min)
at room temperature. After washing, centrifugation for 5 min at 500 g, the pellet was
resuspended in 500 µl RPMI and 50 µl was pipetted into a flow cytometer tube. Following titration, testing 4, 6, 8, 10 and 20 µg/ml as concentrations, the PE-labelled
anti-CD45 was added in a final concentration of 6 µg/ml and samples were incubated
for 30 min at 4°C.
92
For the in vitro stimulation with LPS, 0.5 ml of whole blood was incubated with LPS
at a final concentration of 10 µg/ml for 3 hours at 37°C in a shaking warm water bath
(Memmert, Model WNB 14, Schwabad, Germany). Subsequently, erythrocytes were
lysed and leukocytes and thrombocytes were labelled as described above, followed by
permeabilisation using BD FACS Permeabilizing solution 2, 1/10 diluted with distilled water, again for 10 min at room temperature. As for CD45, the optimal working
dilutions for the primary antibodies directed against IL-1β and IL-6 were also optimized by means of titration, testing 1.6, 3.3, 6.6, 10, 12.5, 25, 50 and 100 µg/ml as
concentrations. A final concentration of 50 µg/ml was used and samples were incubated for 30 min at room temperature. Blocking was performed by adding 20% goat
serum in RPMI for 30 min at room temperature. Finally, the APC-labelled secondary
antibody was added at a concentration of 6 µg/ml for 30 min at 4°C. Cells were resuspended in 450 µl CellFIX, 1/10 diluted with distilled water. The optimal antibody
concentration of the primary and secondary antibody were also determined by titration.
Samples were measured using a double laser bench top flow cytometer FACSCanto
(Beckton Dickinson Biosciences) and analysed with FACSDiva Software (Becton
Dickinson). Excitation was performed with a 488 nm argon-ion laser and emission
collected using a 530/30 nm band pass (BP) filter for FITC conjugates, a 585/42 nm
BP filter for PE conjugates and a 660/20 nm BP filter for APC conjugates. Two basic
parameters, i.e. the side scatter (SSC), which is proportional to the cellular granularity, and the forward scatter (FSC) which is proportional to cell size, were analyzed. For
the CD45 expression, the amount of CD45 antigen present per cell (mean fluorescence intensity, MFI) was determined in all populations as can be seen in Figure 3.
For the cytokine expression, the % of IL-1β and IL-6 positive cells and their MFI
were assessed after differentiation based on CD45 positivity and SSC as described
above.
Additionally, flow cytometric cell sorting was performed on CD45+ cells (BD FACSAria II, California, USA). The sorted cell populations were stained (Diff-Quick,
Acros Organics N.V., Geel, Belgium) after cytocentrifugation (Shandon, UK) and
subsequent analysis of the slides by light microscopy (Olympus BX-UCB, Pennsylvania, USA).
93
3.
Results and discussion
Flow cytometric identification of avian monocytes (Mast et al., 1998), lymphocyte
subpopulations (Bohls et al., 2006; Fair et al., 2008) and thrombocytes (Viertlboeck
and Göbel, 2007) has already been performed. The aspecific fluorescent lipophilic dye
DiOC6(3) used by Uchiyama et al. (2005) for differentiation, was very useful for
counting of quail and chicken blood cells. We succeeded in the development of a
straightforward method to differentiate leukocyte subpopulations and thrombocytes
using a single antibody directed against the common leukocyte antigen. The CD45
antibody used in the current study allows a better discrimination between the leukocyte subpopulations. This is especially the case for the lymphocytes and thrombocytes
because of the reduced interference with the red blood cell nuclei. The presence of
nucleated erythrocytes and thrombocytes was indeed a challenge as this is a major
difference between mammalian and avian hematology (Campbell and Ellis, 2007).
Lysis of the erythrocytes was tested comparing a Tris-aminomethane/NH4Cl buffer
with the commercial lysing solution, with the latter giving the best results (data not
shown). Nevertheless, after lysis, the red blood cell nuclei were still present and since
their size is similar to that of a small lymphocyte, the discrimination between both
events was not possible based on the commonly used FSC versus SSC dot-plot as illustrated in Figure 1 (A). However, the combined use of an anti-chicken CD45 antibody and the SSC, enabled the discrimination between lymphocytes and red blood
cell nuclei. On the representative dot plot showing CD45+ cells versus SSC, the different subpopulations, i.e. lymphocytes, thrombocytes, monocytes and heterophils,
could be gated (Figure 1 B). The position of the different subpopulations on the dot
plot is similar to mammalian species, except for the thrombocytes, which are not present in mammalian blood (Figure 1 C).
94
Figure 1: (A) Representative flow cytometrical SSC versus FSC dot plot of chicken blood after
red blood cell lysis, without CD45 labelling, (B) representative flow cytometrical anti CD45-PE
versus SSC dot-plot of a chicken blood sample after lysis of the erythrocytes (L: lymphocytes, TH:
thrombocytes, M: monocytes and H: Heterophils), (C) representative flow cytometrical SSC versus FSC dot-plot showing the populations gated on dot-plot B
95
The optimal concentration of the anti-CD45 antibody (6 µg/ml) was determined by
titration (data not shown).
To confirm the identity of the gated populations on the anti CD45-PE versus SSC dotplot, additional sorting was performed, followed by light microscopy (Figure 2).
(A)
(B)
(B)
Figure 2 (A): Microscopic image of sorted lymphocytes (L), monocytes (M) and heterophils (H)
after Diff-Quick staining, (B) a confocal microscopic image of a lymphocyte expressing IL-6
(white arrow) surrounded by red blood cell nuclei. The secondary antibody was labeled with
Alexa 488 and propidium iodide was used to stain the nucleus.
Population L was composed of lymphocytes, characterized by a round nucleus and
weakly basophilic cytoplasm. Population M, contains the monocytes with the hallmarks being the largest leukocytes and having a large nucleus. The heterophils (population H) are characterized by a lobed nucleus and abundant eosinophilic granules in
the cytoplasm. For the heterophils and lymphocytes, a purity of 96% and 89.4%
96
could be calculated, respectively. For the monocytes and thrombocytes no percentages
can be provided as only few cells were present on the slide.
In a second series of experiments the optimized cell differentiation method was combined with intracellular detection of pro-inflammatory cytokines. More specifically,
IL-1β and IL-6 were chosen since these cytokines have been implicated as key mediators of fever (Kluger, 1991; Jakab and Kalabay, 1998; Leon et al., 1999). Commercial
antibodies directed against chicken IL-1β and IL-6 are of polyclonal origin and have
not yet been tested for flow cytometry. In the current experiment, the method was optimized after in vitro stimulation of heparin-treated whole blood samples with LPS,
because cell activation has been reported to be better and cytokine expression is more
efficient than with other anticoagulants (Coló Brunialti et al., 2002). Both a commercial lysing agent, BD FACS Lysing solution and a tris-aminomethane/NH4Cl buffer
were tested, with the former giving the best results. It should be remarked that we deliberately chose not to use a secretion block in the in vitro experiments, to mimic the
in vivo situation as closely as possible. Moreover, the use of a fixation-containing
lysing agent in the first step of the protocol, prevents cytokine secretion after sampling.
Several amounts of the commercial permeabilizing solution were tested, with 500 µl
resulting in the highest percentage of cytokine expressing cells and the highest MFI
(data not shown). As for CD45, the optimal working dilutions for the primary antibodies directed against IL-1β and IL-6 were also optimized by means of titration (data not
shown). An APC-labeled secondary antibody was chosen for intracellular cytokine
detection. APC belongs to a family of phycobiliproteins with a broad excitation spectrum and a large Stoke‟s shift with a high quantum yield fluorescence (Jung and Dailey, 1989; Telford et al., 2001). The optimal concentration of the secondary antibody
was also determined by titration.
A fluorescein isothiocyanate (FITC) labelled antibody was first tested as secondary
antibody, but since preliminary data confirmed that FITC stains the cytoplasmic granules of avian heterophils (Rath et al., 1998), this fluorochrome was not suited for intracellular cytokine detection nor could FITC-labelled antibodies be used for the identification of the different leukocyte subpopulations.
97
After stimulation of whole blood with LPS, cytokine production was measured in the
leukocyte subpopulations and the thrombocytes as illustrated in Figure 3.
Figure 3: Representative flow cytometrical dot-plots of in vitro stimulated heterophil (H),
monocyte (M), thrombocyte (TH) and lymphocyte (L) populations (A) after addition of antiCD45 PE and of the secondary APC-labelled antibody without the primary IL antibodies; (B)
addition of anti-CD45 PE, the primary antibody directed against IL-1β and the secondary
APC-labelled antibody; (C) addition of anti-CD45 PE labelled antibody, the primary antibody
directed against IL-6 and the secondary APC-labelled antibody. Autofluorescence was consistently lower than 102 for all samples. The mean % of positive events ± standard error of the
mean (n = 6) is mentioned in the upper right quandrants.
98
The MFI of LPS stimulated cells for both cytokines is shown in Table 1.
Table 1: Mean Fluorescence Intensity (MFI) (± standard error of the mean) for the different cell
types for IL-1β and IL6 (n = 6)
IL-1β
IL-6
Lymphocytes
1800.8 (± 246.6)
1713.8 (± 209.2)
Thrombocytes
2465.5 (± 303.9)
2348.2 (± 218.6)
Monocytes
4297.0 (± 361.4)
3689.5 (± 200.3)
Heterophils*
11987.2 (± 521.8)
11796.8 (± 489.7)
* The MFI values of the heterophils should be interpreted with caution due to the low % of cytokine expressing cells as shown in Figure 3.
On the dot plot of samples to which only the CD45-PE antibody and the secondary
APC-labelled antibody was added (Figure 3 A), a grid was placed to be able to discriminate between specific and nonspecific staining of the secondary antibody. As
could be expected from literature (Schultz et al., 2002; Schuerwegh et al., 2003),
stimulation with LPS evoked a right-shift of the populations, indicating the intracellular presence of IL-1β and IL-6. Monocytes showed the largest shift, both for IL-1β
and IL-6. Thrombocytes are also capable of synthesizing cytokines. This observation
is in accordance with Scott et al. (2007) and Ferdous et al. (2008), although in those
experiments IL-1β and IL-6 expression was measured on the mRNA level. The heterophils expressed the lowest level of cytokines, although mRNA expression after LPS
stimulation is reported (Kogut et al., 2005). However, the latter authors mention that
mRNA levels do not necessarily equate to bioactive protein. A confocal microscopic
image of a lymphocyte expressing IL-6 is shown in Figure 2B.
Finally, it should be remarked that the heterophils clearly expressed more CD45
molecules after LPS stimulation (data not shown). This observation corroborates findings in human granulocytes that contain an intracellular pool of CD45 and upon
stimulation with formylmethionylleucylphenylalanine, ionophore A23187 or LPS increase the surface expression of CD45 (Lacal et al., 1988; Caldwell et al., 1991; Stie
and Jesaitis, 2007).
99
In conclusion, we developed a straightforward method for the differentiation of the
different leukocyte subpopulations in avian blood, using a monoclonal antibody directed against chicken CD45 in combination with SSC properties. Furthermore, intracellular IL-1β and IL-6 expression in these individual populations was assessed. This
method can now be applied for the detection of intracellular cytokine expression after
intravenous administration of LPS to broiler chickens.
Acknowledgements
The authors would like to thank E. Neirinckx, D. De Clercq and K. Jonckheere for the
help with the animal experiment.
100
References
Bohls R.L., Smith R., Ferro P.J., Silvy N.J., Li Z. & Collison E.W. The use of flow
cytometry to discriminate avian lymphocytes from contaminating thrombocytes.
Developmental and Comparative Immunology (2006) 30: 843-850.
Bueno C., Almeida J., Alguero M.C., Sànchez M.L., Vaquero J.M., Laso F.J., San
Miguel J.F., Escribano L. & Orfao A. Flow cytometric analysis of cytokine production by normal human peripheral blood dendritic cells and monocytes: comparative analysis of different stimuli, secretion-blocking agents and incubation
periods. Cytometry (2001) 46: 33-40.
Caldwell C.W., Patterson W.P. & Yesus Y.W. Translocation of CD45RA in neutrophils. Journal of Leukocyte Biology (1991) 49: 317-328.
Campbell T.W. & Ellis C.K. Avian & exotic animal hematology & cytology, Third
edn., Carlton: Blackwell Publishing (2007)
Coló Brunialti M.K., Kallás E.G., Freudenberg M., Galanos C. & Salomao R. Influence of EDTA and heparin on lipopolysaccharide binding and cell activation,
evaluated at single-cell level in whole blood. Cytometry (2002) 50: 14-18.
De Boever S., Beyaert R., Vandemaele F., Baert K., Duchateau L., Goddeeris B., De
Backer P. & Croubels S. The influence of age and repeated lipopolysaccharide
administration on body temperature and the concentration of interleukin-6 and
IgM antibodies in broiler chickens. Avian Pathology (2008) 37: 39-44.
Erroi, A., Fantuzzi, G., Mengozzi, M., Sironi, M., Orencole, S.F., Clark, B.D., Dinarello, C.A., Isetta A., Gnocchi P., Giovarelli M. & Ghezzi P. Differential regulation of cytokine production in lipopolysaccharide tolerance in mice. Infection
and Immunology (1993) 61: 4356-4359.
Fair J.M., Taylor-McCabe K.J., Shou Y. & Marrone B.L. Immunophenotyping of
chicken peripheral blood lymphocyte subpopulations: Individual variability and
repeatability. Veterinary Immunology and Immunopathology (2008) 125: 286273.
Ferdous F., Maurice D. & Scott T. Broiler chick thrombocyte response to lipopolysaccharide. Poultry Science (2008) 87: 61-63.
101
Franco R.F., de Jonge E., Dekkers P.E.P., Timmerman J.J., Spek C.A., van Deventer,S.J.H., van Deursen P., van Kerkhoff L., van Gemen B., ten Cate H., van
der Poll T. & Reitsma P.H. The in vivo kinetics of tissue factor messenger RNA
expression during human endotoxemia: relationship with activation of coagulation. Blood (2000) 96: 554-559.
Horiuchi H., Tanaka K., Shigata A., Yoshida K., Kushima K., Ohta H., Furusawa S.
& Matsuda H. A monoclonal antibody against chicken thrombocytes reacts with
the cells of thrombocyte lineage. Immunolology (2004) 66: 243-250.
Janssens S. & Beyaert R. Role of Toll-like receptor in pathogen recognition. Clinical
Microbiology Reviews (2003) 16: 637-646.
Jakab L. & Kalabay L. The acute phase reaction syndrome: the acute phase reactants.
Acta Microbiologica et Immunologica Hungarica (1998) 45: 409-418.
Jung T.M. & Dailey M.O. A novel and inexpensive source of allophycocyanin for
multicolour flow cytometry. Journal of Immunological Methods (1989) 121: 918.
Klosterhalfen B., Hörstmann-Jungemann K., Vogel P., Flohé S., Offner F., Kirkpatrick C.J. & Heinrich P.C. Time course of various inflammatory mediators during recurrent endotoxemia. Biochemical Pharmacology (1992) 43: 2103-2109.
Kluger M. Fever: role of pyrogens and cryogens. Physiological Reviews (1991) 14:
93-127.
Kogut M.H., Iqbal M., He H., Philbin V., Kaiser P. & Smith A. Expression and function of Toll-like receptors in chicken heterophils. Developmental and Comparative Immunology (2005) 29: 791-807.
Lacal P., Pulidos R., Sànchez-Madrid F. & Mollinedo F. Intracellular location of T200
and Mol glycoproteins in human neutrophils. Journal of Biological Chemistry
(1988) 20: 9946-9951.
Leon L.R., Kozak W., Rudolph K. & Kluger M.J. An antipyretic role for interleukin 10 in LPS fever in mice. American Journal of Physiology (1999) 276: R81-89.
Mast J., Goddeeris B., Peeters K., Vandesande F. & Berghman L. Characterization of
chicken monocytes, macrophages and interdigitating cells by the monoclonal antibody KUL01. Veterinary Immunology and Immunopathology (1998) 61: 343357.
102
Maxwell J.R., Ruby C., Kerkvliet N.I. & Vella A.T. Contrasting the role of costimulation and the natural adjuvant lipopolysaccharide during the induction of T cell
immunity. Journal of Immunology (2002) 168: 4372-4381.
Pålsson-McDermott E. & O‟Neill L. Signal transduction by the lipopolysaccharide
receptor, Toll-like receptor-4. Immunology (2004) 113: 153-162.
Paramithiotis E., Tkalec L. & Ratcliffe J.H. High levels of CD45 are co-ordinately
expressed with CD4 and CD8 on avian thymocytes. Journal of Immunology
(1991) 11: 3710-3717.
Rath N.C., Huff G.R., Balog J.M. & Huff W.E. Fluorescein isothiocyanate staining
and characterization of avian heterophils. Veterinary Immunology and Immunopathology (1998) 64: 83-95.
Remick D.G. & Ward P.A. Evaluation of endotoxin models for the study of sepsis.
Shock (2005) 24: 7-11.
Rhind S.G., Castellani J.W., Brenner I.K.M., Shephard R.J., Zamecnik J., Montain
S.J., Young A.J. & Shek P.N. Intracellular monocyte and serum cytokine expression is modulated by exhausting exercise and cold exposure. American
Journal of Physiology Regulatory, Integrative and Comparative Physiology
(2001) 281: R66-R75.
Schuerwegh A., De Clerck L., Bridts C. & Stevens W. Comparison of intracellular
cytokine production with extracellular cytokine levels using two flow cytometric
techniques. Cytometry Part B (2003) 55B: 52-58.
Schultz C., Rott C., Temming P., von Puttkammer J. & Bucsky P. Influence of specimen age and use of different negative controls in determination of intracytoplasmic levels of cytokines after whole-blood culture assay. Clinical Diagnostic
Laboratory Immunology (2002) 9: 295-298.
Scott T. & Owens M.D. Thrombocytes respond to lipopolysaccharide through Tolllike receptor-4, and MAP kinase and NF-κB pathways leading to expression of
interleukin 6 and cyclooxygenase-2 with production of prostaglandin E2. Molecular Immunology (2008) 45: 1001-1008.
Skarnes R.C., Brown S.K., Hull S.S. & McCracken J.A. Role of prostaglandin E in
the biphasic fever response to endotoxin. Journal of Experimental Medecine
(1981) 154: 1212-1224.
103
Stie J. & Jesaitis A.J. Reorganization of the human neutrophil plasma membrane is
associated with functional priming: implications for neutrophil preparations.
Journal of Leukocyte Biology (2007) 81: 672-685.
Tchilian E.Z. & Beverly P.C.L. Altered CD45 expression and disease. TRENDS in
Immunology (2006) 27: 146-153.
Telford W.G., Moss M.W., Morseman J.P. & Allnutt F.C. Cryptomonad algal phycobiliproteins as fluorochromes for extracellular and intracellular antigen detection
by flow cytometry. Cytometry (2001) 44: 16-23.
Uchiyama R., Morimoto T., Kai O., Uwatoko K., Inoue Y. & Nakanishi T. Counting
absolute number of lymphocytes in quail whole blood by flow cytometry. Avian
Pathology (2005) 67: 441-444.
Verstrepen L., Bekaert T., Chau T., Tavernier J., Chariot A. & Beyaert R. TLR-4, IL1R, TNF-R signalling to NF-kappaB: variations on a common theme. Cellular
and Molecular Life Science (2008) 65: 2965-2978.
Viertlboeck B.C. & Göbel T.W. Chicken thrombocytes express the CD51/CD61 integrin. Veterinary Immunology and Immunopathology (2007) 119: 137-141.
104
Chapter 4 Characterization of an intravenous lipopolysaccharide inflammation model
in chickens
Adapted from
De Boever S., Croubels S., Meyer E., Sys S., Beyaert R., Ducatelle R. &
De Backer P. Characterization of an intravenous lipopolysaccharide inflammation
model in broiler chickens. Avian Pathology (2009) 38: 403-411
105
Abstract
Intravenous administration of lipopolysaccharide (LPS) from Escherichia coli
O127:B8 at a dose of 1,500,000 units/kg BW evoked a hypothermic response followed by a fever phase in five week old broiler chickens. The hypothermic phase coincided with a severe decrease in blood pressure. We assume that this decrease in
blood pressure is, at least partly, responsible for the hypothermic phase of the body
temperature curve. LPS administration also caused a decrease in circulating white
blood cells. The heterophils were predominantly sequestered in the lungs. In LPStreated chickens, far more apoptotic leukocytes were present in the circulation, compared to control chickens. The molecular players responsible for the LPS-induced inflammatory response could be TL1A, IL-1β and IL-6, since a slight increase in their
mRNA levels in white blood cells was already seen 1 hour after LPS administration.
In accordance with these observations, the levels of secreted IL-6 were maximal 3
hours after LPS administration. These parameters characterize this iv E. coli LPS inflammation model in broiler chickens.
106
1.
Introduction
Broilers come into contact with large amounts of lipopolysaccharide (LPS) by inhalation of dust and in cases of airosacculitis, after colonization of the airsacs with Escherichia coli (Lorenzoni and Wideman, 2008; Dwars et al., 2009). LPS is a major
component of the Gram-negative bacterial cell wall, and is capable of eliciting a
plethora of effects including, changes in body temperature, blood pressure and circulating leukocytes. Exposure of leukocytes and other cell types to a pathogen is followed by the appearance of pyrogenic cytokines or endogenous pyrogens in the circulation among which tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and IL-6
are considered the most important. These cytokines signal to the brain, where the level
of prostaglandin E2 is elevated, which is recognized as key mediator to induce fever
(Coceani and Akarsu, 1998; Netea et al., 2000). In chickens, TNF-α has not been
identified but TNF-like ligand 1A (TL1A) produces effects similar to TNF-α such as
production of IL-1β and IL-6. TL1A also promotes inflammation by raising α1 acid
glycoprotein, ceruloplasmin and nitric oxide (NO) (Takimoto et al., 2008). After intravenous (iv) LPS administration in chickens, the IL-6 plasma concentration peaks 3
hours after treatment and precedes the febrile phase (De Boever et al., 2008a). In the
spleen, mRNA levels of IL-1β were significantly elevated 1 hour after LPS administration (Leshchinsky and Klasing, 2003).
High doses of LPS tend to evoke hypothermia instead of fever and both behaviours
are reported to be adaptive (Romanovsky et al., 1996, Almeida et al., 2006b; Akarsu
and Mamuk, 2007). Hypothermia can potentially lower tissue hypoxia and could play
a defensive role after LPS administration (Romanovsky et al., 1997). Another hallmark of LPS administration is cardiovascular collapse resulting in hypotension
through upregulation of inducible NO-synthase (iNOS) and subsequent NO production (Jordan and Hinshaw, 1963; Wakabayashi et al., 1991; Leturcq et al., 1996; Miyamoto et al., 1996; Romanovsky et al., 1997; Thiemermann, 1997; Mayr et al.,
2008). Furthermore, LPS induces the adhesion of circulating leukocytes to the endothelial surface in postcapillary venules in rabbits, rats and mice. The accumulation of
these activated leukocytes is described primarily in the lung (Haslett et al., 1987; Cardozo et al. 1991; Walther et al., 2000; Yipp et al., 2002).
107
The current study was performed to further elucidate which players and cell types are
involved in the inflammatory effects seen after LPS administration in broiler chickens.
In this acute inflammation model, body temperature and blood pressure were measured as primary clinical parameters. Pro-inflammatory cytokines were measured on
three levels: assessment of mRNA expression of TL1A, IL-1β and IL-6 by PCR, intracellular protein expression using a flow cytometric method for IL-1β and IL-6, and
secreted protein in plasma using an IL-6 bio-assay. The characterization of this intravenous LPS inflammation model will enable us to study the influence of non steroidal
anti-inflammatory drug (NSAID) administration on the evaluated parameters in future
experiments.
2.
Materials and methods
2.1.
Animals
Twenty five one-day-old, unvaccinated, Ross chicks of both sexes were obtained from
a commercial hatchery. Temperature and relative humidity accorded with the requirements of young chickens and temperature was adjusted to prevent huddling
(Anonymous, 2004). The concrete floor was covered with wood shavings. Normal
hygienic measures were taken to avoid contact with pathogens as much as possible.
The lighting schedule consisted of 12 hours dark and 12 hours light. Commercial pullet feed and tap water were available ad libitum. All experiments and procedures were
approved by the Ethics Committee of the Faculty of Veterinary Medicine (EC
2008/006 and 008).
2.2. Experiment 1
2.2.1. Body temperature and cytokine expression
For the first experiment, chickens were divided in 2 groups of 6 LPS-treated and 6
control chickens. LPS-treated chickens were injected intravenously in the wing vein
with LPS of Escherichia coli O127:B8 (Sigma-Aldrich, Bornem, Belgium) dissolved
in aqua ad injectabilia at a dose of 1,500,000 units/kg BW at the age of 5 weeks. In
this batch of LPS, 1,500,000 units/kg BW corresponded with a dose of 2.5 mg/kg
108
BW. For all experiments, LPS from the same batch was used. Control chickens were
injected with the same amount of aqua ad injectabilia.
Body temperature was measured by inserting a thermocouple probe (Physitemp Instruments Inc., Clifton, NJ, USA) 5 cm into the cloaca, before and at 1, 2, 3.5, 5, 6.5,
8, 12 and 24 h after LPS administration. Reading was taken after one minute contact
with the mucosa. The area under the body temperature versus time curve from 0 to 5 h
and 0 to 24 h post administration (p.a.) (AUC0→5 h and AUC0→24 h) was calculated to
evaluate differences between treatment groups (α=0.05).
One ml of blood was withdrawn in citrate-containing tubes before and 1, 2 and 3 h
after LPS administration for PCR analysis and transferred into two Eppendorf cups
(Novolab, Geraardsbergen, Belgium) containing 1 ml of RNA/DNA stabilization reagent for blood/bone marrow (Roche Applied Sciences, Vilvoorde, Belgium) and frozen at -20°C until RNA extraction.
Half a ml of blood was withdrawn in heparin containing tubes (Venoject®, Terumo
Corp., Tokyo, Japan) from the leg vein before and 1, 2, 3, 4, 5, 6, 8 and 12 h after LPS
administration for flow cytometric analysis. From 3 LPS-treated chickens and 3 control chickens, a drop of these blood samples was also used to prepare a blood smear.
For determination of IL-6 in plasma using a bio-assay, 0.4 ml of blood was withdrawn
in heparin containing tubes before and 1, 2, 3, 4, 5, 6, 8 and 12 h after LPS administration.
2.2.2. PCR analysis
Blood samples were analysed for chicken TL1A, IL-1β, IL-6 and two housekeeping
genes, i.e. ubiquitin (UB) and glucose-6-phosphate dehydrogenase (G6PDH) and prepared as described previously (De Boever et al., 2008b). Briefly, total RNA was extracted from 1 ml citrate treated blood using a High Pure RNA Isolation Kit (Roche
Applied Science, Vilvoorde, Belgium) according to the manufacturer‟s instructions.
The reverse transcription was performed using the Reverse Transcriptase Core kit
(Eurogentec, Seraing, Belgium), following the manufacturer‟s instructions. A fixed
amount of RNA (600 ng) from each sample was converted into cDNA, using the random nonamer as priming method in the PTC-100 DNA engine (Bio-Rad Laboratories,
Nazareth Eke, Belgium). The primers were designed with the LightCycler Probe De109
sign Software 2.0 (Roche Applied Sciences) using the GenBank sequences for TL1A,
IL-1β and IL-6 and G6PDH. The specific primer sequences for TL1A, IL-1β and IL-6
are listed in Table 1.
Table 1: Primer sequences used for real-time RT-PCR analysis
Gene
Accession
Primer sequence
MgCl2
Primer
Primer
annealing
elongation
2 mM
60°C
12 s
4 mM
60°C
7s
3 mM
60°C
3s
no.
TL1A AB194710
Forward: CCTGAGTTATTCCAGCAACGCA
Reverse: ATCCACCAGCTTGATGTCACTAAC
IL-1β Y15006
Forward: AACATCGCCACCTACAAG
Reverse: TACTCGGTACATACGAGATGGAAA
IL-6
AJ309540
Forward: TGGAGACAGCCCATGTAA
Reverse: CATGGACTGGAGCACAAGTA
The primer for UB was based on the sequences used by Li et al. (2007). Real-time
RT-PCR was performed using a LightCycler 2.0 System (Roche Applied Science).
All reactions were run in duplicate and were quantified by including a standard curve
(5 points in duplicate) in the real-time RT-PCR analysis. The concentration of IL-1β,
IL-6 and TL1A was divided by the normalisation factor (NF), calculated as the square
root of the multiplication of the concentration of both housekeeping genes.
110
2.2.3.Flow cytometric analysis
Intracellular IL-1β and IL-6 were analysed in chicken leukocytes using a flow cytometric method (De Boever et al., submitted).
Reagents and antibodies
Polyclonal antibodies, raised in rabbits and directed against chicken IL-1β and IL-6,
were used as primary antibodies (AHP941Z and AHP942Z, AbD Serotec, Cergy
Saint-Christophe, France). Since no antibodies against TL1A are commercially available, this analysis could not be included.
Allophycocyanin (APC)-conjugated F(ab‟)2 goat antibodies to rabbit immunoglobulin
were used as secondary antibodies (Santa Cruz biotechnology Inc., Heidelberg, Germany).
RPMI 1640, goat serum and bovine serum albumin were purchased at Invitrogen
(Merelbeke, Belgium). BD FACS Lysing solution, BD FACS Permeabilizing solution
2 and BD CellFIX were purchased from Beckton Dickinson Biosciences (Erembodegem, Belgium).
Staining procedure and flow cytometric analysis
Chicken leukocytes were obtained after lysis of the erythrocytes with FACS Lysing
solution: 4.5 ml of FACS Lysing solution (1/10 diluted with distilled water) was
added to 0.5 ml of heparin treated blood in a falcon tube and kept for 10 min at room
temperature. After washing, the pellet was resuspended in 500 µl of RPMI and 50 µl
was pipetted into a flow cytometer tube. Leukocytes were separated from the remaining red blood cell nuclei, using phycoerythrin (PE) - conjugated Cell Lab mouse antichicken CD45 antibodies (Beckman Coulter, 733074), which were added in a concentration of 6 µg/ml. Samples were incubated for 30 min at 4°C. Permeabilization was
performed using 500 µl FACS Permeabilizing solution 2 (1/10 diluted with distilled
water) for 10 min, again at room temperature. Primary antibodies were added in a
concentration of 50 µg/ml and samples were incubated for 30 min at room temperature. Next, goat serum at a concentration of 2% in RPMI was added for 30 min and
samples were incubated at room temperature. Finally, the corresponding APC-labelled
secondary antibody was added at a concentration of 6 µg/ml.
The cells were resuspended in 450 µl CellFIX (1/10 diluted with distilled water) and
pipetted into Trucount Tubes (BD Biosciences). Samples were analysed using a FAC111
SCanto flow cytometer (BD Biosciences). The different cell populations were demarcated in an FL-2/Side Scatter (SSC) dot plot, based on a positive staining for CD45
and their granularity. The PE fluorescence dot plots of the gated cells were then plotted and all data were corrected for autofluorescence. Cytokine-specific fluorescence
was defined as events to the right of the autofluorescence marker and the mean fluorescence intensity (MFI) and proportion of cells staining positive for the cytokine in
question was recorded.
2.2.4.IL-6 measurement by bio-assay
Concentrations of secreted IL-6 were measured in plasma using IL-6 dependent murine 7TD1 hybridoma cells (Van Snick et al., 1986; De Boever et al., 2008a). Briefly,
cells were cultured in 96 well microtitre plates for 72 h in medium with different dilutions of the plasma samples. The number of living cells was measured using a colorimetric hexosaminidase enzyme reaction(Landegren, 1984). The concentration of IL-6
in plasma samples was calculated from a standard curve obtained using a dilution of
recombinant chicken IL-6.
2.2.5. Microscopy of blood smears
Blood smears were prepared with heparinised blood and coloured with Hemacolor ®
(Merck, Darmstadt, Germany) according to the manufacturer‟s guidelines. Slides were
evaluated using a light microscope (Zeiss, Zaventem, Belgium) equipped with a x100
objective. On each slide, 100 leukocytes were evaluated.
To demonstrate the presence of apoptotic cells in circulation after LPS administration,
a blood sample of a LPS-treated chicken was incubated with Annexin-V-FLUOS labelling reagent (Annexin-V-FLUOS Staining Kit, Roche Applied Science) after lysis
of the red blood cells as described above. Leukocyte nuclei were stained using DAPI
(1/100 diluted) (Roche Applied Science). After this double staining, cells were
mounted on microscope slides using glycerin–PBS solution (0.9/0.1, v/v) with 2.5%
1,4-diazabicyclo(2,2,2)octane (Janssen Chimica, Beerse, Belgium) and analyzed using
a Leica DM RBE fluorescence microscope (Leica Microsystems GmbH, Wetzlar,
Germany).
112
2.3. Experiment 2: Blood pressure
Blood pressure was measured before and every hour until 12 h after LPS administration using a non-invasive Doppler technique in 6 LPS-treated and 2 control chickens
at the age of 5 weeks (Christensen et al., 1987). A Doppler crystal probe coated with
ultrasound gel was placed over the plantar arcuate artery on the ventral side of the foot
web (Ultrasonic Doppler flow detector, model 811-B, Parks Medical Electronics Inc.,
Oregon, USA). The crystal was connected to a medium gain amplifier. The bird was
positioned on its side and an inflatable cuff, connected to a sphygmomanometer, was
placed around the upper part of the hind limb. Chickens were gently handled, and
adapted to this procedure to avoid stress and treatment related effects on the measurement as much as possible. The pulse in the foot web was located as an audio signal. The cuff was inflated until the sound was extinguished. Return of the pulse sound
during deflation of the cuff indicated systolic blood pressure. The area under the blood
pressure versus time curve from 0 to 5 h and from 0 to 24 h p.a. (AUC0→5 h and
AUC0→24 h) was calculated to evaluate differences between treatment groups.
2.4. Experiment 3: Histology
Sequestration of heterophils in tissues of LPS-treated chickens was demonstrated by
histological examination of the lung after Giemsa staining. Twenty four one-day-old,
unvaccinated, Ross chicks of both sexes were obtained from a commercial hatchery
and raised as described in section 2.1. At the age of 5 weeks, chickens were divided in
3 groups. At 2, 3 and 4 h after iv LPS administration at a dose of 1,500,000 units/kg
BW, 3 chickens were euthanized. At 2, 3 and 4 h after pyrogen free water administration, 3 chickens were euthanized. At the same time points, 2 control chickens were
euthanized. Lungs were collected from LPS-treated, pyrogen free water treated and
control birds and stored in 10% formaldehyde for 24 h.
After embedding in paraffin, tissues were cut in sections of 3 µm and stained with a
Giemsa staining according to standard procedures. Slides were evaluated microscopically, by counting the amount of heterophils in 10 microscopic fields using a 100x
objective (Zeiss).
113
2.5. Statistical analysis
A Kolmogorov Smirnov test was performed to check if the variable were normally
distributed. The Student‟s t-test (α = 0.05) was used to demonstrate possible differences in the AUC0→5 h and AUC0→24 h of the body temperature between LPS-treated
and control chickens. The results of the PCR and flow cytometric analyses were also
statistically evaluated, using the same test. For the AUC0→5 h and AUC0→24
h
of the
blood pressure and the histological analyses, a non-parametric Kruskal-Wallis test
was performed, since these variables were not normally distributed.
Statistical comparison of the IL-6 concentration between the different treatment
groups was done 3 h after the administration of LPS or saline, the time point at which
the secreted IL-6 concentration reached its highest value. A Mann-Whitney test was
performed to demonstrate possible differences in cytokine concentration.
114
3.
Results
3.1. Experiment 1
3.1.1.Body temperature
The course of the body temperature was characterized by a hypothermic phase followed by a fever phase in LPS-treated chickens, as shown in Figure 1. There was a
significant difference in AUC0→5 h between LPS-treated chickens and control chickens expressed as mean ± SD (LPS: 204.03 ± 1.52 °C x h; control: 207.50 ± 0.96 °C x
h with P < 0.05). For the AUC0→24 h, no significant difference could be remarked between LPS- treated and control chickens, since the hypothermic phase cancels out the
hyperthermic phase.
Figure 1: Body temperature versus time curve of LPS-treated chickens (n=6) and control chickens (n=6) expressed as mean (+SD). The LPS-treated chickens showed a hypothermic phase followed by a fever phase. Control animals showed a slight increase in body temperature.
115
3.1.2.PCR analysis
The mRNA levels of TL1A, IL-1β and IL-6 are depicted in Figure 2. They were
slightly increased in leukocytes and thrombocytes of LPS-treated chickens. However,
no statistical significance could be demonstrated for any of the 3 cytokine levels.
Figure 2: Concentration/NF of TL1A, IL-1β and IL-6 versus time graphs of LPS-treated (n=6)
and control chickens (n=6) expressed as mean (+SD). A slight, although not significant, increase
in mRNA levels in the leukocytes was seen 1 h after LPS administration.
116
3.1.3.Flow cytometry
A decrease in circulating CD45 positive white blood cells was observed as shown in
Figure 3 (A). Specifically, in LPS-treated chickens there was a significant decrease in
circulating heterophils as demonstrated in Figure 3 (B). In control chickens an increase in circulating heterophils can be remarked from 4 h after aqua ad injectabilia
administration, this increase was attributed to stress due to handling of the animals.
In Figure 4, significant differences in MFI 3 h after treatment between LPS-treated
chickens and control chickens are shown for intracellular IL-1β and IL-6 in the
heterophils.
(A)
(B)
Figure 3: (A) Number of CD45 positive white blood cells versus time and (B) number of
circulating heterophils in LPS-treated (n=6) and control chickens (n=6) expressed as mean
(+SD). A significant decrease in circulating leukocytes was seen in LPS-treated chickens due to
sequestration and apoptosis.(P<0.05)
117
*
*
Figure 4: Intracellular expression (MFI) of IL-1β and IL-6 3 h after treatment in the heterophils
of LPS-treated chickens (n=6) and control chickens (n=6) expressed as mean (+SD) * Means
differ significantly from those of the control group (P < 0.05). A significant increase in intracellular IL-1β and IL-6 expression in the heterophils was seen 3 h after LPS administration.
3.1.4.Bio-assay
LPS-treated chickens had significantly higher levels of IL-6 in plasma at 3 h posttreatment compared to control chickens (P<0.05) as shown in Figure 5.
*
Figure 5: Concentration of secreted IL-6 versus time graph of LPS-treated chickens (n=6) and
control chickens (n=6) expressed as mean (+SD) * Mean differs significantly from that of the
control group (P < 0.05). A significant increase in plasma IL-6 concentration was seen 3 h after
LPS administration.
118
3.1.5.Light and fluorescence microscopy
Microscopic examination of blood smears revealed a decrease of circulating heterophils in LPS-treated chickens. Moreover, 4 h after LPS administration, pregranulocytes appeared in circulation, characterized by the presence of blue granules in their
cytoplasm and a less lobulated nucleus. In the LPS-treated chickens, dark coloured
cells could be observed from 2 h p.a. These cells could be identified as apoptotic cells
using annexin V staining as illustrated in Figure 6.
In the control chickens, an increase in circulating heterophils was seen. No marked
B LPSdifference in circulating monocytes and lymphocytes could be observed between
B
treated and control chickens.
A
B
Figure 6: (A) Fluorescence microscopic image of a fluorescein isothiocyanate (FITC) - annexin V
stained apoptotic heterophil, as identified by the shape of the nucleus (indicated with an arrow
and on the right, two red blood cell nuclei can be remarked) (B). Intravenous LPS administration
to broiler chickens induced heterophil apoptosis.
119
3.2. Experiment 2: Blood pressure
The administration of LPS resulted in a profound and sustained hypotension as depicted in Figure 7. Both the AUC0→5
h
(LPS: 352.92 ± 39.38 mmHg x h; control:
552.5 ± 38.89 mmHg x h) and AUC0→24 h (LPS: 1986.25 mmHg x h ± 212.47; control:
2607.5 mmHg x h ± 272.24) were significantly different between LPS-treated and
control chickens (P<0.05).
Figure 7: Blood pressure versus time curve of LPS-treated chickens (n=6) and control chickens
(n=2) expressed as mean (+SD). LPS administration to broiler chickens induced a profound and
sustained hypotension.
120
3.3. Experiment 3: Histology
LPS administration significantly increased the number of heterophils in the lung (P <
0.05), 2 h after administration as shown in Figure 8. Figure 9 illustrates the difference
in presence of heterophils in lung tissue after Giemsa staining of an LPS-treated
chicken (A) in comparison to a control chicken (B).
*
Figure 8: Number of heterophils / microscopic lung field (100x) versus time curve for LPS-treated
chickens (n=3), pyrogen free water treated chickens (n=3) and control chickens (n=2) expressed
as mean (+SD) * Mean differs significantly from those of the control group and the pyrogen free
water treated group (P < 0.05). Two h after intravenous LPS administration to broiler chickens
induced a significant sequestration of heterophils in the lungs was remarked.
(A)
(B)
Figure 9: Giemsa staining of the lung of an LPS-treated chicken (A) and a control chicken (B).
The black arrows indicate heterophils. Significantly more heterophils can be remarked in LPStreated chickens than in control chickens.
121
4.
Discussion
Recognition of microbial components by Toll-like receptors triggers a cascade of cellular signals which culminates in the activation of NF-κB leading to inflammatory
gene expression encoding pro-inflammatory cytokines like TNF-α, IL-1β and IL-6,
inducible NO synthase (iNOS), cyclooxygenase 2 (COX-2), and phospholipase A2 and
clearance of the infectious agent (Witkamp and Monshouwer, 2000; Verstrepen et al.,
2008).
IL-1β, IL-6 and TNF-α are considered the most important pyrogenic cytokines or endogenous pyrogens in the circulation (Dinarello, 2000, Witkamp and Monshouwer,
2000). In mammals, TNF-α is considered one of the first mediators released during
inflammation, that in turn promotes the production of IL-1β and IL-6 (Witkamp and
Monshouwer, 2000). To date, TNF-α has not been identified in the chicken. However,
chicken TL1A belongs to the TNF ligand superfamily, a family of cytokines regulating cell growth/survival/apoptosis, and shows a similar mode of action as TNF-α
(Gaur and Aggarwal, 2003; Takimoto et al., 2008).
In the current experiment, mRNA levels of IL-1β, IL-6 and TL1A in white blood cells
were slightly elevated 1 h after iv injection of the Toll-like receptor 4 ligand LPS. It
should be mentioned that mRNA levels do not necessarily equate to protein levels and
cytokines can be produced by other cell types than leukocytes (Kogut et al., 2005). In
the current study, the IL-1β and IL-6 intracellular protein levels in white blood cells
were found to be significantly elevated in the heterophils, the avian counterpart of the
neutrophil, 3 h after LPS administration. These results from in vivo administration of
LPS confirm the in vitro results from heterophils, macrophages and thrombocytes
(Dil and Qureshi, 2002; Kogut et al., 2005; Ferdous et al., 2008). The concentration of
secreted bioactive IL-6, produced by white blood cells but also by other cell types
such as endothelial cells is also significantly elevated 3 h after LPS administration.
This could be expected since there is generally a good correlation between intracellular detection of cytokines and the secreted amounts of cytokines (Schuerwegh et al.,
2003).
As a result of the production of these cytokines, a change in body temperature occurs.
In the first experiment of this study, a biphasic response in body temperature, i.e. a
fever phase preceded by a hypothermic phase was seen. The rise in body temperature
122
of the control chickens could be attributed to several factors including circadian
rhythm and handling of the chickens (Dawson and Whittow, 2000; Cabanac and Aizawa, 2000). It is proposed that hypothermic and pyrogenic mechanisms are independently activated during an LPS-induced acute phase response and that both behaviours are adaptive (Romanovsky et al., 1996, Almeida et al., 2006b; Akarsu and Mamuk, 2007). Hypothermia can potentially lower tissue hypoxia and thus plays a defensive role in septic shock and is likely aimed at preserving the host‟s vital systems
(Romanovsky et al., 1997; Almeida et al., 2006a). The similarities in time course of
the hypothermia and the reduction in oxygen consumption strongly suggest that hypothermia is a reflection of reduced thermogenesis (Derijk et al., 1994), but the time
course of the LPS-induced hypothermia coincides with the time course of arterial hypotension. Intravenous LPS administration triggers wide-spread iNOS expression,
resulting in copious NO production (Bowen et al., 2007; Saia et al., 2008). NO seems
to be involved in LPS-induced hypothermia, since it may participate in vasodilatation,
increasing heat loss and intensifying the hypothermia magnitude (VayssettesCourchay et al., 2003). As time passes after the administration of a high dose of LPS,
the level of endotoxemia decreases, the arterial pressure returns to its normal values
and along with the alleviation of tissue hypoperfusion, cold-seeking behaviour
changes into warmth-seeking behaviour and fever emerges (Romanovsky et al., 1996;
Almeida et al., 2006a). We agree with the concept proposed by Almeida et al. (2006a)
that hypotension evokes hypoperfusion and less oxygen consumption, whereby there
is less oxygen for heat production, resulting in hypothermia. In this way, hypothermia
can be seen as a result of the hypotension, another hallmark of LPS administration in
various species such as chickens, rats, dogs, rabbits, primates and humans (Jordan and
Hinshaw, 1964;Wakabayashi et al., 1991; Leturcq et al., 1996; Miyamoto et al., 1996;
Romanovsky et al., 1997; Mayr et al., 2008). NO is also believed to be responsible for
the hypotension after endotoxin administration (Doursout et al., 2008), so either way,
NO seems to be the causative agent of both hypotension and hypothermia. However,
in this experiment a sustained hypotension was seen over a longer period than the hypothermic phase. Probably in the initial phase of the inflammatory response, hypotension has a profound effect on the body temperature while later on the mechanisms
evoking fever overrule the effect of hypotension.
123
In dogs and pigs, hypothermia by cooling of the animals induced a neutropenia (Fedor
et al., 1958; Biggar et al., 1983; Biggar et al., 1984). Also in our experiments, hypothermia was accompanied by a decrease in circulating granulocytes. More in general,
there was a decrease of all CD45 positive cells. In sheep and dwarf goats LPS administration was shown to induce a decrease in peripheral white blood cell count caused
by margination and accumulation of leukocytes in the lungs (Meyrick and Brigham,
1983; Van Miert et al., 1997). Normal lungs contain a large pool of marginated neutrophils since they are less deformable then erythrocytes, which have similar dimensions but pass the lung capillary segments faster (Hogg and Doerschuk, 1995; Kitagawa et al., 1997; Klut et al., 1998; Kuebler et al., 2000; Walther et al., 2000; Suwa et
al. 2001; Jones et al., 2002). Another key feature in a localized response to LPS or
inflammation is sequestration of leukocytes from the circulation to the endothelium,
resulting in emigration into the surrounding, inflamed tissue. In the case of sepsis or
endotoxemia, the leukocytes will become trapped in the lungs and are not able to recirculate, as seen in rabbits, rats and mice (Haslett et al., 1987; Cardozo et al., 1991;
Yipp et al., 2002). Endotoxin decreases neutrophil deformability by stiffening of the
cytoskeleton by formation of microfilaments and increases the concentration of neutrophils in pulmonary capillaries (Hogg and Doerschuk, 1995; Kitagawa et al., 1997;
Klut et al., 1998; Kuebler et al., 2000; Walther et al., 2000; Suwa et al. 2001). Interestingly, in rabbits, injection of recombinant human IL-6 induces a decrease in deformability of neutrophils (Suwa et al., 2001). Also L-selectin mediated leukocyte/endothelial interaction, endothelium derived Toll-like receptor 4 and the adhesion
molecules ICAM1 and ELAM1, that bind neutrophils on endothelial cells, are reported to participate in the process of sequestration (Osborn 1990; Hogg and Doerschuk, 1995; Kuebler et al., 2000; Andonegui et al., 2003).
The decrease in circulating white blood cells, seen in our experiments, is at least
partly caused by the sequestration of these cells as shown by the abundant presence of
especially granulocytes in the lung 2 h after LPS administration. A second reason
could be apoptosis of these cells, which is reported in vivo in pigs and chickens and in
vitro for fish lymphocytes (Norimatsu et al., 1995; Shini et al., 2008a; Xiang et al.,
2008). In the current study, an annexin-V staining of isolated white blood cells of
LPS-treated chickens showed much more apoptotic cells than the samples from con-
124
trol chickens. In mice, it was suggested that these apoptotic cells have beneficial effects against LPS-induced endotoxic shock and even have therapeutic potential by
reducing the release of pro-inflammatory cytokines (Ren et al., 2008).
From 4 h after LPS administration, granulocytosis was seen in the LPS-treated chickens. Ushiyama et al. (2005) reported granulocytosis in quails 3 h after LPS administration and Shini et al. (2008b) demonstrated an increased heterophil:lymphocyte
ratio 1, 3 and 24 h after LPS treatment, which is earlier than in our experiment. LPS
accelerates the release of neutrophils from bone marrow pools and stimulates an increase in immature heterophils or band cells, in the bone marrow and peripheral blood
as confirmed in chicken blood in the present experiment (Biggar et al., 1983; Klut et
al., 1996; Klut et al., 1998; Shini et al., 2008). In rabbits it was demonstrated that administration of recombinant human IL-6 accelerates the release of PMN from the bone
marrow between 9 and 24 h after treatment (Suwa et al., 2001).
It should be remarked that in the control group, an increase in circulating heterophils
was observed, 4 h after the administration of pyrogen free water. This can be attributed to stress due to the frequent handling of the chickens. An increase in the blood
heterophil:lymphocyte ratio is used as a general stress indicator and is related to corticosterone production in chickens, which can rise due to simple experimental procedures (e.g. confinement, isolation and multiple blood sampling) in birds such as pigeons and geese (Machin et al., 2001; Takahashi et al., 2002).
In conclusion, the parameters characterizing this iv E. coli LPS inflammation model in
five week old broiler chickens are a profound hypotension which accompanied the
hypothermic phase of the body temperature curve, mRNA levels of TL1A, IL-1β and
IL-6 were slightly elevated 1 h after LPS administration, 3 h after LPS administration
intracellular IL-1β and IL-6 expression peaked in the heterophils and secreted IL-6
reached it‟s maximum concentration,. Further more, LPS induced a decrease in circulating CD45 positive cells, partly caused by sequestration of the heterophils in the
lungs on the one hand and, apoptosis of the circulating leukocytes on the other hand.
In future experiments, the influence of non steroidal anti-inflammatory drugs
(NSAID) administration on these parameters will be evaluated.
125
Aknowledgements
The authors like to thank W. Burms for the quantification of IL-6 in plasma by bioassay, S. Stuyvaert for the help with the PCR analysis and K. Demeyere for performing the flow cytometric analysis. C. Puttevils and D. Ameye are acknowledged for the
help with the Giemsa staining of the tissues. The help of E. Neirinckx, D. De Clercq
en K. Jonckheere with the animal experiments was greatly appreciated.
126
References
Akarsu E. & Mamuk S. Escherichia coli lipopolysaccharides produce serotypespecific hypothermic response in biotelemetered rats. American Journal of
Physiology. Regulatory, integrative and comparative Physiology (2007) 292:
R1846-1850.
Almeida M., Steiner A., Branco L. & Romanovsky, A. Cold-seeking behaviour as a
thermoregulatory strategy in systemic inflammation. European Journal of
Neuroscience (2006a) 23: 3359-3367.
Almeida M., Steiner A., Branco L. & Romanovsky A. Neural substrate of coldseeking behaviour in endotoxin shock. PLos ONE (2006b) 1: 1-10.
Anonymous (2004). Draft Appendix A of the European Convention for the Protection
of Vertebrate Animals used for Experimental and other Scientific Purposes
(ETS No. 123). Guidelines for accommodation and care of animals (Article 5
of the Convention).
Biggar W., Bohn D. & Kent G. Neutrophil circulation and release from bone marrow
during hypothermia. Infection and immunity (1983) 40: 708-712.
Bowen O., Erf G., Chapman M. & Wideman R. Plasma nitric oxide concentrations in
broilers after intravenous injections of lipopolysaccharide or microparticles.
Poultry Science (2007) 86: 2550-2554.
Cabanac M. & Aizawa S. Fever and tachycardia in a bird (Gallus domesticus) after
simple handling. Physiology & Behaviour (2000) 69: 541-545.
Cardozo C., Edelman J., Jagirdar J. & Lesser M. Lipopolysaccharide-induced pulmonary vascular sequestration of polymorphonuclear leukocytes is complement
independent. The American Review of Respiratory Disease (1991) 144: 173178.
Christensen J., Fosse R., Halvorsen O. & Morild I. Comparison of various anesthetic
regimens in the domestic fowl. American Journal of Veterinary Research
(1987) 48: 1649-1657.
Coceani F. & Akarsu E. Prostaglandin E2 in the pathogenesis of fever. An update.
Annals of the New York Academy of Science (1998) 856: 76-82.
127
Dawson W. & Whittow G. Regulation of body temperature. In Sturkie’s Avian physiology fifth edition (2000, pp.343-390). London: Academic Press.
De Boever S., Beyaert R., Vandemaele F., Baert K., Duchateau L., Goddeeris B., De
Backer P. & Croubels S. The influence of age and repeated lipopolysaccharide
administration on body temperature and the concentration of interleukin-6 and
IgM antibodies against lipopolysaccharide in broiler chickens. Avian Pathology (2008a) 31: 39-44.
De Boever S., Vangestel C., De Backer P., Croubels S. & Sys S.U. Identification and
validation of housekeeping genes as internal control for gene expression in an
intravenous LPS inflammation model in chickens. Veterinary Immunology and
Immunopathology (2008b) 122: 312-317.
Derijk R., Van Kampen M., Van Rooijen N. & Berkenbosch F. Hypothermia to endotoxin involves reduced thermogenesis, macrophage-dependent mechanisms,
and prostaglandins. The American Journal of Physiology (1994) 266: R1-8.
Dil N. & Qureshi M. Involvement of lipopolysaccharide related receptors and nuclear
factor κB in differential expression of inducible nitric oxide synthase in
chicken macrophages from different genetic backgrounds. Veterinary Immunology and Immunopathology (2002) 88: 149-161.
Dinarello C. Proinflammatory cytokines. Chest (2000) 118: 503-508.
Doursout M., Oguchi T., Fischer U., Liang Y., Chelly B., Hartley C. & Chelly J. Distribution of NOS isoforms in a porcine endotoxin shock model. Shock (2008)
29: 692-702.
Doyle S. & O‟Neill L. Toll-like receptors: From the discovery of NF-κB to new insights into transcriptional regulations in innate immunity. Biochemical Pharmacology (2006) 72: 1102-1113.
Dwars R., Matthijs M., Daemen A., van Eck J., Vervelde L. & Landman W. Progression of lesions in the respiratory tract of broilers after single infection with
Escherichia coli compared to superinfection with E. coli after infection with infectious bronchitis virus. Veterinary Immunology and Immunopathology
(2009) 127: 65-76.
Fedor E.J., Fisher B. & Fisher E.R. Observations concerning bacterial defense mechanisms during hypothermia. Surgery (1958) 43: 807-814.
128
Ferdous F., Maurice D. & Scott T. Broiler chick thrombocyte response to lipopolysaccharide. Poultry Science (2008) 87: 61-63.
Gaur U. & Aggarwal B. Regulation of proliferation, survival and apoptosis by members of the TNF superfamily. Biochemical Pharmacology (2003) 66: 14031408.
Haslett C., Worthen G., Giclas P., Morrison D., Henson J. & Henson P. The pulmonary vascular sequestration of neutrophils in endotoxemia is initiated by an effect on the neutrophil in the rabbit. The American Review of Respiratory Disease (1987) 136: 9-18.
Hogg J. & Doerschuk C. Leukocyte traffic in the lung. Annual Review of Physiology
(1995) 57: 97-114.
Jones H., Paul W. & Page C. A new model for the continuous monitoring of polymorphonuclear leukocyte trapping in the pulmonary vasculature of the rabbit.
Journal of Pharmacological and Toxicological Methods (2002) 48: 21-29.
Jordan M. & Hinshaw L. Species resistance to histamine and endotoxin: the response
of the chicken. Proceedings of the Society for Experimental Biology and Medicine (1964) 115: 455-458.
Kitagawa Y., Van Eeden S., Redenbach D., Blair M., Klut M., Wiggs B. & Hogg J.
Effect of mechanical deformation on structure and function of polymorphonuclear leukocytes. Journal of Applied Physiology (1997) 82: 1397-1405.
Klut M., van Eeden S., Whalen B., Verburght L., English D. & Hogg J. Neutrophil
activation and lung injury associated with chronic endotoxemia in rabbits. Experimental Lung Research (1996) 22: 449-465.
Klut M., van Eeden S. & Hogg J. Neutrophil structural changes associated with chronic endotoxemia and lung injury. Journal of Inflammation (1998) 48: 1-12.
Kogut M., He H. & Kaiser P. Lipopolysaccharide binding protein/CD14/TLR4dependent recognition of salmonella LPS induces the functional activation of
chicken heterophils and up-regulation of pro-inflammatory cytokine and chemokine gene expression in these cells. Animal Biotechnology (2005) 16: 165181.
129
Kuebler W., Borges J., Sckell A., Kuhnle G., Bergh K., Messmer K. & Goetz A. Role
of L-selectin in leukocyte sequestration in lung capillaries in a rabbit model of
endotoxemia. American Journal of Respiratory Critical Care Medicine (2000)
161: 36-43.
Landegren U. Measurement of cell numbers by means of the endogenous enzyme
hexosaminidase. Applications of detection of lymphokines and cell surface antigens. Journal of Immunological Methods (1984) 67: 379-388.
Leshchinsky T. & Klasing K. Profile of chicken cytokines induced by lipopolysaccharide is modulated by dietary alpha-tocopheryl acetate. Poultry Science (2003)
82: 1266-1273.
Leturcq D., Moriaty A., Talbott G., Winn R., Martin T. & Ulevitch R. Antibodies
against CD14 protect primates from endotoxin-induced shock. The Journal of
Clinical Investigation (1996) 98: 1533-1538.
Li Y.P., Handberg K.J., Juul-Madsen H.R., Zhang M.F. & Jørgensen P.H. Transcriptional profiles of chicken embryo cell cultures following infection with infectious bursal disease virus. Archives of Virology (2007) 152: 463-478.
Lorenzoni A. & Wideman R. Intratracheal administration of bacterial lipopolysaccharide elicits pulmonary hypertension in broilers with primed airways. Poultry
Science (2008) 87: 645-654.
Machin K., Tellier L., Lair S. & Livingston A. Pharmacodynamics of flunixin and
ketoprofen in mallard ducks (Anas platyrhynchos). Journal of Zoo and Wildlife
Medicine (2001) 32: 222-229.
Mayr F., Firbas C., Leitner J., Spiel A., Reiter R., Beyer D., Meyer M., Wolff G. &
Jilma B. Effects of the pan-selectin antagonist bimosiamose (TBC1369) in experimental human endotoxemia. Shock (2008) 29: 475-482.
Meyrick B. & Brigham K.L. Acute effects of Escherichia coli endotoxin on the pulmonary microcirculation of anesthetized sheep. Laboratory investigation
(1983) 48: 458-470.
Miyamoto T., Fujinaga T., Yamashita K. & Hagio M. Changes of serum cytokine activities and other parameters in dogs with experimentally induced endotoxic
shock. Journal of Veterinary Research (1996) 44: 107-118.
130
Netea M., Kullberg B. & Van der Meer J. Circulating cytokines as mediators of fever.
Clinical Infectious Diseases (2000) 31: S178-184.
Norimatsu M., Ono T., Aoki A., Ohishi K., Takahashi T., Watanabe G., Taya K., Sasamoto S. & Tamura Y. Lipopolysaccharide-induced apoptosis in swine lymphocytes in vivo. Infection and Immunity (1995) 63: 1122-1126.
Ren Y., Xie Y., Jiang G., Fan J., Yeung J., Li W., Tam P. & Savill J. Apoptotic cells
protect mice against lipopolysaccharide-induced shock. The Journal of Immunology (2008) 180: 4978-4985.
Romanovsky A., Shido O., Sakurada S., Sugimoto N. & Nagasaka T. Endotoxin
shock: thermoregulatory mechanisms. The American Journal of Physiology
(1996) 270: R693-703.
Romanovsky A.A., Shido O., Sakurada S., Sugimoto N. & Nagasaka T. Endotoxin
shock-associated hypothermia. How and why does it occur? Annals of the New
York Academy of Science (1997) 813: 733-737.
Saia R., Anselmo-Franci J. & Carnio E. Hypothermia during endotoxemic shock in
female mice lacking nitric oxide synthase. Shock (2008) 29: 119-126.
Schuerwegh A., De Clerck L., Bridts C. & Stevens W. Comparison of intracellular
cytokine production with extracellular cytokine levels using two flow cytometric techniques. Cytometry Part B (2003) 55B: 52-58.
Shini S., Kaiser P., Shini A. & Bryden W. Differential alterations in ultrastructural
morphology of chicken heterophils and lymphocytes by corticosterone and
lipopolysaccharide. Veterinary Immunology and Immunopathology (2008a)
122: 83-93.
Shini S., Kaiser P., Shini A. & Bryden W. Biological response of chickens (Gallus
gallus domesticus) induced by corticosterone and a bacterial endotoxin. Comparative Biochemistry and Physiology (2008b) 149: 324-333.
Suwa T., Hogg J., Klut M., Hards J. & van Eeden S. Interleukin-6 changes deformability of neutrophils and induces their sequestration in the lung. American
Journal of Respiratory Critical Care Medicine (2001) 163: 970-976.
Takahashi K., Kawamata K., Akiba Y., Iwata T. & Kasai M. Influence of dietary conjugated linoleic acid isomers on early inflammatory responses in male broiler
chickens. British Poultry Science (2002) 43: 47-53.
131
Takimoto T., Sato K., Akiba Y. & Takahashi K. Role of chicken TL1A on inflammatory responses and partial characterization of its receptor. The Journal of Immunolgy (2008) 180: 8327-8332.
Thiemermann C. Nitric oxide and septic shock. General Pharmacology (1997) 2: 159166.
Ulevitch R. Therapeutics targeting the innate immune system. Nature (2004) 4: 512520.
Van Miert A., Van Duin C. & Wensing T. Effects of pentoxifylline and polymyxin B
on the acute-phase-response to Escherichia coli endotoxin in dwarf goats.
Journal of Veterinary Pharmacology and Therapeutics (1997) 20: 61-68.
Van Snick J., Cayphas S., Vink A., Uyttenhove C., Coulie P.G., Rubira M.R. & Simpson R.J. Purification and NH2-terminal amino acid sequence of a T-cellderived lymphokine with growth factor activity for B-cell hybridomas. Proceedings of the National Academy of Science of the United States of America
(1986) 83: 9679.
Vayssettes-Couchay C., Chataigneau M., Protin C., Ragonnet C. & Verbeuren T. Cutaneous venous dysfunction studied in vivo in the LPS-treated rabbit: implication of NO in saphenous vein hyporeactivity. Naunyn-Schniedebergs’ Archives
of Pharmacology (2003) 367: 516-523.
Verstrepen L., Bekaert T., Chau T., Tavernier J., Chariot A. & Beyaert R. TLR-4, IL1R, TNF-R signalling to NF-kappaB: variations on a common theme. Cellular
and Molecular Life Science (2008) 65: 2965-2978.
Walther A., Weihrauch M., Schmidt W., Gebhard M., Martin E. & Schmidt H. Leukocyte-independent plasma extravasation during endotoxemia. Critical Care
Medicin (2000) 8: 2943-2948.
Wakabayashi G., Gelfand J., Burke J., Thompson R. & Dinarello C. A specific receptor antagonist for interleukin 1 prevents Escherichia coli-induced shock in rabbits. The FASEB Journal (1991) 5: 338-343.
Witkamp R. & Monshouwer M. Signal transduction in inflammatory processes, current and future therapeutic targets: a mini review. The Veterinary quarterly
(2000) 22: 11-16.
132
Xiang L., Peng B., Dong W., Yang Z. & Shao J. Lipopolysaccharide induces apoptosis in Carassius auratus lymphocytes, a possible role in pathogenesis of bacterial infection in fish. Developmental and Comparative Immunology (2008)
32: 992-1001.
Yipp B., Andonegui G., Howlett C., Robbins S., Hartung T., Ho M. & Kubes P. Profound differences in Leukocyte-endothelial cell responses to lipopolysaccharide versus lipoteichoic acid. The Journal of Immunology (2002) 168: 46504658.
133
134
Part IV Nonsteroidal anti-inflammatory drugs
135
Chapter 1 Pharmacokinetics of tepoxalin and
its active metabolite
Adapted from
De Boever S., Neirinckx E., Baert K., De Backer P. & Croubels S. Pharmacokinetics of tepoxalin and its active metabolite in broiler chickens. Journal of Veterinary
Pharmacology and Therapeutics (2009) 32: 97-100.
137
Abstract
The pharmacokinetics of tepoxalin and its active acid metabolite, RWJ-20142, were
evaluated in a two-way cross-over study using 6 broilers following a single oral and
intravenous administration of tepoxalin at a dose of 30 mg/kg. The concentration of
tepoxalin and its acid metabolite were determined by a validated high-performance
liquid chromatography method with fluorescence detection. After intravenous administration of tepoxalin, plasma concentration versus time data of tepoxalin could be described by a one-compartmental model. A terminal half-life of 0.52 h, a total body
clearance of 8.60 l/h.kg and a volume of distribution of 5.80 l/kg were calculated. After oral administration of tepoxalin, plasma concentrations of the parent compound did
not rise above the limit of quantification of 25 ng/ml. The active metabolite RWJ20142 was excessively formed, reaching maximum plasma concentrations of 22.6 and
11.3 µg/ml, at 0.71 and 1.25 hours after intravenous and oral tepoxalin administration,
respectively. A terminal half-life of 1.07 and 2.80 hours could be calculated for the
active metabolite after intravenous and oral tepoxalin administration, respectively.
138
1.
Introduction
Tepoxalin,
[5(4-chlorophenyl)-N-hydroxy-(4-methoxyphenyl)-N-methyl-1H-
pyrazole-3-propanamide], is an orally active dual cyclooxygenase/lipoxygenase inhibitor, with a favourable gastrointestinal profile with respect to gastric mucosal injury (Wallace et al., 1991; 1993; Argentieri et al., 1994; Knight et al., 1996; Kirchner
et al., 1997). Tepoxalin is indicated for the control of pain and inflammation associated with osteoarthritis in dogs. Besides its anti-inflammatory and analgesic properties, tepoxalin has been reported to inhibit T cell proliferation and to have cytokine
modifying activity (Rainsford et al., 1993, 1996; Zhou et al., 1994; Kazmi et al.,
1995; Ritchie et al., 1995; Willburger et al., 1998; Fiebich et al., 1999). After oral
administration in humans and dogs, tepoxalin is rapidly converted to its active, carboxylic acid metabolite RWJ-20142, which inhibits cyclooxygenase but not lipoxygenase (Waldman et al., 1996; Homer et al., 2005). The objective of the present experiment was to study the pharmacokinetics of tepoxalin and its active metabolite in
broiler chickens, in order to use it in future experiments as an anti-inflammatory and a
potential cytokine inhibiting drug in an inflammation model in chickens developed in
our laboratory (Baert et al., 2005a, b; De Boever et al., 2008).
139
2.
Materials and methods
2.1.
Animals
Experiments were carried out on six healthy broiler chickens (Ross, mean body
weight 1.16 ± 0.108 kg), obtained from a local commercial poultry farm. The study
was approved by the Ethics Committee of the Faculty of Veterinary Medicine
(2004/077). The animals were housed according to the requirements of the EU
(Anonymous, 2004).
2.2.
Experimental design
The study was designed a two-way cross-over study using two groups (n = 6) of broilers. A drug free period of 1 week was allowed between the 2 treatments. Before oral
administration, chickens were fasted for 14 h. Intravenous tepoxalin was prepared by
dissolving the tepoxalin standard (Schering-Plough Co., Wicklow, Ireland) in sterile
polyethylene glycol at a concentration of 60 mg/ml. The drug was slowly injected at a
dose of 30 mg/kg via a 25 G needle in the wing vein. For the oral administration, tepoxalin lyophilisates tablets (Zubrin Oral Lyophilisates, 50 mg; Schering-Plough,
Brussels, Belgium ) were weighed and the amount corresponding to 30 mg/kg was
given directly into the beak of the animal. Blood samples were collected from the leg
vein (vena metatarsea plantaris) before (0) and at 15, 30, 45 min, 1, 1.5, 2, 2.5, 3, 4,
6, 7, 8 and 10 h after administration. Plasma was collected after centrifugation of the
blood sample for 10 min at 2400 g and stored at -20°C until assayed.
2.3.
Tepoxalin and metabolite assay
Plasma concentrations of tepoxalin and its active, acid metabolite were determined by
a HPLC method with fluorescence detection. Briefly; 225 µl of plasma were pipetted
into a 1.5 ml Eppendorf tube, followed by the addition of 25 µl of internal standard
(RWJ-20294, Schering-Plough Co.) (25 or 250 µg/mL) and 500 µl of acetonitrile.
After vortexing briefly and centrifugation (10.000 g for 10 min at room temperature),
50 µL of the supernatant were injected in the HPLC system (TSP, Fremont, CA,
USA) ( λex = 290 nm and λem = 440 nm). A PLRP-S column (Polymer Laboratories,
140
Shropshire, UK) attached to an appropriate guard column was used. The mobile phase
(MF) A consisted of 0.01 M 1-octane-sulfonic acid in 0.01 M acetic acid in water,
mobile phase B consisted of tetrahydrofuran. The retention time was 6.5, 8.8 and 12.6
min. for tepoxalin, its acid metabolite and the IS, respectively, using an isocratic elution at 58% MF A and 42% MF B at 0.7 ml/min. The calibration curves for tepoxalin
and acid metabolite were linear between 0.025 and 1 µg/mL and 2.5 and 100 µg/ml (r
> 0.99). The precision fell between the ranges specified by EU at for different concentration levels and the accuracy fell within ranges of -20% to +10% at the same concentration levels (Anonymous, 2005). The LOQ was set at 25 ng/ml for both compounds and the LOD was 5.9 ng/ml and 6.8 ng/ml for tepoxalin and its acid metabolite, respectively (Anonymous, 2005). The extraction recovery was 98% and 95% for
tepoxalin and the acid metabolite, respectively. Stock solutions were stable for at least
3 months.
2.4.
Pharmacokinetic analysis of data
The pharmacokinetic parameters of tepoxalin were calculated using a computer modelling program (WinNonlin® Standard Edition Version 5.01; Pharsight Corporation,
Mountain View, CA, USA). Akaike‟s information criterion was used to determine the
number of compartments used in the pharmacokinetic analysis and the most appropriate weighting for the data (Yamaoka et al., 1978). The plasma concentration versus
time curves for tepoxalin after intravenous administration were best fitted to a onecompartmental open model with the following exponential equation:
C i.v. = C0 .e
k el t
where C is the plasma concentration, C0 is the plasma concentration at time 0 h, kel is
the first-order elimination rate constant for the elimination phase and t is the time.
For the acid metabolite the area under the curve (AUC), the half-life of elimination
(t½ ), the maximum observed concentration (Cmax) and the time to maximum concentration (Tmax) were calculated by the non compartmental PK functions for Microsoft
Excel. The mean plasma concentrations of tepoxalin and its acid metabolite versus
time curves are shown in Figure 1.
141
Concentration (µg/ml)
Tepoxalin intravenous
100
Metabolite intravenous
Metabolite oral
10
1
0.1
0.01
0
2
4
6
8
10
Time (h)
Figure 1: Mean (+SD) plasma concentrations vs. time curve of tepoxalin and its acid metabolite after oral and intravenous administration of tepoxalin to broiler chickens at a dose of 30
mg/kg (n = 6).
For both administration routes, the mean pharmacokinetic parameters of both substances are reported in Table 1. After oral administration of tepoxalin, plasma concentrations of the parent compound did not rise above the LOQ of 25 ng/ml.
142
Table 1: Mean (SD) and median (range) pharmacokinetic parameters of tepoxalin and the active
metabolite, RWJ-20142 in broiler chickens after intravenous and oral administration of 30 mg/kg
(n = 6).
Tepoxalin
Active metabolite
Route of administration
i.v.
AUC
(µg.h/ml)
t½ (h)
Mean
Median
Mean
Median
Mean
Median
(SD)
(range)
(SD)
(range)
(SD)
(range)
4.65
5.03
51.3
58.2
43.5
42.1
(1.82)
(2.17-6.80)
(21.7)
(11.8-66.4)
(15.2)
(27.1-69.3)
0.52
0.49
1.07
1.05
2.80
2.52
(0.14)
(0.37-0.65)
(0.17)
(0.97-1.41)
(1.01)
(1.82-4.22)
hm
kel (h-1)
p.o.
1.43
hm
hm
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
0.71
0.75
1.25
1.00
(0.29)
(0.25-1)
(0.42)
(1-2)
22.6
24.0
11.3
11.4
(10.4)
(5.68-35.2)
(2.89)
(6.61-14.5)
-
-
-
-
(0.40)
Vd (l/kg)
5.80
(1.97)
Cl (l/h.kg)
8.60
(4.98)
Tmax (h)
Cmax (µg/ml)
MRT (h)
-
-
-
0.75
0.77
(0.21)
(0.53-0.94)
AUC: area under the curve; t½: half-life of elimination; kel: elimination rate constant; Vd: volume
of distribution; Cl: clearance; Tmax: time at which maximum concentration is reached; C max:
maximum plasma concentration; MRT: mean residence time; hm: harmonic mean.
143
2.5.
Statistical analysis
The Student‟s t-test (α = 0.05) was used to demonstrate possible differences in the
AUC and half-life of elimination of the acid metabolite after oral and intravenous administration of tepoxalin.
3.
Results and discussion
Because we expected a low oral bioavailability of tepoxalin in chickens, we selected a
dose of 30 mg/kg. Nevertheless, plasma concentrations of tepoxalin after oral administration of the drug did not rise above the LOQ of 25 ng/ml.
Comparison of the pharmacokinetic parameters of tepoxalin after intravenous administration is only possible in dogs at this moment (Homer et al., 2005). After intravenous tepoxalin administration in chickens, a mean half-life of elimination of 0.52
hours was calculated. In dogs, tepoxalin was eliminated 5 times slower. Differences in
elimination half-life could be attributed to dissimilarities between animal species in
the clearance or the volume of distribution of the drug. A difference in clearance of
tepoxalin has been described for dogs and mice. In dogs, the excretion route was almost exclusively via faeces and only 1% via urine. In mice, on the contrary, about
30% of tepoxalin was eliminated via urine (EMEA, 2003). Another explanation could
be a quantitative difference in biotransformation rate of tepoxalin between dogs and
chickens.
In mammals, including rats and dogs, tepoxalin undergoes both rapid and extensive in
vivo conversion to its carboxylic acid hydrolysis product as shown in Fig. 2.
144
CH3
O
HO
N
N
CH3
CH3
O
OH
N
N
N
O
O
Cl
Cl
(a)
(b)
O
C H3
O
N
N
C H3
O
Cl
(c)
Figure 2: Chemical structures of (a) tepoxalin, (b) its acid metabolite (RWJ-20142) and (c) the
internal standard RWJ-20294 (IS)
Plasma concentrations of the acid metabolite were substantially higher and remained
in the systemic circulation for a longer period than the parent compound (Knight et
al., 1996). These data were confirmed in chickens in the present experiment. Despite
the levels of the parent compound in plasma after oral administration being below the
LOQ, the metabolite was abundantly present indicating the existence of a substantial
pre-systemic first-pass metabolism. In this way, tepoxalin could be considered as a
pro-drug. Tepoxalin may reach substantial higher concentrations at sites of inflammation than can be expected from plasma levels, since a high Vd of 5.80 l/kg was calculated after intravenous administration.
In contrast to humans and dogs, where the half-life of elimination of the metabolite
was about 14 hours after oral tepoxalin administration, chickens eliminated the acid
metabolite much faster with a mean half-life of elimination of 2.80 and 1.07 h after
oral and intravenous administration, respectively (Waldman et al., 1996; Homer et al.,
2005). Similarly in dogs and in chickens, the half-life of elimination of the metabolite
was faster after intravenous than oral administration of the parent drug (Homer et al.,
145
2005). This could be due to the presence of a flip-flop phenomenon for the parent
drug, suggesting that the rate of absorption is slower than the rate of elimination. A
slower absorption of tepoxalin would also result in a slower formation of the metabolite and a longer persistence of the metabolite in plasma after oral administration of
the parent drug.
Besides the acid metabolite, an unknown metabolite was detected in plasma of dogs
after tepoxalin administration (EMEA, 2003). Also in this study in chickens the presence of an unknown metabolite in plasma was seen as a peak eluting between the acid
metabolite and tepoxalin, both after oral and intravenous tepoxalin administration
(data not shown). The unknown metabolite represented approximately 10% in peak
area of the active metabolite.
Knowing the pharmacokinetic properties of tepoxalin in chickens, we intend to study
the anti-inflammatory and cytokine inhibiting potentials of the drug in an intravenous
LPS inflammation model in chickens whereby the inflammatory pathways could be
elucidated.
Acknowledgements
The assistance of P. Wassink and K. Jonckheere for sample analysis and the assistance of D. De Clercq in the animal experiment was greatly appreciated.
146
References
Anonymous (2004) Draft Appendix A of the European Convention for the Protection
of Vertebrate Animals used for Experimental and other Scientific Purposes (ETS
No. 123). Guidelines for accommodation and care of animals (Article 5 of the
Convention).
Anonymous (2005) Volume VIII, Notice to applicants, Veterinary medicinal products: Establishment of maximum residue limits (MRLs) for residues of veterinary products in foodstuffs of animal origin: Development and validation of a
proposed regulatory method, EMEA/CVMP/573/00.
Argentieri D.C., Ritchie D.M., Ferro M.P., Kirchner T., Wachter M.P., Anderson
D.W., Rosenthale M.E. & Capetola R.J. Tepoxalin: a dual cyclooxygenase/5lipoxygenase inhibitor of arachidonic acid metabolism with potent antiinflammatory activity and a favourable gastrointestinal profile. The Journal of
Pharmacology and Experimental Therapeutics (1994) 271: 1399-1408.
Baert K., De Boever S., Duchateau L. & De Backer P. Sodium salicylate attenuates
lipopolysaccharide (LPS)-induced adipsia, but not hypophagia, in broiler chickens. British Poultry Science (2005a) 46: 144-8.
Baert, K. Duchateau, L. De Boever S., Cherlet M. & De Backer P. Antipyretic effect
of oral sodium salicylate after an intravenous E. coli LPS injection in broiler
chickens. British Poultry Science (2005b) 46: 137-43.
De Boever S., Beyaert R., Vandemaele F., Baert K., Duchateau L., Goddeeris B., De
Backer P. & Croubels, S. The influence of age and repeated lipopolysaccharide
administration on body temperature and the concentration of interleukin-6 and
IgM antibodies against lipopolysaccharide in broiler chickens. Avian Pathology
(2008) 37: 39-44.
EMEA. (2003) Scientific discussion CVMP/221/01-Rev.3, 1-20.
Fiebich B.L., Hofer T.J., Lieb K., Huell M., Butcher R.D., Schumann G., SchulzeOsthoff K., Bauer J. The nonsteroidal anti-inflammatory drug tepoxalin inhibits
interleukin-6 and alpha1-anti-chymotrypsin synthesis in astrocytes by preventing
degradation of IκB-alpha. Neuropharmacology (1999) 38: 1325-1333.
147
Homer L.M., Clarke C.R. & Weingarten A.J. Effect of dietary fat on oral bioavailability of tepoxalin in dogs. Journal of Veterinary Pharmacology and Therapeutics
(2005) 28: 287-291.
Kazmi S.M., Plante R.K., Visconti V., Taylor G.R., Zhou L. & Lau C.Y. Suppression
of NF kappa B activation and NF kappa B-dependent gene expression by tepoxalin, a dual inhibitor of cyclooxygenase and 5-lipoxygenase. Journal of Cellular
Biochemistry (1995) 57: 299-310.
Kirchner T., Aparicio B., Argentieri D.C., Lau C.Y. & Ritchie D.M. Effects of tepoxalin, a dual inhibitor of cyclooxygenase/5-lipoxygenase, on events associated
with NSAID-induced gastrointestinal inflammation. Prostaglandins, Leukotrienes and essential fatty acids (1997) 56: 417-423.
Knight E.V., Kimball J.P., Keenan C.M., Smith I.L., Wong F.A., Barrett D.S., Dempster A.M., Lieuallen W.G., Panigrahi W.J. & Szot R.J. Preclinical toxicity
evaluation of tepoxalin, a dual inhibitor of cyclooxygenase and 5-lipoxygenase,
in Sprague-Dawley rats and beagle dogs. Fundamental and Applied Toxicology
(1996) 33: 38-48.
Rainsford K.D., Ying C. & Smith F. Selective effects of some 5-lipoxygenase inhibitors on synovial interleukin-1 (IL-1) production compared with IL-1 synthesis
inhibitors. Agents and Actions (1993) 39: C186-188.
Rainsford K.D., Ying C. & Smith F. Effects of 5-lipoxygenase inhibitors on interleukin production by human synovial tissues in organ culture: comparison with
interleukin-1-synthesis inhibitors. Journal of Pharmacy and Pharmacology
(1996) 48: 46-52.
Ritchie D.M., Argentieri D.C., Aparicio B.L., Plante R.K., Lau C.Y. & Barbone A.G.
Cytokine-modulating activity of tepoxalin, a new potential antirheumatic. International Journal of Immunopharmacology (1995) 17: 805-812.
Waldman S.A., Vitow C., Osborne B., Gillen L., Argentieri D.C., Wong F.A., Smith
I.L., Chow A.T., Misiti J. & Bjornsson T.D. Pharmacokinetics and pharmacodynamics of tepoxalin after single oral dose administration to healthy volunteers.
Journal of Clinincal Pharmacology (1996) 36: 462-468.
148
Wallace J.L., Cirino G., Cicala C., Anderson D.W., Argentieri D. & Capetola R.J.
Comparison of the ulcerogenic properties of tepoxalin with those of nonsteroidal
anti-inflammatory drugs (NSAIDs). Agents and actions (1991) 34: 247-250.
Wallace J.L., McCafferty D., Carter L. & McKnight W. Tissue-selective inhibition of
prostaglandin synthesis in rat by tepoxalin: anti-inflammatory without gastropathy? Gastroenterology (1993) 105: 1630-1636.
Willburger R.E., Wittenberg R.H., Schmidt K., Kleemeyer K.S. & Peskar B.A. Antiinflammatory effect of tepoxalin: blood and synovial tissue studied in patients
with knee arthrosis. Acta Orthopedica Scandinavica (1998) 69: 295-300.
Yamaoka K., Nakagawa T. & Uno T. Application of Akaike‟s information criteria
(AIC) in the evaluation of linear pharmacokinetics. Journal of Pharmacokinetics
and Biopharmaceutics (1978) 6: 165–175.
Zhou L., Ritchie D., Wang E.Y., Barbone A.G., Argentieri D. & Lau C.Y. Tepoxalin,
a novel immunosuppressive agent with a different mechanism of action from
cyclosporin A. The Journal of Immunology (1994) 153: 5026-5037.
Zubrin,
Technical
Monograph,
Schering-Phough
Animal
Health
(2003).
149
Chapter 2 Pharmacodynamics and pharmacokinetics of tepoxalin, ketoprofen and sodium-salicylate in an intravenous LPS inflammation model in broiler chickens
Adapted from
De Boever S., Neirinckx E., Meyer E., De Baere S., Beyaert R., De Backer P. &
Croubels S. Pharmacodynamics of tepoxalin, sodium-salicylate and ketoprofen in an
intravenous lipopolysaccharide inflammation model in broilers.
Journal of Veterinary Pharmacology and Therapeutics, conditionally accepted.
151
Abstract
The pharmacodynamic properties of tepoxalin, Na-salicylate and ketoprofen were
determined in an intravenous lipopolysaccharide (LPS) inflammation model in broiler
chickens. The drugs were administered orally at a dose of 30 mg/kg, 50 mg/kg and 3
mg/kg, respectively. LPS administration induces an increase in the intracellular expression of interleukin (IL)-1β and IL-6 and the secreted IL-6 plasma concentration.
Furthermore, an elevation in body temperature is noted. Despite pretreatment with a
single dose of the drugs and LPS administration on the Tmax of the drug after a second
dose, no decrease was seen in systemic IL-6 levels. The intracellular expression of IL1β in the heterophils was slightly decreased if LPS was administered in combination
with each of the 3 drugs. Tepoxalin and Na-salicylate administration had no significant effect on the LPS induced increase in prostaglandin E2 (PGE2) plasma concentration, in contrast to ketoprofen. None of the three drugs were able to influence the elevation in body temperature after LPS administration. The pharmacokinetic properties
of Na-salicylate and ketoprofen were not altered in combination with LPS administration. However, LPS significantly decreased the AUC0→6h of the active metabolite of
tepoxalin, RWJ-20142, indicating a perfusion-limited elimination for this molecule.
152
1.
Introduction
Lipopolysaccharide (LPS), an integral component of the Gram-negative bacterial cell
wall, is commonly used to induce an acute phase response. Acute endotoxemia
represents an adequate tool for understanding inflammatory processes (Remick and
Ward, 2005). Furthermore, the European Medicines Evaluation Agency (EMEA) recognizes the Escherichia coli (E. coli) endotoxin-induced fever model as an acceptable method for the assessment of the anti-pyretic effect of nonsteroidal antiinflammatory drugs (NSAIDs) (Anonymous, 2001). In our laboratory, an intravenous
inflammation model was developed in broiler chickens, to be able to test the pharmacodynamic properties of NSAIDs (De Boever et al., 2008). The most obvious and
relevant parameters in this inflammation model are the cytokine expression and the
elevation in body temperature after LPS administration (De Boever et al., 2009a).
Salicylates are probably the oldest and still most widely used anti-inflammatory drugs.
Since salicylates lack the acetyl group of acetyl salicylic acid, they are believed to be
ineffective as direct cyclooxygenase (COX) inhibitor, but they are nevertheless able to
reduce inflammation indirectly through inhibition of Nuclear Factor – κB (NF-κB)
transcription factor activation, which mediates COX-2 expression (Tegeder et al.,
2001; D‟Acquisto et al., 2002). This is in contradiction with the findings of Giuliano
et al. (2001) that salicylate is capable of inhibiting COX-2 activity in vivo without
affecting COX-2 expression.
Tepoxalin is indicated for the control of pain and inflammation associated with osteoarthritis in dogs. Besides its anti-inflammatory and analgesic properties, tepoxalin
has been reported to inhibit T cell proliferation and to have cytokine modifying activity by suppression of NF-κB (Rainsford et al., 1993, 1996; Zhou et al., 1994; Kazmi
et al., 1995; Ritchie et al., 1995; Willburger et al., 1998; Lee & Burckart, 1998; Fiebich et al., 1999). After oral administration in humans, dogs and chickens, tepoxalin is
rapidly converted to its active, carboxylic acid metabolite RWJ-20142, which inhibits
COX activity but not lipoxygenase activity (Waldman et al., 1996; Homer et al.,
2005; De Boever et al., 2009b).
Ketoprofen is a chiral compound existing as a racemic mixture of R (-) and S (+)
stereoisomers and is indicated in the treatment of inflammatory and painful conditions
153
of the bones and joints and muscular-skeletal systems in cattle, horses, dogs and cats.
It is known to inhibit COX activity, but is also reported to modulate cytokine production (Ghezzi et al., 1998).
The pharmacokinetic properties of these 3 drugs in healthy broiler chickens were determined previously in our group (Baert & De Backer, 2003; De Boever et al., 2009;
Neirinckx et al., submitted). The aim of the present study was twofold. First, to evaluate the pharmacodynamic properties of Na-salicylate, tepoxalin and ketoprofen on the
interleukin-1β and interleukin-6 expression and on body temperature after intravenous
LPS administration in broiler chickens. Secondly, the effect of LPS administration on
the pharmacokinetic properties of the drugs was determined.
2.
Materials and methods
2.1. Animals
Forty eight one-day-old, unvaccinated, Ross chicks of both sexes were obtained from
a commercial hatchery. Temperature and relative humidity accorded with the requirements of young chickens and temperature was adjusted to prevent huddling
(Anonymous, 2004). The cages had a floor area of 1 m² and a 1 m high wooden frame
covered with wire. The concrete floor was covered with wood shavings. Normal hygienic measures were taken to avoid contact with pathogens as much as possible. The
lighting schedule consisted of 12 hours dark and 12 hours light. Commercial pullet
starter feed (AVEVE, Merelbeke, Belgium) and tap water were available ad libitum.
All experiments and procedures were approved by the Ethics Committee of the Faculty of Veterinary Medicine, Ghent University (EC 2008/069).
2.2. Drugs and reagents
Solvents of high-performance liquid chromatography (HPLC) grade were used for
HPLC analysis and LC-MS/MS analysis and were obtained from Sigma Chemical Co.
(Bornem, Belgium) and Acros (Geel, Belgium). Analytical standards of tepoxalin and
its metabolites, RWJ-20142 and RWJ-20294, used for HPLC-analysis were a kind gift
from Schering-Plough Co. (Wicklow, Ireland). Ketoprofen was a kind gift of Kela
(Hoogstraten, Belgium). Na-salicylate, o-anisic acid and fenoprofen were purchased at
Sigma Chemical Co.
154
2.3. Experimental protocol
At the age of five weeks, the animals were divided in 8 groups of 6 animals of mixed
breed. The mean body weight of all animals was 1.27 ± 0.16 kg. One group was injected intravenous (IV) with LPS of E. coli O127 B8 (Sigma-Aldrich) at a dose of 1.5
x 106 units/kg or 2.5 mg/kg. The control animals were injected with the same amount
of pyrogen free water. Three groups were treated with one of the three drugs in combination with LPS administration (either Na-salicylate, ketoprofen or tepoxalin).
Three other groups were treated with one of the three drug in combination with pyrogen free water. Na-salicylate was administered orally at a dose of 50 mg/kg. A 50
mg/ml solution was made by dissolving 500 mg of Na-salicylate in 10 ml tap water.
Ketoprofen was also administered orally at a dose of 3 mg/kg. A 6 mg/ml solution
was made by dissolving 60 mg of ketoprofen in 10 ml of tap water. Both drugs were
administered as a bolus, using a tube inserted into the oesophagus. For Na-salicylate
and ketoprofen the dose was similar to the one of the commercial products for veterinary use. The dose of tepoxalin was previously used in broiler chickens for the determination of the pharmacokinetic properties of the drug (De Boever et al., 2009b). Tepoxalin was administered at a dose of 30 mg/kg. Lyophilisates tablets (Zubrin Oral
Lyophilisates®, 50 mg; Schering-Plough, Brussels, Belgium) were weighed and the
amount corresponding to 30 mg/kg was given directly into the beak of the animal. The
Tmax was 1.45; 1.25 and 0.36 h for Na-salicylate, tepoxalin and ketoprofen, respectively.
All three drugs were administered 12 h before the administration of LPS or pyrogen
free water. LPS or pyrogen free water were administered at the Tmax of each drug after
the second dose.
Body temperature was measured by inserting a thermocouple probe (Physitemp Instruments, Clifton, NJ, USA) 5 cm into the cloaca, before and at 1, 2, 3.5, 5, 6.5, 8, 12
and 24 h after LPS administration. The area under the body temperature versus time
curve from 0 to 5 h and 0 to 24 h post administration (p.a.) (AUC0→5 h and AUC0→24 h)
was calculated to evaluate differences between treatment groups (α=0.05). AUC0→5 h
was calculated to evaluate the acute phase of the inflammation, AUC 0→24 h was calculated to evaluate the whole inflammation process.
155
For flow cytometric analysis of intracellular IL-1β and IL-6, 0.5 ml blood was withdrawn in heparin containing tubes from 4 LPS-treated animals, 3 control animals, 3
animals treated with LPS in combination with the drug and 3 animals that received the
drug alone, at 2, 3 and 4 h after LPS administration.
Blood (0.5 ml) from all animals was withdrawn in heparin containing tubes and
plasma collected before and at 1.5, 3, 4.5 and 6 h after LPS administration for determination of secreted IL-6, assayed using IL-6 dependent murine 7TD1 cells. Blood (1
ml) from all animals was withdrawn in heparin containing tubes and plasma collected
before and at 0.5, 1, 1.5, 3, 4.5 and 6 h after LPS administration for determination of
drug concentration.
At the same time points the PGE2 concentration was determined in plasma by LCMS/MS.
2.4. Flow cytometric analysis
Intracellular IL-1β and IL-6 were analysed in chicken leukocytes using a flow cytometric
method optimised in our group (De Boever et al., in press).
Chicken leukocytes were obtained after lysis of the erythrocytes with FACS Lysing
solution: 4.5 ml of FACS Lysing solution (1/10 diluted with distilled water) (Beckton
Dickinson Biosciences, Erembodegem, Belgium) was added to 0.5 ml of heparin
treated blood in a falcon tube and kept for 10 min at room temperature. After washing,
the pellet was resuspended in 500 µl of RPMI (Invitrogen, Merelbeke, Belgium) and
50 µl was pipetted into a flow cytometer tube. Leukocytes were separated from the
remaining red blood cell nuclei, using phycoerythrin (PE) - conjugated Cell Lab
mouse anti-chicken CD45 antibodies (Beckman Coulter, 733074), which were added
in a concentration of 6 µg/ml. Samples were incubated for 30 min at 4°C. Permeabilization was performed using 500 µl FACS Permeabilizing solution 2 (1/10 diluted with
distilled water) (Beckton Dickinson Biosciences) for 10 min, again at room temperature. Primary antibodies raised in rabbits and directed against chicken IL-1β and IL-6,
were used as primary antibodies (AHP941Z and AHP942Z, AbD Serotec, Cergy
Saint-Christophe, France) and were added in a concentration of 50 µg/ml and samples
were incubated for 30 min at room temperature. Since no antibodies against TL1A are
commercially available, this analysis could not be included. Next, goat serum (Invi-
156
trogen) at a concentration of 2% in RPMI was added for 30 min and samples were
incubated at room temperature. Finally, the corresponding allophycocyanin (APC)labelled secondary antibody (APC-conjugated F(ab‟)2 goat antibodies to rabbit immunoglobulin, Santa Cruz biotechnology Inc., Heidelberg, Germany) was added at a
concentration of 6 µg/ml.
The cells were resuspended in 450 µl CellFIX (1/10 diluted with distilled water) and
pipetted into Trucount Tubes (BD Biosciences). Samples were analysed using a FACSCanto flow cytometer (BD Biosciences). The different cell populations were demarcated in an FL-2/Side Scatter (SSC) dot plot, based on a positive staining for CD45
and their granularity. The PE fluorescence dot plots of the gated cells were then plotted and all data were corrected for autofluorescence. Cytokine-specific fluorescence
was defined as events to the right of the autofluorescence marker and the mean fluorescence intensity (MFI) and proportion of cells staining positive for each cytokine
was recorded.
2.5. IL-6 measurement by bio-assay
Concentrations of IL-6 were measured in plasma using IL-6 dependent murine 7TD1
hybridoma cells (Van Snick et al., 1986). Briefly, cells were cultured in 96 well microtitre plates for 72 h in medium with different dilutions of the plasma samples. A
colorimetric hexosaminidase enzyme reaction was used to reflect the number of living
cells which was related to the amount of IL-6 in the media (Landegren, 1984). The
concentration of IL-6 in plasma samples was calculated from a standard curve obtained using a dilution of recombinant chicken IL-6. The comparison of the IL-6 concentration between the different treatment groups was done 3 h after the administration of LPS, the time point at which the IL-6 concentration reached its highest value.
157
2.6. HPLC techniques
Na-salicylate, tepoxalin and ketoprofen were all quantitated using validated analytical
methods (linearity, within- and between-run precision and accuracy, limit of quantification (LOQ), limit of detection (LOD) and specificity – detailed results not shown)
(Anonymous 2002, Knecht and Stork, 1974). Analyte recovery was not evaluated
since all analytical methods used internal standardization to allow proper quantification.
Na-salicylate: salicylate was quantitated using a validated HPLC method with UV
detection (305 nm) as described by Baert (2003). Samples were prepared by pipetting
500 µl of plasma into a 15 ml screw-capped tube, followed by the addition of 50 ml
of internal standard (o-anisic acid in methanol, 100 µg/ml), 150 µl of 1 M HCl and 5
ml of diethylether. After centrifugation, the organic layer was transferred to a clean
screw-capped tube and evaporated under nitrogen at 40°C. The residue was dissolved
in 250 µl of the mobile phase and 100 µl were injected on a Thermo Separations
Product (TSP, Fremont, CA, USA) HPLC system. A 250 x 4.6 mm I.D. reversedphase column (5 µm Spherisorb ODS-2, Chrompack, Antwerp, Belgium) attached to
an appropriate guard column was used. The mobile phase comprised of 85% wateracetic acid (99:1, v/v) and 15% acetonitrile. The limit of quantification (LOQ) was set
at 5 µg/ml. The flow rate was 1 ml/min.
Tepoxalin: Plasma concentrations of tepoxalin and its active, acid metabolite RWJ20142 were determined by a validated HPLC method with fluorescence detection as
described previously (De Boever et al., 2009). Briefly; 225 µl of plasma were pipetted
into a 1.5 ml Eppendorf tube, followed by the addition of 25 µl of internal standard
(RWJ-20294, Schering-Plough Co.) (25 or 250 µg ⁄ml) and 500 µl of acetonitrile. After vortexing briefly and centrifugation (10 000 g for 10 min at room temperature), 50
µl of the supernatant were injected in the HPLC system (TSP, Fremont, CA, USA)
(λex = 290 nm and λem = 440 nm). A PLRP-S column (Polymer Laboratories, Shropshire, UK) attached to an appropriate guard column was used. The mobile phase (MF)
A consisted of 0.01 M 1-octane-sulfonic acid in 0.01 M acetic acid in water, mobile
phase B consisted of tetrahydrofuran. The calibration curves for tepoxalin and its acid
metabolite were linear between 0.025 and 1 µg/ml and 2.5 and 100 µg ⁄ml (r > 0.99).
The LOQ was set at 0.025 µg/ml for both compounds. The flow rate was 0.7 ml/min.
158
Ketoprofen was quantitated using a validated LC-MS/MS method. Prior to LCMS/MS analysis, samples were prepared by pipetting 100 µl of plasma into a 15 ml
screw-capped tube, followed by the addition of 50 µl of internal standard (flunixin,
25 µg/ml), 100 µl of 1 N HCl and 3 ml of ethylacetate. After centrifugation, the organic layer was transferred to another tube and evaporated under nitrogen at 40°C.
The residue was dissolved in 200 µl of HPLC water and 5 µl were injected on the
LCMS/MS system (Surveyor autosampler plus and MS pump plus in combination
with a TSQ Quantum Ultra, all from Thermo Electron, Zellik, Belgium). Separation
of the analyte and the internal standard was performed on a Nucleodur C18 Pyramid
column (125 x 2 mm i.d., dp: 3 µm) from Macherey-Nagel (Filterservice, Eupen, Belgium). A guard column of the same type was used. The mobile phase consisted of
0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B) and a gradient
elution was performed. The flow-rate was 200 µl/min and the run time was 13 min.
The effluent was sent to the MS instrument from 3 to 8 min. The MS was operated in
the positive electrospray ionisation (ESI) mode. The following selected reaction monitoring (SRM) transitions and collision energy (CE) were used: ketoprofen, m/z =
255.10 > 209.10 (CE: 14V) and 255.10 > 105.00 (CE: 25V); flunixin, m/z = 297,10 >
278.99 (CE: 23V) and 297.10 > 264.00 (CE: 35V). Linear calibration curves (r >
0.99) were obtained between 0.05 and 10.0 µg/ml. The LOQ was set at 0.050 µg/ml.
2.7. Pharmacokinetic analysis
The half-life of elimination (t½ ) and area under the plasma concentration–time curve
(AUC0→6 h) of salicylate and the active metabolite of tepoxalin, RWJ-20142, were
calculated using the non compartmental PK functions for Microsoft Excel.
2.8. Prostaglandin E2 analysis
PGE2 was quantitated using a LC-MS/MS method. Prior to LC-MS/MS analysis,
samples were prepared by pipetting 100 µl of plasma into an l.5 ml Eppendorf tube,
followed by the addition of 20 µl of internal standard (PGE2- d4, 0.5 µg/ml) and 100
µl of methanol. After vortexing briefly and centrifugation (10 000 g for 10 min at
room temperature), the supernatant was transferred to an autosampler vial, containing
100 µl of a 1% solution of concentrated ammonia in water. After vortex mixing for 30
159
sec, a 10- µl aliquot was injected on the LC-MS/MS system (Surveyor autosampler
plus and MS pump plus in combination with a TSQ Quantum Ultra, all from Thermo
Electron.
Chromatography was performed using a PLRP-S column (150 x 2.1 mm i.d., dp: 5
µm) from Varian (Sint-Katelijne-Waver, Belgium). A guard column of the same type
was used. The mobile phase consisted of 1 % of concentrated ammonia in water (A,
90 %) and methanol (B, 10 %) and a gradient elution was performed. The flow-rate
was 200 µl/min and the run time was 12 min. The effluent was sent to the MS instrument from 6.3 to 7.8 min. The MS was operated in the negative electrospray ionisation (ESI) mode. The following selected reaction monitoring (SRM) transitions and
collision energy (CE) were used: PGE2-d4 (IS), m/z = 355.14 > 275.11 (CE: 25V) and
355.14 > 318.91 (CE: 19V); PGE2, m/z = 351.00 > 271.20 (CE: 18V) and 351.00 >
315.20 (CE: 17V). The LOQ was set at 50 pg/ml.
2.9. Statistical analysis
Using a Student‟s t-test (α = 0.05), the values for AUC0→5 h and AUC0→24 h for the
body temperature, the PGE2 concentration in plasma at 1.5 h after LPS administration
and the IL-6 concentration in plasma at 3 h after LPS administration were evaluated.
For the metabolite of tepoxalin and Na-salicylate the values for t½ and the AUC0→6 h
were also compared using the same test. For the results of the flow cytometric analysis of intracellular IL-1β and IL-6, the nonparametric Kruskal-Wallis test was used.
160
3.
Results
3.1. Clinical signs
Clinical signs that were seen during the experiment were somnolence, anorexia, adipsia, diarrhea and ruffling of the feathers.
3.2. Body temperature
The results of the body temperature are represented in Figure 1. LPS induced a significant increase in body temperature, which could also be concluded from the significant difference in AUC (0→24 h) between LPS and control animals (LPS: 995.56 ± 3.88
°C x h; control: 987.51 ± 2.44 °C x h) (P < 0.05). No significant differences in
AUC(0→5h) were seen between treatments. There was no influence on the course of the
body temperature by either administered drug.
Figure 1: Body temperature versus time curve of LPS treated animals (mean + SD, n=6), LPS
treatment in combination with tepoxalin (T) (mean, n=6), ketoprofen (K) (mean, n=6) or Nasalicylate (S) (mean, n=6) and control animals (mean + SD, n=6)
161
3.3. Flow cytometric analysis of IL-1β and IL-6
The intracellular expression of IL-1β and IL-6 in the heterophils was increased 2 h
after LPS administration compared to control animals as illustrated by Table 1. The
administration of tepoxalin, Na-salicylate and especially ketoprofen slightly decreased
the MFI for IL-1β.
Table 1: Mean Fluorescence Intensity (± SD) for IL-1β and IL-6 in the heterophils, 2 h after LPS
administration of LPS treated animals (n = 4), control animals (n = 3), LPS treatment in
combination with tepoxalin (T + LPS, n = 3), with ketoprofen (K + LPS, n = 3) and Na-salicylate
(S + LPS, n = 3)
IL-1β
IL-6
LPS
28252.0 ± 8029.6 23546.7 ± 14291.6
Control
7274.7 ± 4170.6
4385.7 ± 923.7
T + LPS 13364.3 ± 3538.6
12935.3 ± 5955.6
K + LPS
8992.7 ± 3338.9
14528.5 ± 12899.7
S + LPS
10028.7 ± 8431.5
14808.3 ± 9271.6
162
3.4. Bio-assay for IL-6 measurement
The concentration of the IL-6 in plasma 3 h after LPS administration is presented in
Figure 2. LPS induced a significant increase in circulating IL-6, 3 h after administration (P < 0.05). Like the course of the body temperature, the administration of the
anti-inflammatory drugs did not influence the concentration of IL-6 in plasma after
LPS administration.
Figure 2: Concentration of secreted IL-6, 3 h after LPS administration in LPS treated animals
(n=6), LPS treatment in combination with tepoxalin (T) (n=6), ketoprofen (K) (n=6) or Nasalicylate (S) (n=6) and control animals (n=6) expressed as mean concentration (+SD)
163
3.5. PGE2 concentration in plasma
The course of the PGE2 concentration in plasma, which reached its highest
concentration 1.5 h after LPS administration, is shown in Figure 3. LPS
administration induced a significant increase in PGE2 concentration after 1.5 h in
comparison to the control animals (P < 0.05). Combination of LPS with tepoxalin and
Na-salicylate slightly reduced the concentration of PGE2 in plasma, when combined
with ketoprofen on the other hand, the latter was able to significantly decrease the
concentration (P < 0.05). The concentration of PGE2 in the animals treated with
pyrogen free water in combination with the drug was comparable to the control
animals (data not shown).
*
*
Figure 3: Concentration of PGE2 1.5 h after LPS administration in LPS treated animals and LPS
treated animals in combination with tepoxalin (T + LPS), Na-salicylate (S + LPS) and ketoprofen
(K + LPS) (n=6) and control animals (n=6) expressed as mean concentration (+SD)
Means indicated with an asterix differ significantly from LPS treated animals (P < 0.05)
164
3.6. Pharmacokinetics of tepoxalin, ketoprofen and Na-salicylate in combination
with LPS administration
LPS did not affect the pharmacokinetics of Na-salicylate in the chicken as shown in
Figure 4.
Figure 4: Plasma concentration of salicylate versus time graph of LPS treated animals in combination with salicylate (S + LPS) (n=6) and salicylate treated animals only (S) (n=6) expressed as
mean concentration (+SD)
The values for t½ and the AUC0→6 h are mentioned in Table 2. No significant differences in these parameters could be calculated after LPS administration.
Table 2: Mean (± SD) half-life of elimination (t½) and area under the curve (AUC0→6h) of the
active metabolite, RWJ-20142, salicylate and ketoprofen
Drug
t½ (h)
AUC0→6h (µg.h/ml)
Drug only
LPS-treated
Drug only
LPS-treated
2.77 ± 1.55a
2.52 ± 0.66a
284.10 ± 71.42a
289.11 ± 52.67a
Ketoprofen
ND
ND
1.16 ± 0.69a
0.80 ± 0.45a
RWJ-20142
2.65 ± 0.39a
3.08 ± 0.92a
50.26 ± 14.24a
30.46 ± 15.21b
Salicylate
Means with different superscript letters are significantly different at P < 0.05; ND: not determined
165
For tepoxalin, concentrations of the drug in plasma were above the LOQ of 0.025
µg/ml from 0.5 to 3 h after LPS administration, ranging only between 0.147 to
0.039 µg/ml. After oral administration of tepoxalin, its metabolite, RWJ-20142,
was abundantly present in the plasma in concentrations 100 times higher than the
parent molecule. The administration of LPS decreased the AUC0→6
h
of the
metabolite as illustrated by Figure 5.
Figure 5: Concentration of RWJ-20142, the active metabolite of tepoxalin versus time graph of
LPS treated animals in combination with tepoxalin (RWJ-20142 + LPS) (n=6) and tepoxalin
treated animals only (RWJ-20142) (n=6) expressed as mean concentration (+SD)
The AUC0→6 h of the metabolite was significantly lower after LPS administration.
166
The curves of the plasmaconcentration of ketoprofen and ketoprofen in combination
with LPS administration are shown in Figure 6. One and a half h after LPS administration the concentration of ketoprofen in plasma slightly increased this can be due to
the presence of an enterohepatic cycle or LPS could influence the absorption of the
drug.
Figure 6: Concentration versus time graph of LPS treated animals in combination with ketoprofen (K + LPS) (n=6) and ketoprofen treated animals only (K) (n=6) expressed as mean
concentration (+SD)
167
4.
Discussion
Acute endotoxemia represents an adequate tool for understanding inflammatory processes, furthermore the EMEA recognizes the E. coli endotoxin-induced fever model
for the assessment of the anti-pyretic effect of NSAIDs (Anonymous, 2001; Remick
and Ward, 2005). Such an endotoxin inflammation model in broiler chickens, characterized by fever and cytokine expression, was developed in our laboratory (De Boever
et al., 2008). In the present study, the pharmacodynamic properties of tepoxalin, Nasalicylate and ketoprofen were investigated in the developed model, following the
determination of the pharmacokinetic parameters of these in chickens (Baert & De
Backer, 2003; De Boever et al., 2009; Neirinckx et al., submitted). Using the latter
information, the chickens were premedicated with a single dose 12 h before LPS administration and LPS was administered on the Tmax after a second drug administration.
The administration of LPS induces a plethora of events including the appearance of
pyrogenic cytokines in the circulation among which TNF-α, IL-1β and IL-6 are considered the most important in mammals. In chickens, TNF-α has not been identified
but TNF-like ligand 1A (TL1A) produces effects similar to TNF-α such as production
of IL-1β and IL-6, raising α1 acid glycoprotein, ceruloplasmin and nitric oxide (NO)
(Takimoto et al., 2008). The parameters evaluated in the present experiment were intracellular IL-1β and IL-6, secreted IL-6 concentration in plasma and body temperature. To evaluate the inhibitory effect of the NSAIDs on COX-activity, PGE was additionally measured in plasma.
The importance of IL-6 in mediating the febrile response during infection has been
demonstrated by studies showing that neither transgenic mice lacking IL-6 nor rats
treated with IL-6 antiserum develop any fever in response to LPS or IL-1β. The cytokines signal the brain, where the level of PGE2 is elevated, recognized as key mediator
in fever and the entire febrile course requires de novo synthesis of PGE2 (Coceani and
Akarsu, 1998; Netea et al., 2000; Ivanov et al., 2002, Pecchi et al., 2009). In mice, the
presence of IL-6 is critical for fever induction, although IL-6 itself is not or only
weakly pyrogenic. Two hypotheses have been suggested by Nilsberth et al. (2009):
IL-6 either prevents an antipyretic response to peripheral immune challenge, or is involved in the transport of PGE2 into the brain. PGE2 is produced by brain vascular
168
cells upon peripheral immune challenge, although blood-borne, circulating PGE2
originating from the macrophages located within the LPS-processing organs such as
lung and liver can initiate the early fever phase (Pecchi et al., 2009). In chickens, intracerebroventricular injection of PGE2 was able to enhance body temperature (Macari
et al., 1993). Other authors however, doubt the involvement of hypothalamic PGE2 in
the development of fever, but since inhibitors of the prostanoid synthesis have been
shown to be effective antipyretics in pigeons, it seems likely that prostanoids are involved in fever in birds (Fraifeld et al., 1995; Fraifeld and Kaplanski, 1998). COX, an
enzyme essential in the production of prostanoids, exist in two isoforms. COX-1 is
expressed constitutively in most tissues, playing a wide range of housekeeping roles,
while COX-2 transcripts are barely detectable in most quiescent cells, but are robustly
upregulated by a variety of stimuli, including LPS (Tegender et al., 2001; Ivanov et
al., 2002). PGE2 production is a valuable parameter for evaluating COX-2 activity,
while thromboxane B2 production is used to determine COX-1 effects (Huntjens et al.,
2005).
The anti-inflammatory effects of Na-salicylate cannot be attributed to covalent modification of COX, as is the case for acetylsalicylic acid but it inhibits activation of Nuclear Factor-κB (NF-κB) (D‟acquisto et al., 2002). NF-κB is a transcription factor
regulated by an inhibitory molecule called inhibitory κB (IκB) which retains NF-κB in
the cytoplasm under normal conditions. Upon cellular stimulation, IκB is phosphorelated and releases NF-κB allowing its translocation to the nucleus where it binds to its
target promoters (Doyle and O‟Neill, 2006). Phosphorylation of IκB is mediated by
the IκB kinase (IKK) complex of which Na-salicylate is able of binding and blocking
the ATP binding site of one of the subunits of IKK, namely IKKβ (Yin et al., 1998;
Hayden and Ghosh, 2008). This is in contrast to the findings of Giuliano et al. (2001)
that salicylate inhibits COX-2 activity in vivo without affecting COX-2 expression. In
the current study, Na-salicylate administration did not affect the concentration of IL-6
in plasma nor the elevation in body temperature induced by LPS administration. Baert
et al. (2005) investigated the influence of Na-salicylate on fever in broiler chickens
after LPS injection from the same serotype as used in this experiment. Na-salicylate
(100 and 200 mg/kg) had an effect on temperature in the period from 1 to 5 h after
LPS administration, whereas in the second period from 6 to 8 h after LPS administra-
169
tion, this relationship was less pronounced. In the present study, fever only emerged
from 6 h after LPS administration and also a lower dose of Na-salicylate was used.
The second NSAID tested was tepoxalin which is also capable of inhibiting NF-κB,
besides its ability to inhibit COX and LOX (Willburger et al., 1998; Fiebich et al.,
1999). Tepoxalin is converted to its active, acid metabolite which selectively inhibits
COX but not LOX. In analogy with Na-salicylate, tepoxalin administration did not
influence the concentration of IL-6 in plasma nor the course of the body temperature
after LPS administration. Despite the fact that both Na-salicylate and tepoxalin are
COX inhibitors, they were not able to significantly reduce the PGE2 concentration in
plasma although a trend was seen.
The third NSAID evaluated was ketoprofen.which influences cytokine expression
through PGE2 suppression. Indeed, PGE2 can induce the release of IL-6 in a wide variety of cell types through activation of nuclear factor-IL6 (NF-IL6) (Tsuboi et al.,
1995; Davidson et al., 2001; Yoon et al., 2003). In this experiment, ketoprofen administration decreased the plasma concentration of PGE2 but not of IL-6. As for both
other NSAIDs, the elevation of the body temperature after LPS administration was not
inhibited. Also in calves, ketoprofen administration before a 3h IV infusion of E. coli
LPS failed to reduce the body temperature. As an explanation for this failure was
mentioned that dose and dosing regimen may not have been optimal because the
pharmacokinetics were not determined in the animal species (Semrad, 1993). This
argument is certainly not valid for this experiment.
All three drugs slightly reduced the intracellular expression of IL-1β, without any effect on the body temperature.
Different reasons can be brought forward why the administered NSAIDs did not affect
the measured parameters. The first reason can be the drug dose. For Na-salicylate a
dose of 50 mg/kg was chosen since this dose is similar to the one of the commercial
products for veterinary use (Anonymous, 2003). Our results and pharmacokinetic data
in broilers obtained after administration of this dose (Baert et al., 2003) confirmed
that a plasma concentration of 50 µg/ml was reached, which is reported to be the
plasma concentration of salicylic acid for which effective antipyretic, antiinflammatory and analgesic activity can be achieved (Lees and Higgins, 1985; Lees et
170
al., 1991). In the present study, plasma concentrations rose above this level until 2 h
after LPS administration.
Ritchie et al. (1995) determined an IC50 of 10-12 µM (or 3.858 µg/ml) for tepoxalin
on IL-6 production in human peripheral blood mononuclear cells (PBMC). Although
tepoxalin was administered at a dose of 30 mg/kg, which is already 3 times the dose
used in dogs for reduction of inflammation and pain relief (Zubrin®, leaflet), this concentration was not reached in plasma. In chickens, tepoxalin can be seen as a prodrug,
since after oral administration of the drug, only the active metabolite is present in
plasma. To our knowledge, no IC50 values are determined for this molecule. For ketoprofen an IC50 of 38 nM (or 9.66 ng/ml) for PGE2 was determined in human PBMC
(Tsuboi et al., 1995). This concentration was certainly reached in plasma after the
administration of 3 mg/kg ketoprofen to the animals. Despite the fact that ketoprofen
significantly reduced the concentration of PGE2 in plasma, it did not alter the body
temperature after LPS administration. It should be considered that ketoprofen successfully reduced the peripheral PGE2 concentration, probably was not able to reduce the
central elevation of prostanoids responsible for fever.
An alternative explanation could be that the other mediators involved in fever in birds
were not affected by the NSAIDs used. Several mediators have been implicated in
pyrogenesis such as bradykinin, endothelins melanocyte stimulating hormone and
nitric oxide (NO) (Martin et al., 1991; de Souza et al., 2002).
Besides the pharmacodynamic properties of the drugs, the influence of LPS on the
pharmacokinetics was evaluated for the first time in chickens in this study. All phases
that determine the pharmacokinetic profile of a drug, i.e. absorption, distribution, metabolism and excretion, can be affected during the acute phase response (Monshouwer
and Witkamp, 1999; Yang and Lee, 2008). Endotoxin induces effects on the kidneys
and liver resulting in a number of functional changes including decreases in renal
plasma flow, glomerular filtration rate and blood pressure, decreases of hepatic blood
flow and protein synthesis and increases in acute phase proteins (Hasegawa et al.,
1999).
In the present experiment, LPS did not affect the pharmacokinetic properties of the
administered drugs, except for the active metabolite of tepoxalin which was abundantly present after tepoxalin administration in a concentration 100 times higher than
171
the parent compound. This indicates the existence of a substantial first-pass metabolism. The AUC0→6 h of the metabolite was considerably lower after LPS administration, due to a change in hepatic blood flow by the induction of hypotension by LPS,
indicating the existence of a perfusion-limited elimination.
In conclusion, the administration of Na-salicylate, tepoxalin and ketoprofen slightly
reduced the intracellular IL-1β expression in the heterophils, but did not affect the
intracellular and secreted IL-6 concentration in plasma nor the course of the body
temperature after LPS administration. Since none of the administered drugs affected
IL-6, unfortunately no conclusions can be drawn on the importance of IL-6 as a fever
mediator in chickens. Additionally, Na-salicylate and tepoxalin were not able to significantly reduce the plasma concentration of PGE2, in contrast to ketoprofen.
The pharmacokinetic properties of Na-salicylate and ketoprofen were not altered by
LPS administration. The formation of the active metabolite of tepoxalin, however,
was affected by LPS administration resulting in a lower AUC0→6 h.
172
Acknowledgements
During the animal experiments, the help of J. Goossens, V. Vandenbroucke, A. Maes
and K. Baert was greatly appreciated. W. Burms is acknowledged for the analysis of
IL-6 in the plasma samples. K. Demeyere‟s help with the flow cytometric analysis
was greatly appreciated. The authors also would like to thank A. Van den Bussche and
J. Lambrecht for the help with the drug analyses.
173
References
Anonymous (2001). Guideline for the conduct of efficacy studies for nonsteroidal
anti-inflammatory drugs. EMEA/CVMP/237/01-FINAL
Anonymous (2002). Commission Decision 2002/657/EC implementing council Directive 96/23/EC concerning the performance of analytical methods and the interpretation of results, Official Journal of the European Communities, N° L221.
Anonymous (2003). Wijziging Vrijstellingsregeling artikel 2 Diergeneesmiddelenwet
1999.
Anonymous (2004). Draft Appendix A of the European Convention for the Protection
of Vertebrate Animals used for Experimental and other Scientific Purposes
(ETS No. 123).
Baert K. (2003). Pharmacokinetics and pharmacodynamics of nonsteroidal antiinflammatory drugs in birds. PhD thesis
Baert K. & De Backer P. Comparative pharmacokinetics of three nonsteroidal antiinflammatory drugs in five bird species. Comparative Biochemistry and Physiology Part C (2003) 134: 25-33.
Baert K., Duchateau L., De Boever S., Cherlet M. & De Backer P. Antipyretic effect
of oral sodium salicylate after an intravenous E. coli LPS injection in broiler
chickens. British Poultry Science (2005) 46: 137-143.
Coceani F. & Akarsu E. Prostaglandin E2 in the pathogenesis of fever. An update.
Annals of the New York Academy of Science (1998) 856: 76-82.
D‟Acquisto F., May M. & Ghosh S. Inhibition of Nuclear Factor Kappa B (NF-κB):
An emerging theme in anti-inflammatory therapies. Molecular Interventions
(2002) 2: 22-35.
Davidson J., Abul H., Milton A. & Rotondo D. Cytokines and cytokine inducers
stimulate prostaglandin E2 entry into the brain. Plugers Archive (2001) 442:
526-533.
De Boever S., Beyaert R., Vandemaele F., Baert K., Duchateau L., Goddeeris B., De
Backer P. & Croubels S. The influence of age and repeated lipopolysaccharide
administration on body temperature and the concentration of interleukin-6 and
IgM antibodies against lipopolysaccharide in broiler chickens. Avian Pathology (2008) 31: 39-44.
174
De Boever S., Croubels S., Meyer E., Sys S., Beyaert R., Ducatelle R & De Backer P.
Characterization of an intravenous lipopolysaccharide inflammation model in
broiler chickens. Avian Pathology (2009a) 38: 403-411.
De Boever S., Neirinckx E., Baert K., De Backer P. & Croubels S. Pharmacokinetics
of tepoxalin and its active metabolite in broiler chickens. Journal of Veterinary
Pharmacology and Therapeutics (2009b) 32: 97-100.
De Boever S., Croubels S., Demeyere K., Lambrecht B., De Backer P. & Meyer E.
Flow cytometric differentiation of avian leukocytes and analysis of their intracellular cytokine production. Avian Pathology, in press.
de Souza G., Cardoso R., Melo M., Fabricio A., Silva V., Lora M., De BrumFernandes A., Rae G., Ferreira S. & Zampronio A. A comparative study of the
antipyretic effects of indomethacin and dipyrone in rats. Inflammation Research (2002) 51: 024-032.
Doyle S. & O‟Neill L. Toll-like receptors: from the discovery of NF-κB to new insights into transcriptional regulations in innate immunity. Biochemical Pharmacology (2006) 72: 1102-1113.
Fiebich B., Hofer T., Lieb K., Huell M., Butcher R., Schumann G., Schulze-Osthoff
K. & Bauer J. The nonsteroidal anti-inflammatory drug tepoxalin inhibits interleukin-6 and alpha1-anti-chymotrypsin synthesis in astrocytes by preventing
degradation of IκB-alpha. Neuropharmacology (1999) 38: 1325-1333.
Fraifeld V., Blaicher-Kulick R., Degen A. & Kaplanski J. Is hypothalamic prostaglandin E2 involved in avian fever? Life Sciences (1995) 56: 1343-1346.
Fraifeld V. & Kaplanski J. Brain eicosanoids and LPS fever: species and age differences. Progress in Brain Research (1998) 115: 141-157.
Ghezzi P., Melillo G., Meazza C., Sacco S., Pellegrini L., Asti C., Porzio S., Marullo
A., Sabbatini V., Caselli G. & Bertini R. Differential contribution of R and S
isomers in ketoprofen anti-inflammatory activity: role of cytokine modulation.
The Journal of Pharmacology and Experimental Therapeutics (1998) 287:
969-974.
Graham J., Kollias-Baker C., Craigmill A., Thomasy S. & Tell L. Pharmacokinetics of
ketoprofen in Japanese quail (Coturnix japonica). Journal of Veterinary Pharmacology and Therapeutics (2005) 28: 399-402.
175
Giuliano F., Mitchell J. & Warner T. Sodium salicylate inhibits prostaglandin formation without affecting the induction of cyclooxygenase-2 by bacterial lipopolysaccharide in vivo. The Journal of Pharmacology and Experimental Therapeutics (2001) 3: 894-900.
Hasegawa T., Takagi K. & Kitaichi K. Effects of bacterial endotoxin on drug pharmacokinetics. Nagoya Journal of Medical Science (1999) 62: 11-28.
Hayden M., & Ghosh S. Shared principles in NF-kappaB signaling. Cell (2008) 132:
344-362.
Homer L.M., Clarke C.R. & Weingarten A.J. Effect of dietary fat on oral bioavailability of tepoxalin in dogs. Journal of Veterinary Pharmacology and Therapeutics
(2005) 28: 287-291.
Huntjens D., Danhof M., Della Pasqua O. Pharmacokinetic-pharmacodynamic correlations and biomarkers in the development of COX-2 inhibitors. Reumatology
(2005) 44: 846-859.
Ivanov A., Pero R., Scheck A. & Romanovsky A. Prostaglandin E2-synthesizing enzymes in fever: differential transcriptional regulation. American Journal of
Physiology. Regulatory, integrative and comparative physiology (2002) 283:
R1104-R1117.
Kazmi S., Plante R., Visconti V., Taylor G., Zhou L. & Lau C. Suppression of NF
kappa B activation and NF kappa B-dependent gene expression by tepoxalin, a
dual inhibitor of cyclooxygenase and 5-lipoxygenase. Journal of Cellular Biochemistry (1995) 57: 299-310.
Knecht, J., Stork G. (1974). Percentage and logarithmic procedures for calculation of
calibration curves. Fresenius Zeitschrift fur Analytische Chemie, 270(2), 97-99.
Landegren U. Measurement of cell numbers by means of the endogenous enzyme
hexosaminidase. Applications of detection of lymphokines and cell surface antigens. Journal of Immunological Methods (1984) 67: 379-388.
Lee J. & Burckart G. Nuclear Factor Kappa B: important transcription factor and
therapeutic target. Journal of Clinical Pharmacology (1998) 38: 981-993.
Lees P. & Higgins A. Clinical pharmacology and therapeutic uses of nonsteroidal anti-inflammatory drugs in the horse. Equine Veterinary Journal (1985) 17: 8396.
176
Lees P., May S. & McKellar Q. Pharmacology and therapeutics of nonsteroidal antiinflammatory drugs in the dog and cat: 1 General pharmacology. Journal of
Small Animal Practice (1991) 32: 183-193.
Macari M., Furlan R., Gregorut F., Secato E., Guerreiro J. Effects of endotoxin, interleukin-1 beta and prostaglandin injections on fever response in broilers. British
Poultry Science (1993) 34: 1035-1042.
Martin L., Catania A., Hiltz M. & Lipton J. Neuropeptide alpha-MSH antagonizes IL6 and TNF-induced fever. Peptides (1991) 12: 297-299.
Monshouwer M. & Witkamp R. Cytochromes and cytokines: changes in drug disposition in animals during an acute phase response: a mini-review. Veterinary
Quarterly (2000) 22: 17-20.
Neirinckx E., Croubels S., De Boever S., Remon J., Bosmans T., Daminet S., De
Backer P. & Vervaet C. Species comparison of enantioselective oral bioavailability and pharmacokinetics of ketoprofen. Research in Veterinary Science,
submitted.
Netea M., Kullberg B. & Van der Meer J. Circulating cytokines as mediators of fever.
Clinical Infectious Diseases (2000) 31: S178-184.
Nilsberth C., Elander L., Hamzic N., Norell M., Lönn J., Engström L. & Blomqvist A.
The role of Interleukin-6 in lipopolysaccharide-induced fever by mechanisms
independent of Prostaglandin E2. Neuroendocrinology (2009) 150: 1850-1860.
Pecchi E., Dallaporta M., Jean A., Thirion S. & Troadec J-D. Prostaglandins and sickness behavior: Old story, new insights. Physiology and Behavior (2009) article
in press.
Rainsford K., Ying C. & Smith F. Selective effects of some 5-lipoxygenase inhibitors
on synovial interleukin-1 (IL-1) production compared with IL-1 synthesis inhibitors. Agents and Actions (1993) 39: C186-188.
Remick D. & Ward P. Evaluation of endotoxin models for the study of sepsis. Shock
(2005) 24: 7-11.
Ritchie D., Argentieri D., Aparicio B., Plante R., Lau C. & Barbone A. Cytokinemodulating activity of tepoxalin, a new potential antirheumatic. International
Journal of Immunopharmacology (1995) 17: 805-812.
177
Semrad S. Comparative efficacy of flunixin, ketoprofen and ketorolac for treating endotoxemic neonatal calves. American Journal of Veterinary Research (1993) 9:
1511-1516.
Skordi E., Wilson I., Lindon J. & Nicholson J. Characterization and quantification of
metabolites of racemic ketoprofen excreted in urine following oral administration to man by 1H-NMR spectroscopy, directly coupled HPLC-MS and HPLCNMR, and circular dichroism. Xenobiotica (2004) 34: 1075-1089.
Swan G., Short C. & Tubbesing U. Nonsteroidal anti-inflammatory drugs in domestic
animals: II disposition and clinical indications. Journal of the South African
Veterinary Association (1995) 66: 35-41.
Takimoto T., Sato K., Akiba Y. & Takahashi K. Role of chicken TL1A on inflammatory responses and partial characterization of its receptor. The Journal of Immunolgy (2008) 180: 8327-8332.
Tegeder I., Pheilschifter J. & Geisslinger G. Cyclooxygenase-independent actions of
cyclooxygenase inhibitors. The FASEB Journal (2001) 15: 2057-2072.
Tsuboi I., Tanaka H., Nakao M., Shigeki S. & Itoh K. Nonsteroidal anti-inflammatory
drugs differentially regulate cytokine production in human lymphocytes: upregulation of TNF, IFN-γ and IL-2, in contrast to downregulation of IL-6 production. Cytokine (1995) 4: 372-379.
Van Snick J., Cayphas S., Vink A., Uyttenhove C., Coulie P.G., Rubira M.R. & Simpson R.J. Purification and NH2-terminal amino acid sequence of a T-cellderived lymphokine with growth factor activity for B-cell hybridomas. Proceedings of the National Academy of Science of the United States of America
(1986) 83: 9679.
Waldman S.A., Vitow C., Osborne B., Gillen L., Argentieri D.C., Wong F.A., Smith
I.L., Chow A.T., Misiti J. & Bjornsson T.D. Pharmacokinetics and pharmacodynamics of tepoxalin after single oral dose administration to healthy volunteers. Journal of Clinincal Pharmacology (1996) 36: 462-468.
Willburger R., Wittenberg R., Schmidt K., Kleemeyer K. & Peskar B. Antiinflammatory effect of tepoxalin: blood and synovial tissue studied in patients with knee
arthrosis. Acta Orthopedica Scandinavica (1998) 69: 295-300.
178
Yang K. & Lee M. Effects of endotoxin derived from Escherichia coli lipopolysaccharide on the pharmacokinetics of drugs. Archives of Pharmacal Research (2008)
9: 1073-1086.
Yin M., Yamamoto Y. & Gaynor R. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature (1998) 396: 77-80.
Yoon J., Kim S., Hwang S., Chang S., Kang S. & Chun J. Nonsteroidal anti-inflammatory
drugs inhibit nitric oxide-induced apoptosis and dedifferentiation of articular
chondrocytes independent of cyclooxygenase activity. The Journal of Biological
Chemistry (2003) 278: 15319-15325.
Zhou L., Ritchie D., Wang E., Barbone A., Argentieri D. & Lau C. Tepoxalin, a novel
immunosuppressive agent with a different mechanism of action from cyclosporin
A. The Journal of Immunology (1994) 153: 5026-5037.
179
General discussion
To date no nonsteroidal anti-inflammatory drugs (NSAIDs) are registered for poultry
in Belgium, although in practice, some NSAIDs are used for various indications in
avian species. However, the benefit of these treatments is difficult to evaluate due to
the lack of pharmacological studies.
In support of an application to register a NSAID, clinical trials need to be performed
to demonstrate the efficacy of the drug. An example of what may be considered as an
appropriate parameter when attempting to evaluate the efficacy of a NSAID, is rectal
temperature in an E. coli endotoxin-induced fever model for the assessment of the
anti-pyretic effect (Anonymous, 2001).
Lipopolysaccharide or endotoxin, is a component of the Gram-negative bacterial cell
wall and is commonly used to induce an inflammatory response in humans and various animal species (Skarnes et al., 1981; Morimoto et al., 1987; Klosterhalfen et al.,
1992; Erroi et al., 1993; Semrad, 1993; Franco et al., 2000; Maxwell et al., 2002;
Haudek et al., 2002). The response to LPS can differ between animal species, chickens are far less susceptible to the deleterious effects of LPS in comparison to other
animals (Berczi et al., 1966). It can also be influenced by differences in ambient temperature, dosage, prior sensitization, age, route of administration and genetic line
(Jones et al., 1983; Cheng et al., 2004).
LPS induces a plethora of events including the production of cytokines, prostanoids,
and acute phase proteins. As clinical signs, the non-specific symptoms of infection
like fever, weakness, malaise, listlessness, somnolence, hyperalgesia, inability to concentrate, lethargy and reduced feed and water intake, are remarked after LPS adminis181
tration (Lenczowski et al., 1997; Sell et al., 2001; Dantzer, 2006). NSAIDs are defined as that group of acidic anti-inflammatory agents which block the conversion of
arachidonic acid into prostaglandins and thromboxane (Anonymous, 2001). Tepoxalin, Na-salicylate and ketoprofen were chosen to be tested in the developed inflammation model upon the following considerations:
Tepoxalin,
[5(4-chlorophenyl)-N-hydroxy-(4-methoxyphenyl)-N-methyl-1H-
pyrazole-3-propanamide], is an orally active dual cyclooxygenase/lipoxygenase inhibitor (Wallace et al., 1991; 1993; Argentieri et al., 1994; Knight et al., 1996;
Kirchner et al., 1997). Tepoxalin is indicated for the control of pain and inflammation
associated with osteoarthritis in dogs. Besides its anti-inflammatory and analgesic
properties, tepoxalin has been reported to inhibit T cell proliferation and to have cytokine modifying activity (Rainsford et al., 1993; Zhou et al., 1994; Kazmi et al., 1995;
Ritchie et al., 1995; Willburger et al., 1998; Fiebich et al., 1999).
Ketoprofen, a chiral compound existing as a racemic mixture of R (-) and S (+) isomers, indicated in the treatment of inflammatory and painful conditions of the bones
and joints and muscular-skeletal systems in cattle, horses, dogs and cats, is known to
inhibit COX, but is also reported to modulate cytokine production (Ghezzi et al.,
1998). It has been marketed for use in humans and is extensively used in animals. Water soluble formulations of ketoprofen are marketed which could be interesting to use
in chickens.
Salicylates are probably the oldest and still most widely used anti-inflammatory drugs.
Since salicylates lack the acetyl group of acetyl salicylic acid, they are believed to be
ineffective as a direct COX inhibitor, but they are nevertheless able to reduce inflammation through inhibition of Nuclear Factor – κB (NF- κB) (Tegeder et al., 2001;
D‟Acquisto et al., 2002). This is in contradiction with the findings of Giuliano et al.
(2001) that salicylate is capable of inhibiting COX-2 activity in vivo without affecting
COX-2 expression.
Off-label use of salicylates in chickens has been reported for indications as heat stress
and preservation of feed intake (personal communication).
Salicylate and ketoprofen were already used as anti-pyretic agents in a LPS inflammation model in rabbits, salicylate also in chickens, but for tepoxalin no data were found
in literature (Hać, 1982; Baert et al., 2005; Davidson et al., 2001).
182
When developing a model to test the efficacy of NSAIDs, one should consider that
standardization of the model and the choice of relevant parameters are very important
issues to be addressed and are discussed below.
A reproducible and standardized inflammation model should be developed to study
the pharmacodynamic properties of NSAIDs
Considering the various factors able to influence the outcome of a LPS inflammation
reaction, standardization of the model is absolutely necessary. However, for a model
te be relevant compromises need to be made between laboratory conditions and farming conditions, concerning e.g. hygienic measures, housing of the animals.
In a first experiment, the impact of age and repeated LPS contact on the body temperature and cytokine expression and the correlation with the presence of IgM antibodies
against LPS, was investigated.
Three and five week old animals were repeatedly injected intravenously with LPS.
Animals of 3 weeks responded to LPS administration with a higher maximum body
temperature and area under the body temperature versus time curve than 5 week old
chickens after the first dose. The course of the body temperature, however, was the
same between the two age groups. For further experiments, the choice was made to
use 5 week old animals because of the advantage of a heavier body weight enabling us
to collect larger volumes of plasma in order to quantify inflammation parameters. A
common rule of thumb is to limit the blood collection to no more than 10% of the
bird‟s blood volume, that averages 7% of the body weight. A convenient calculation is
to draw 1% of the body weight. Birds are more tolerant to blood loss than mammals
because rapid volume replacement occurs by resorption of tissue fluids (Sturkie,
1986). According to Diehl et al. (2001) a blood volume of 2% of the body weight can
be withdrawn without harming the animal.
The second injection with LPS reduced the duration of the fever phase, both in 3 and
5 week old animals. Repeated administration of LPS also decreased the peak of interleukin-6 in plasma significantly. This is in accordance with the findings in LPStolerant mice and guinea-pigs (Erroi et al., 1993; Roth et al., 1994).
Significant higher levels of antibodies against LPS could be detected 7 days after LPS
administration and in the 5 week old birds. However, there seems to be no correlation
183
between the reduced response to LPS and the presence of antibodies since the 5 week
old animals with higher antibody levels, responded to LPS in the same way as the 3
week old animals.
From the fact that animals show a reduced response after repeated LPS contact can be
concluded that contact with LPS from the environment needs to be avoided as much
as possible.
In the conducted studies, ambient temperature was adjusted according to animal behaviour and ethical guidelines. The influence of ambient temperature on the febrile
response to endotoxin could be confirmed after administration of LPS to 3 week old
chickens housed in temperatures below their thermoneutral zone. In contrast to animals housed in thermoneutral temperatures, these animals did not develop fever (unpublished data). Preferably, these experiments need to be conducted in temperature
controlled stables.
Depending on the batch, the endotoxin concentration can differ significantly. LPS
concentration from E. coli O127:B8 (Sigma-Aldrich) can vary between 500.000 endotoxin units per mg and 2.250.000 endotoxin units per mg, whereas most authors
express the dose in mg/kg BW. Therefore, standardization of the amount of units injected/kg BW should be defined.
Relevant inflammation parameters should be measured, using reliable methods
To be able to evaluate the efficacy of a NSAID, the influence on relevant inflammatory parameters should be measured.
The anti-pyretic effect of a NSAID can be deducted from the measurement of the
body temperature in an inflammation model, since fever is a cardinal sign of inflammation.
The measurement of body temperature, however, is not always straightforward. Body
temperature is subject to circadian rithm and can be elevated after handling of the animals due to stress (Cabanac and Aizawa, 2000; Dawson and Whittow, 2000).
Exposure of leukocytes and other cell types to a pathogen and/or endotoxin is followed by the appearance of pyrogenic cytokines or endogenous pyrogens in the circulation among which tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and IL-6
are considered the most important. These cytokines signal to the brain, where the level
184
of prostaglandin E2 is elevated, which is recognized as key mediator to induce fever
(Coceani and Akarsu, 1998; Netea et al., 2000). In chickens, TNF-α has not been
identified but TNF-like ligand 1A (TL1A) produces effects similar to TNF-α such as
production of IL-1β and IL-6. TL1A also promotes inflammation by raising α1 acid
glycoprotein, ceruloplasmin and nitric oxide (NO) (Takimoto et al., 2008). An important issue in the determination and quantification of these cytokines in chickens is the
fact that commercial species-specific antibodies, ELISA‟s, primers, ….
directed
against avian cytokines are not commonly available. Since the interest of scientists in
avian bird flue because of its risk for human health, this situation is slightly ameliorated, however determining inflammation parameters in avian species still remains a
challenge.
Ideally, cytokine determination is done on 3 different levels, i.e. mRNA level, intracellular protein and secreted protein.
First a real-time RT-PCR method was developed for the measurement of mRNA levels of IL-1β, IL-6 and TL1A in avian leukocytes. To be able to interpret the results of
such a method, reliable and stable reference or housekeeping genes need to be identified for the normalization of real-time RT-PCR results. In the developed inflammation
model, UB and G6PDH were identified as appropriate housekeeping genes. mRNA
levels of TL1A, IL-1β and IL-6, certainly in mammals the most important proinflammatory cytokines, were slightly elevated 1 h after LPS administration in avian
leukocytes.
Secondly, intracellular IL-1β and IL-6 levels were also determined in avian leukocytes
and thrombocytes, using a flow cytometric method. Several hampering factors needed
to be overcome in the development of the method. A major difficulty we encountered
in using this method was the presence of nucleated red blood cells in avian species.
The nuclei of these cells remain in the sample after lysis of red blood cells, making it
difficult to identify lymphocytes and thrombocytes. This problem was solved using a
PE-labeled antibody directed against a common leukocyte antigen CD45, which is a
haemopoietic cell-specific surface glycoprotein (Tchilian and Beverly, 2006). Another
difficulty was the presence of nucleated thrombocytes, the avian counterpart of the
mammalian platelets, which have a similar size as lymphocytes but slightly higher
185
side scatter properties. Nucleated red blood cells and the presence of nucleated thrombocytes, are unique features in avian haematology compared to mammals.
The different cell types were then identified on their CD45-positivity and their typical
side scatter properties. In the in vivo experiments, an increase in intracellular IL-1β
and IL-6 could be remarked about 3 h after LPS administration in the heterophils, the
avian counterpart of the neutrophil.
A third level on which cytokine expression can be measured is secreted protein. Several cell types are able to produce IL-6, so the amount of secreted IL-6 is the sum of
that produced by the white blood cells, endothelial cells and others. In this experiment, secreted IL-6 was measured using a bio-assay working with the 7TD1 murine
cell line that grows IL-6 dependent. Like the intracullar expression of IL-6, the peak
concentration of IL-6 was measured 3 h after LPS administration. This is no coincidence since there is a good correlation between intracellular detection of cytokines
and the secreted amounts of cytokines (Schuerwegh et al., 2003). In the future, a more
accurate method will be used that is currently being developed in our laboratory, using
the BD™ CBA system. BD™ CBA is a flow cytometry application that allows users
to quantify multiple proteins simultaneously. This method significantly reduces sample requirements and time to results in comparison with traditional ELISA and Western blot techniques.
Besides cytokine expression, our developed LPS inflammation model is characterized
by severe hypotension, heterophil sequestration primarily in the lungs and apoptosis
of white blood cells which reduces the amount of circulating leukocytes.
Other relevant parameters that could be measured in future experiments are feed intake and feed conversion, since they are important economical issues in poultry industry, and NO. IL-1β, IL-6 and TNF-α act on adipocytes and induce secretion of leptin,
a protein whose activity has been neuroanatomically mapped to brain areas involved
in regulating feed intake and energy expenditure (Johnson, 1998). However, in contrast to these findings, Ogimoto et al. (2006) found that LPS reduces feed intake in
mice via a mechanism that is dissociated from its effect of peripheral cytokine production. These authors found that the absence of MyD88 signalling, which is a universal
adapter protein as it is used by all TLR‟s (except TLR3) to activate the transcription
186
factor NF-κB, protects against LPS-induced anorexia, even when known anorexiainducing cytokines are present.
Intravenous LPS administration triggers wide-spread iNOS expression, resulting in
copious NO production (Bowen et al., 2007; Saia et al., 2008). NO seems to be the
causative agent of both hypotension and hypothermia, because it may participate in
vasodilatation, increasing heat loss and intensifying the hypothermia magnitude
(Vayssettes-Courchay et al., 2003).
The pharmacokinetics of the NSAID in the healthy animal
Dosages cannot be simply extrapolated from those recommended for other animal
species. Therefore, the basic pharmacokinetics should be investigated in the target
species.
From in vitro experiments, Ritchie et al. (1995) determined an IC50 of 10-12 µM (or
3.858 µg/ml) for tepoxalin on IL-6 production in human peripheral blood mononuclear cells (PBMC). In vivo, tepoxalin undergoes both rapid and extensive conversion
to its carboxylic acid hydrolysis product in chickens like it does in dogs and mice.
Although tepoxalin was administered at a dose of 30 mg/kg, which is already 3 times
the dose used in dogs for reduction of inflammation and pain relief (Zubrin® package
insert), the concentration of the parent compound was below the limit of quantification (LOQ), in contrast to that of the active metabolite which was abundantly present.
This was due to the presence of a first-pass metabolism and this way, tepoxalin can be
seen as a prodrug. After intravenous tepoxalin administration in chickens, a mean
half-life of elimination of 0.52 hours was calculated. In dogs, tepoxalin was eliminated 5 times slower (Homer et al., 2005), this could be attributed to a quantitative
difference in biotransformation rate, but also differences in clearance or volume of
distribution of the drug. In dogs, the excretion route occurs almost exclusively via
faeces and only 1% via urine. In mice, on the contrary, about 30% of tepoxalin was
eliminated via urine (EMEA, 2003).
For ketoprofen an ID50 of 38 nM (or 9.66 ng/ml) for PGE2 was determined in human
PBMC. After the administration of 3 mg/kg ketoprofen to broilers, this concentration
was certainly reached in plasma (Neirinckx et al., submitted).
187
The plasma concentration of salicylic acid for which effective antipyretic, antiinflammatory and analgesic activity can be achieved, has been reported to be 50
µg/ml for several species (Lees and Higgins, 1985; Lees et al., 1991). After administration of salicylate at a dose of 50 mg/kg BW, plasma concentrations rise above this
concentration (Baert et al., 2003).
Pharmacokinetics of NSAIDs after LPS administration
All phases that together determine the pharmacokinetic profile of a drug, i.e. absorption, distribution, metabolism and excretion, can be affected during an acute phase
response (Monshouwer and Witkamp, 1999; Yang and Lee, 2008). In Part IV, chapter
2, the pharmacokinetics of tepoxalin, its active metabolite, ketoprofen and salicylate
were determined after LPS administration. For the parent compounds, no changes
were seen in the determined parameters, t½ and AUC0→6h,compared to the results in
healthy birds. For the active metabolite of tepoxalin, a difference in AUC0→6h was
obvious due to perfusion limited elimination. Since LPS elicits a severe hypothermia,
this will result in a reduction of the hepatic blood flow. Since this metabolite is
formed through first-pass metabolism mainly in the liver, the formation will be compromised, resulting in a larger AUC0→6h. These changes in drug kinetics in the presence of LPS could influence the outcome of treatment.
Considerations on the failure of demonstrating efficacy of the NSAIDs in broilers
Although some authors stated that the inflammatory response in birds is similar to that
in mammals (Fraifeld & Kaplanski, 1998; Mahmoud et al., 2007), our results gave an
indication of the opposite. In mammals, PGE2 is believed to be the key mediator in
fever (Coceani & Akarsu, 1998; Netea et al., 2000). All three drugs used in the experiment, i.e. tepoxalin, ketoprofen and Na-salicylate are listed as COX inhibitors. Nevertheless, none of the drugs were able to reduce the body temperature after LPS administration in chickens. Furthermore, these drugs are reported to be able to modulate
cytokine expression. However, no effect was seen on the IL-6 concentration in plasma.
These findings could suggest that in chickens additional parameters or other pathways
could play a role. Other explanations could be that the dose of the drug or the dose
188
regimen are not appropriate, although the plasma concentrations rose above the recommended in vitro concentrations for ketoprofen and salicylate. However, these concentrations could not be appropriate for avian species or for the developed model.
In future experiments, other drugs, having other pathways as a target, or other dose
regimens should be evaluated. As an example, drugs inhibiting NO production could
be tested in this model. Recently, various molecules are tested in vitro and in vivo, like
rapamycin, phenylisothiourea derivatives and N6-(1-Iminoethyl) – L-lysine dihydrochloride (Jin et al., 2009a, b; Nagareddy et al., 2009). Some antibiotics are also
reported to influence cytokine production such as the macrolide telithromycin, which
also influences NO formation, and the veterinary antibiotic florfenicol (Lotter et al.,
2006; Zhang et al., 2008).
Furthermore, recombinant proteins, e.g. PGE2 and IL-6 can be injected in chickens to
determine the importance of these molecules in the inflammatory process.
These findings will give more insight not only in pharmacodynamics but also in understanding the total inflammation process in poultry, since basic knowledge on inflammation mechanisms in birds seems to be lacking.
189
References
Anonymous (2001). Guideline for the conduct of efficacy studies for nonsteroidal
anti-inflammatory drugs. EMEA/CVMP/237/01-FINAL
Argentieri D., Ritchie D., Ferro M., Kirchner T., Wachter M., Anderson D., Rosenthale M. & Capetola R. Tepoxalin: a dual cyclooxygenase/5-lipoxygenase inhibitor of arachidonic acid metabolism with potent anti-inflammatory activity
and a favourable gastrointestinal profile. The Journal of Pharmacology and
Experimental Therapeutics (1994) 271: 1399-1408.
Baert K. Pharmacokinetics and pharmacodynamics of non-steriodal anti-inflammatory
drugs in birds. PhD thesis (2003)
Berczi I., Bertόk L. & Bereznai T. Comparative studies on the toxicity of Escherichia
coli lipopolysaccharide endotoxin in various animal species. Canadian Journal
of Microbiology (1966) 12: 1070-1071.
Bowen O., Erf G., Chapman M. & Wideman R. Plasma nitric oxide concentrations in
broilers after intravenous injections of lipopolysaccharide or microparticles.
Poultry Science (2007) 86: 2550-2554
Cabanac M. & Aizawa S. Fever and tachycardia in a bird (Gallus domesticus) after
simple handling. Physiology & Behaviour (2000) 69: 541-545.
Cheng H., Freire R. & Pajor E.A. Endotoxin stress responses in chickens from different genetic lines. 1. Sickness, behavioural, and physical responses. Poultry Science (2004) 83: 707-715.
Coceani F. & Akarsu E. Prostaglandin E2 in the pathogenesis of fever. An update.
Annals of the New York Academy of Science (1998) 856: 76-82.
Dantzer R. Cytokine-induced sickness behavior: mechanisms and implications. Neurologic Clinics (2006) 24: 222-234.
D‟Acquisto F., May M. & Ghosh S. Inhibition of Nuclear Factor Kappa B (NF-κB):
An emerging theme in anti-inflammatory therapies. Molecular Interventions
(2002) 2: 22-35.
Davidson J., Abul H., Milton A. & Rotondo D. Cytokines and cytokine inducers
stimulate prostaglandin E2 entry into the brain. Plugers Archive (2001) 442:
526-533.
190
Dawson W. & Whittow G. Regulation of body temperature. In Sturkie’s Avian physiology fifth edition, Academic Press, London (2000) p.343-390
Diehl K., Hull R., Morton D., Pfister R., Rabemampianina Y., Smith D., Vidal J., van
de Vorstenbosch C. Good Practice Guide to the Administration of
Substances and Removal of Blood, Including Routes and Volumes. Journal of
Applied Toxicology (2001) 21: 15-23.
EMEA (2005) Volume VIII, Notice to applicants, Veterinary medicinal products: Establishment of maximum residue limits (MRLs) for residues of veterinary
products in foodstuffs of animal origin: Development and validation of a proposed regulatory method, EMEA/CVMP/573/00.
Erroi A., Fantuzzi G., Mengozzi M., Sironi M., Orencole S., Clark B., Dinarello C.,
Isetta A., Gnocchi P., Giovarelli M. & Ghezzi P. Differential regulation of cytokine production in lipopolysaccharide tolerance in mice. Infection and Immunity (1993) 61: 4356-4359.
Franco R., de Jonge E., Dekkers P., Timmerman J., Spek C., van Deventer S., van
Deursen P., van Kerkhoff L., van Gemen B., ten Cate H., van der Poll T. &
Reitsma P.H. The in vivo kinetics of tissue factor messenger RNA expression
during human endotoxemia: relationship with activation of coagulation. Blood
(2000) 96: 554-559.
Freifeld J. & Kaplanski V. Brain eicosanoids and LPS fever: species and age differences. Progress in brain research (1998) 115: 141-147.
Ghezzi P., Melillo G., Meazza C., Sacco S., Pellegrini L., Asti C., Porzio S., Marullo
A., Sabbatini V., Caselli G. & Bertini R. Differential contribution of R and S
isomers in ketoprofen anti-inflammatory activity: role of cytokine modulation.
The Journal of Pharmacology and Experimental Therapeutics (1998) 287:
969-974.
Giulliano F., Mitchell J. & Warner T. Sodium salicylate inhibits prostaglandin formation without affecting the induction of cyclooxygenase-2 by bacterial lipopolysaccharide in vivo. The Journal of Pharmacology and Experimental Therapeutics (2001) 299: 894-900.
Hác E. The plasma cation pattern in fever and sodium salicylate antipyresis. Polish
Journal of Pharmacology and Pharmacy (1982) 34: 169-175.
191
Haudek S., Natmessing B., Fürst W., Bahrami S., Schlag G. & Redl H. Lipopolysaccharide dose response in baboons. Shock (2003) 20: 431-436.
Homer L., Clarke C. & Weingarten A. Effect of dietary fat on oral bioavailability of
tepoxalin in dogs. Journal of Veterinary Pharmacology and Therapeutics
(2005) 28: 287-291.
Jin G., Ahn S., Yoon J., Park J., Lee E., Yoo J., Lee J., Choi W. & Han J. Rapamycin
down-regulates inducible nitric oxide synthase by inducing proteasomal degradation. Biological & Pharmaceutical Bulletin (2009) 32: 988-992.
Jin G., Lee da Y., Cheon Y., Gim H., Kim do H., Ryu J. & Jeon R. Synthesis of phenylisothiourea derivatives as inhibitors of NO production in LPS activated macrophages. Bioorganic & Medicinal Chemistry Letters (2009b) 19: 3088-3092.
Jonhnson R. Immune and endocrine regulation of feed intake in sick animals. Domestic Animal Endocrinology (1998) 15: 309-319.
Jones C., Edens F. & Denbow D.M. Influence of age on the temperature response of
chickens to Escherichia coli and Salmonella typhimurium endotoxins. Poultry
Science (1983) 62: 1553-1558.
Kazmi S., Plante R., Visconti V., Taylor G., Zhou L. & Lau C. Suppression of NF
kappa B activation and NF kappa B-dependent gene expression by tepoxalin, a
dual inhibitor of cyclooxygenase and 5-lipoxygenase. Journal of Cellular Biochemistry (1995) 57: 299-310.
Klosterhalfen B., Hörstmann-Jungemann K., Vogel P., Flohé S., Offner F., Kirkpatrick C. & Heinrich P. Time course of various inflammatory mediators during
recurrent endotoxemia. Biochemical Pharmacology (1992) 43: 2103-2109.
Kirchner T., Aparicio B., Argentieri D., Lau C. & Ritchie D. Effects of tepoxalin, a
dual inhibitor of cyclooxygenase/5-lipoxygenase, on events associated with
NSAID-induced gastrointestinal inflammation. Prostaglandins, Leukotrienes
and essential fatty acids (1997) 56: 417-423.
Knight E., Kimball J., Keenan C., Smith I., Wong F., Barrett D., Dempster A.,
Lieuallen W., Panigrahi W. & Szot R. Preclinical toxicity evaluation of tepoxalin, a dual inhibitor of cyclooxygenase and 5-lipoxygenase, in Sprague-Dawley
rats and beagle dogs. Fundamental and Applied Toxicology (1996) 33: 38-48.
192
Lenczowski M., Van Dam A., Poole S., Larrick J. & Tilders F. Role of circulating
endotoxin and interleukin-6 in the ACTH and corticosterone response to intraperitoneal LPS. American Journal of Physiology (2007) 273: 1870-1877.
Lotter K., Höcher K., Bucher M. & Kees F. In vivo efficacy of telithromycin on cytokine and nitric oxide formation in lipopolysaccharide-induced acute systemic
inflammation in mice. Journal of Antimicrobial Chemotherapy (2006) 58: 651621.
Mahmoud M., Shimizu Y., Shiina T., Nikami H., Dosoky R., Ahmed M. & Takewaki
T. Involvement of a capsaicin-sensitive TRPV1-independent mechanism in
lipopolysaccharide-induced fever in chickens. Comparative Biochemistry and
Physiology, Part A (2007) 148: 578-583.
Maxwell J., Ruby C., Kerkvliet N. & Vella A.T. Contrasting the role of costimulation
and the natural adjuvant lipopolysaccharide during the induction of T cell immunity. Journal of Immunology (2002) 168: 4372-4381.
Monshouwer M. & Witkamp R. Cytochromes and cytokines: changes in drug disposition in animals during an acute phase response: a mini-review. The Veterinary
Quarterly (1999) 22: 17-20.
Morimoto A., Murakami N., Nakamori T. & Watanabe T. Evidence for separate
mechanisms of induction of biphasic fever inside and outside the blood-brain
barrier in rabbits. Journal of Physiology (1987) 383: 629-637.
Nagareddy P., McNeill J. & MacLeod K. Chronic inhibition of inducible nitric oxide
synthase ameliorates cardiovascular abnormalities in streptozotocin diabetic
rats. European Journal of Pharmacology (2009) 611: 53-59.
Netea M., Kullberg B. & Van der Meer J. Circulating cytokines as mediators of fever.
Clinical Infectious Diseases (2000) 31: S178-184.
Ogimoto K, Harris M. & Wisse B. MyD88 is a key mediator in anorexia, but not
weight loss, induced by lipopolysaccharide and interleukin-1β. Endocrinology
(2006) 147: 4445-4453.
Rainsford K., Ying C. & Smith F. Selective effects of some 5-lipoxygenase inhibitors
on synovial interleukin-1 (IL-1) production compared with IL-1 synthesis inhibitors. Agents and Actions (1993) 39: C186-188.
193
Ritchie D., Argentieri D., Aparicio B., Plante R., Lau C. & Barbone A. Cytokinemodulating activity of tepoxalin, a new potential antirheumatic. International
Journal of Immunopharmacology (1995) 17: 805-812.
Roth J., McClellan J., Kluger M. & Zeisberger E. Attenuation of fever and release of
cytokines after repeated injections of lipopolysaccharide in guinea-pigs. Journal of Physiology (1994) 477: 177-185.
Saia R., Anselmo-Franci J. & Carnio E. Hypothermia during endotoxemic shock in
female mice lacking nitric oxide synthase. Shock (2008) 29: 119-126.
Schuerwegh A., De Clerck L., Bridts C. & Stevens W. Comparison of intracellular
cytokine production with extracellular cytokine levels using two flow cytometric techniques. Cytometry Part B (2003) 55B: 52-58.
Sell K., Crowe S. & Kent S. Lipopolysaccharide induces memory-processing deficits
in day-old chicks. Pharmacology, Biochemistry and Behaviour (2001) 68: 497502.
Semrad S. Comparative efficacy of flunixin, ketoprofen, and ketorolac for treating
endotoxemic neonatal calves. American Journal of Veterinary Research (1993)
54: 1511-1516.
Skarnes R., Brown S., Hull S. & McCracken, J. Role of prostaglandin E in the biphasic fever response to endotoxin. The Journal of Experimental Medecine
(1981) 154: 1212-1224.
Sturkie P. Weis H. & Ringer R. Effects of age on blood pressure in the chicken. American Journal of Physiology (1983) 174: 405-407.
Takimoto T., Sato K., Akiba Y. & Takahashi K. Role of chicken TL1A on inflammatory responses and partial characterization of its receptor. The Journal of Immunolgy (2008) 180: 8327-8332.
Tchilian E. & Beverly P. Altered CD45 expression and disease. Trends in Immunology (2006) 27: 146-153.
Tegeder I., Pheilschifter J. & Geisslinger G. Cyclooxygenase-independent actions of
cyclooxygenase inhibitors. The FASEB Journal (2001) 15: 2057-2072.
194
Vayssettes-Couchay C., Chataigneau M., Protin C., Ragonnet C. & Verbeuren T. Cutaneous venous dysfunction studied in vivo in the LPS-treated rabbit: implication of NO in saphenous vein hyporeactivity. Naunyn-Schniedebergs’ Archives
of Pharmacology (2003) 367: 516-523.
Wallace J., Cirino G., Cicala C., Anderson D., Argentieri D. & Capetola, R.J. Comparison of the ulcerogenic properties of tepoxalin with those of nonsteroidal
anti-inflammatory drugs (NSAIDs). Agents and actions (1991) 34: 247-250.
Wallace J., McCafferty D., Carter L. & McKnight W. Tissue-selective inhibition of
prostaglandin synthesis in rat by tepoxalin: anti-inflammatory without gastropathy? Gastroenterology (1993) 105: 1630-1636.
Willburger R., Wittenberg R., Schmidt K., Kleemeyer K. & Peskar B. Antiinflammatory effect of tepoxalin: blood and synovial tissue studied in patients with knee
arthrosis. Acta Orthopedica Scandinavica (1998) 69: 295-300.
Yang K. & Lee M. Effects of endotoxin derived from Escherichia coli lipopolysaccharide on the pharmacokinetics of drugs. Archives of Pharmacal Research (2008)
9: 1073-1086.
Zhang X., Song Y., Ci X., An N., Fan J., Cui J. & Deng X. Effects of florfenicol on
early cytokine response and survival in murine endotoxemia. Interational Immunopharmacology (2008) 8: 982-988.
Zhou L., Ritchie D., Wang E., Barbone A., Argentieri D. & Lau C. Tepoxalin, a novel
immunosuppressive agent with a different mechanism of action from cyclosporin A. The Journal of Immunology (1994) 153: 5026-5037.
195
Summary
To date, no NSAIDs are registered in Belgium for use in poultry. Registration of a
drug requires the control of a drug‟s quality, safety and efficacy and information on
pharmacokinetics and pharmacodynamics of the drug. The evaluation of a drug‟s efficacy needs to be done by monitoring appropriate parameters, e.g. the efficacy of an
antipyretic drug can be evaluated by measurement of the body temperature in an E.
coli endotoxin-induced fever model.
In Part I, the current situation on the use of NSAIDs in Europe and Belgium is
reviewed. Furthermore, the general aspects of inflammation and in vivo inflammation
models are described. An overview on the structure of LPS, its interaction with the
cells and the connection between cytokines and fever is given. The general aspects of
pharmacokinetics and pharmacodynamics of NSAIDs are listed.
In Part II, the aims of the thesis are described.
The first aim was addressed in Part III, chapter 1:
In chapter 1, the influence of age and repeated contact with LPS on body temperature and IL-6 concentration in plasma and the relationship with the presence of
IgM antibodies against LPS is described. In the developed model, a reproducible
course of body temperature could be established after a single intravenous LPS administration at a dose of 1500000 units/kg BW. Three week old animals responded to
LPS with a higher body temperature than 5 week old animals. Repeated LPS administration decreased the rise in body temperature and the concentration of IL-6 in plasma.
Antibodies directed against LPS did not seem to be responsible for the reduced response to LPS.
197
The second aim was addressed in Part III, chapter 2 and 3:
In chapter 2, the development of a real-time RT-PCR method to quantify cytokines in avian leukocytes is described. Appropriate housekeeping genes were identified to obtain reliable real-time RT-PCR results on the mRNA expression of IL-1β,
IL-6 and TL1A. UB and G6PDH proved to be the most stable combination.
In chapter 3, a flow cytometric method was developed for the determination of
intracellular IL-1β and IL-6 in the different leukocyte subpopulations and the thrombocytes. Identification of the cell types was performed on their CD45 positivity and
their side scatter properties.
The third aim described in the thesis was addressed in Part III, chapter 4:
In chapter 4, the developed methods were applicated to further characterize the
LPS inflammation in chickens. A profound hypotension accompanied the hypothermic phase of the body temperature curve, mRNA levels of TL1A, IL-1β and IL-6
were slightly elevated 1 h after LPS administration. About 3 h after LPS administration intracellular IL-1β and IL-6 expression peaked in the heterophils and also secreted IL-6 reached a maximum concentration. Furthermore, LPS induced a decrease
in circulating CD45 positive cells, partly caused by sequestration of the heterophils in
the lungs and, apoptosis of the circulating leukocytes.
The fourth aim was addressed in Part IV, chapter 1:
In chapter 1, the pharmacokinetics of tepoxalin, a combined COX and LOX inhibitor in healthy broiler chickens was evaluated after oral and intravenous administration of the drug. Chickens eliminated tepoxalin 5 times faster than dogs. After oral
administration of the drug, the concentration of the parent compound was below the
LOQ, although the active metabolite RWJ-20142 was abundantly present in plasma.
This indicates the existence of a substantial first-pass metabolism. This way, tepoxalin
can be considered as a prodrug.
198
The last aim was addressed in Part IV, chapter 2:
In chapter 2, the pharmacodynamic properties of tepoxalin, ketoprofen and Nasalicylare were evaluated in the inflammation model. Furthermore, the influence of
LPS administration on the pharmacokinetic properties of the drugs was determined.
The administration of Na-salicylate, tepoxalin and ketoprofen did not affect the course
of the body temperature after LPS administration nor the IL-6 concentration in
plasma, which were chosen as relevant parameters. The pharmacokinetic properties of
the parent compounds were not altered by LPS administration, but the formation of
the active metabolite of tepoxalin was affected by LPS administration resulting in a
lower AUC0→6 h.
Following general conclusions can be drawn from the performed experiments in this
thesis:
1. A reproducible body temperature vs. time course could be established after a
single intravenous injection of LPS at a dose of 1500000 units/kg BW in
broiler chickens. Three week old animals respond to LPS with a higher body
temperature compared to 5 week old animals. Repeated LPS administration reduces the fever phase and the IL-6 concentration in plasma. Antibodies directed against LPS do not seem to be responsible for this reduced response.
2. UB and G6PDH proved to be a stable combination of housekeeping genes for
the correction of the real-time RT-PCR results of IL-1β, IL-6 and TL1A in the
developed LPS inflammation model.
3. Identification of avian leukocyte populations and thrombocytes can be done
based on their CD45 positivity and their side scatter properties through flow
cytometry. In these cell types intracellular IL-1β and IL-6 can be determined.
4. LPS inflammation in chickens is characterized by, hypotension, elevated mRNA
levels of TL1A, IL-1β and IL-6 1 h after LPS administration, peak expression
of intracellular IL-1β and IL-6 in the heterophils 3 h after LPS administration,
together with peak concentration of secreted IL-6. Furthermore, LPS induced
a decrease in circulating CD45 positive cells, partly caused by sequestration
and partly by apoptosis.
199
5. Tepoxalin can also be considered as a prodrug in chicken, since concentrations
of the parent compound do not rise above the limit of quantification after oral
administration, while the active metabolite is abundantly present.
6. The administration of Na-salicylate, tepoxalin and ketoprofen did not affect the
course of the body temperature after LPS administration nor the IL-6 concentration in plasma. The formation of the active metabolite of tepoxalin was affected by LPS administration resulting in a lower AUC0→6 h, probably due to
perfusion limited elimination.
200
Samenvatting
Tot op vandaag zijn er in België geen NSAIDs geregistreerd om te gebruiken bij
pluimvee. De registratie van een geneesmiddel vereist de controle van de kwaliteit,
veiligheid en doeltreffendheid van een geneesmiddel en informatie omtrent de farmacokinetiek en dynamiek. De evaluatie van de doeltreffendheid van een geneesmiddel
moet gedaan worden aan de hand van het monitoren van relevante parameters, zo kan
bijvoorbeeld de doeltreffendheid van een antipyretisch geneesmiddel beoordeeld worden door het meten van de lichaamstemperatuur in een E. coli endotoxine-geïnduceerd
koorts model.
In deel I is een overzicht gegeven van de huidige situatie van het gebruik van
NSAIDs in Europa en België. Verder worden de algemene aspecten van ontsteking en
in vivo ontstekingsmodellen beschreven. Een overzicht van de structuur van LPS, de
interactie van LPS met de cellen en het verband tussen cytokines en koorts is gegeven.
De algemene aspecten van farmacokinetiek en farmacodynamiek van NSAIDs werden
beschreven.
In deel II zijn de doelstellingen van de thesis beschreven.
De eerste doelstelling kwam aan bod in deel III, hoofdstuk 1:
In hoofdstuk 1 wordt de invloed van leeftijd en herhaald contact met LPS beschreven op de lichaamstemperatuur en de IL-6 concentratie in het plasma en de relatie met de aanwezigheid van IgM antilichamen tegen LPS. In het ontwikkelde model
kon het verloop van de lichaamstemperatuur na een enkele intraveneuze toediening
van LPS aan een dosis van 1500000 units/kg lichaamsgewicht herhaald worden. Drie
weken oude dieren reageerden op LPS met een hogere lichaamstemperatuur dan 5
weken oude dieren. Herhaalde toediening van LPS verminderde de stijging in li201
chaamstemperatuur en de concentratie van IL-6 in het plasma. De antilichamen gericht tegen LPS leken niet verantwoordelijk te zijn voor de verminderde reaktie tegen
LPS.
De tweede doelstelling kwam aan bod in deel III, hoofdstuk 2 en 3:
In hoofdstuk 2 is de ontwikkeling van een real-time RT-PCR methode beschreven voor de kwantificatie van cytokines in aviaire leukocyten. Geschikte huishoudgenen werden geïdentificeerd om betrouwbare real-time RT-PCR resultaten te bekomen
voor de expressie van IL-1β, IL-6 en TL1A mRNA. UB en G6PDH bewezen de meest
stabiele combinatie te zijn.
In hoofdstuk 3 werd een flow cytometrische methode ontwikkeld voor de intracellulaire bepaling van IL-1 β en IL-6 in de verschillende subpopulaties van leukocytes en thrombocyten. De identificatie van de verschillende celtypes werd gedaan op
basis van het feit dat ze positief waren voor CD45 en hun „side scatter‟ eigenschappen.
In hoofdstuk 4 werden de ontwikkelde methodes gebruikt om LPS geïnduceerde
ontsteking bij kippen verder te karakteriseren. De fase van hypothermie van de lichaamstemperatuur werd vergezeld van een hevige bloeddrukdaling, de mRNA levels
van TL1A, IL-1β en IL-6 waren licht gestegen 1 u na LPS toediening. Ongeveer 3 u
na LPS toediening piekte de intracellulaire expressie van IL-1β en IL-6 in de heterofielen en ook het gesecreteerde IL-6 bereikte zijn maximum concentratie. Verder induceerde LPS een vermindering in circulerende CD45 positieve cellen, deels door
sequestratie van de heterofielen in de long, deels door apoptose van de circulerende
leukocyten.
De vierde doelstelling kwam aan bod in deel IV, hoofdstuk 1:
In hoofdstuk 1 werd de farmacokinetiek van tepoxaline, een gecombineerde
COX en LOX inhibitor, beoordeeld in gezonde kippen, na orale en intraveneuze toediening van het geneesmiddel. De kip elimineert tepoxalin 5 keer sneller dan de hond.
Na oral toediening van het geneesmiddel was de concentratie van de moedermolecule
lager dan het quantificatielimiet, ondanks dat de actieve metaboliet, RW20142, overvloedig aanwezig was in het plasma. Dit wijst op de aanwezigheid van een belangrijke
„first-pass‟ metabolisatie. Op deze manier kan tepoxalin gezien worden als een produg.
202
De laatste doelstelling kwam aan bod in deel IV, hoofdstuk 2:
In hoofdstuk 2 werden de farmacodynamische eigenschappen van tepoxaline,
ketoprofen en Na-salicylaat nagegaan in het ontstekingsmodel. Verder werd de invloed van LPS op de farmacokinetische eigenschappen van de geneesmiddelen bepaald. De toediening van Na-salicylaat, tepoxaline en ketoprofen veranderde het verloop van de lichaamstemperatuur na LPS toediening niet, noch de IL-6 concentratie in
het plasma, welke gekozen werden als relevante parameters. De farmacokinetische
eigenschappen van de moedermolecules werden niet veranderd door LPS toediening,
maar de vorming van de actieve metaboliet van tepoxaline werd wel beïnvloed door
LPS toediening, wat resulteerde in een lagere AUC0→6u.
Volgende algemene besluiten kunnen getrokken worden uit de experimenten van deze
thesis:
1. Een herhaalbare lichaamstemperatuur versus tijd curve werd opgetekend na
een enkele intraveneuze toediening van LPS aan een dosis van 1500000
units/kg. Drie weken oude dieren reageren op LPS met een hogere lichaamstemperatuur in vergelijking met 5 weken oude dieren. Herhaalde
LPS toediening vermindert de koortsfase en de IL-6 concentratie in het
plasma. antilichamen gericht tegen LPS lijken niet verantwoordelijk te zijn
voor de verminderde respons.
2. UB en G6PDH bewezen een stabiele combinatie van huishoudgenen te zijn
in het ontwikkelde LPS ontstekingsmodel om de real-time RT-PCR resultaten van IL-1β, IL-6 en TL1A te corrigeren.
3. De identificatie van aviaire leukocyten en thrombocyten kan flow cytometrisch gebeuren op basis van het feit dat ze positief zijn voor CD45 en hun
„side scatter‟ eigenschappen. In deze celtypes kan intracellulair IL-1β en
IL-6 gemeten worden.
4. LPS geïnduceerde ontsteking bij kippen is gekarakteriseerd door bloeddrukdaling, verhoogde mRNA expressie van TL1A, IL-1β en IL-6, 1 u na
LPS toediening, piek expressie van IL-1β en IL-6 in de heterofielen, 3 u na
LPS toediening en dit samen met de piek concentratie aan gesecreteerd IL-
203
6. Verder induceerde LPS een vermindering in circulerende CD45 positieve cellen, deels veroorzaakt door sequestratie en deels door apoptose.
5. Tepoxaline kan ook beschouwd worden als een prodrug bij kippen omdat
de concentratie van de moedermolecule niet boven het quantificatielimiet
komt na oral toediening van het geneesmiddel, terwijl de actieve metaboliet
overvloedig aanwezig is.
6. De toediening van Na-salicylaat, tepoxaline en ketoprofen beïnvloedde het
verloop van de lichaamstemperatuur na LPS toediening niet, noch de concentratie aan IL-6 in het plasma. De vorming van de actieve metaboliet van
tepoxaline werd beïnvloed door LPS toediening wat resulteerde in een lagere AUC0→6u, waarschijnlijk door perfusiegelimiteerde eliminatie.
204
Curriculum Vitae
Sandra De Boever werd op 10 maart 1979 geboren te Gent. Na het behalen van haar diploma hoger secundair onderwijs aan het Sint-Paulusinstituut te Herzele (WetenschappenWiskunde), begon zij in 1997 met de studie Diergeneeskunde aan de Universiteit Gent en
behaalde het diploma van dierenarts in 2003.
In oktober 2003 trad zij in dienst als assistente bij de vakgroep Farmacologie, Toxicologie
en Biochemie van de faculteit Diergeneeskunde. Zij verrichtte er haar onderzoek onder
begeleiding van Prof. dr. Siska Croubels en Prof. dr. Patrick De Backer naar een intraveneus LPS inflammatie model bij mestkippen. Tevens behaalde zij in 2006 het diploma van
de Doctoraatsopleiding in de Diergeneeskundige Wetenschappen en het diploma van Geaggregeerde voor het secundair onderwijs groep 2. In 2008 behaalde zij het diploma van
Master of Laboratory Animal Science (FELASA categorie D).
Sandra De Boever is auteur en mede-auteur van verschillende wetenschappelijke publicaties in internationale tijdschriften. Zij nam eveneens actief deel aan meerdere nationale en
internationale congressen.
205
Bibliography
Scientific papers
Antipyretic effect of oral sodium salicylate after an intravenous E. Coli LPS injection in broiler chickens
Baert K., Duchateau L., De Boever S., Cherlet M. & De Backer P.
British Poultry Science (2004) 2: 137-143.
Sodium salicylate attenuates LPS-induced adipsia, but not hypophagia, in broiler
chickens
Baert K., De Boever S., Duchateau L. & De Backer P.
British Poultry Science (2004) 2: 144-148.
Quantitative liquid chromatographic-mass spectrometric analysis of amoxicillin in broiler edible tissues
De Baere S., Wassink P., Croubels S., De Boever S., Baert K. & De Backer P.
Analytica Chimica Acta (2005) 529: 221-227.
Two inusual cases of plant intoxication in small ruminants
Baert K., Croubels S., De Boever S., Verbeken A. & De Backer P.
Vlaams Diergeneeskundig Tijdschrift (2005) 74: 149-153.
206
Pharmacokinetics and oral bioavailability of pentoxyfylline in broiler chickens
De Boever S., Baert K., Croubels S. & De Backer P.
Journal of Veterinary Pharmacology and Therapeutics (2005) 28: 575-580.
Disposition and oral bioavailability of amoxicillin and clavulanic acid in pigs
Reyns T., De Boever S., Baert K., Croubels S., Schauvlieghe S., Gasthuys F. &
De Backer. P.
Journal of Veterinary Pharmacology and Therapeutics (2007) 30: 550-555.
Quantitative analysis of clavulanic acid in porcine tissues by liquid chromatography combined with electrospray ionization tandem mass spectrometry
Reyns T., De Boever S., De Baere S., De Backer P. & Croubels S.
Analytica Chimica Acta (2007) 597: 282–289.
The influence of age and repeated LPS administration on body temperature and
the relation with interleukin-6 and IgM antibodies in broiler chickens
De Boever S., Beyaert R., Vandemaele F., Baert K., Duchateau L., Goddeeris B.,
De Backer P. & Croubels S.
Avian Pathology (2008) 37: 39-44.
Tissue Depletion of Amoxicillin and Its Major Metabolites in Pigs: Influence of
the Administration Route and the Simultaneous Dosage of Clavulanic Acid
Reyns T., De Boever S., De Baere S., De Backer P. & Croubels S.
Journal of Agricultural and Food Chemistry (2008) 56: 448-454.
Identification and validation of housekeeping genes as internal control for gene
expression in an intravenous LPS inflammation model in chickens
De Boever S., Vangestel C., De Backer P., Croubels S. & Sys S.
Veterinary Immunology and Immunopathology (2008) 122: 312-317.
207
Induction of the carrier state in pigeons infected with Salmonella enterica subspecies enterica serovar Typhimurium PT99 by treatment with florfenicol: a matter of
pharmacokinetics
Pasmans F., Baert K., Martel A., Bousquet-Melou A., Lanckriet R., De Boever S.,
Van Immerseel F., Eeckhaut V., De Backer P. & Haesebrouck F.
Antimicrobial Agents and Chemotherapy (2008) 52: 954-961.
Pharmacokinetics of tepoxalin and its active metabolite in broiler chickens
De Boever S., Neirinckx E., Baert K., De Backer P. & Croubels S.
Journal of Veterinary Pharmacology and Therapeutics (2008) 32: 97-100.
Transsplenic portal catheterisation combined with a jugular double lumen catheter
for pharmacokinetic and presystemic metabolisation studies in pigs
Gasthuys F., De Boever S., Schauvliege S., Reyns T., Levet T., Cornillie P.,
Casteleyn C., De Backer P. & Croubels S.
Journal of Veterinary Pharmacology and Therapeutics (2008) 32: 137-145.
Influence of administration route on the biotransformation of amoxicillin in the
pig
Reyns T., De Boever S., Schauvliege S., Gasthuys F., Meissonnier G., Oswald I.,
De Backer P. & Croubels S.
Journal of Veterinary Pharmacology and Therapeutics (2008) 32: 241-248.
Influence of 2 different ventilation modes on the function of an anaesthetic conserving device (AnaConDa®) in sevoflurane anaesthetized pigs
Schauvliege S., Bouchez S., Devisscher L., Reyns T., De Boever S. & Gasthuys F.
Veterinary Anaesthesia and Analgesia (2009) 36: 230-238.
208
Characterization of an intravenous lipopolysaccharide inflammation model in
broiler chickens
De Boever S., Croubels S., Meyer E., Sys S., Beyaert R., Ducatelle R. &
De Backer P.
Avian Pathology (2009) 38: 403-411.
Flow cytometric differentiation of avian leukocytes and analysis of their intracellular cytokine production.
De Boever S., Croubels S., Demeyere K., Lambrecht B., De Backer P. & Meyer E.
Avian Pathology, in press.
Pharmacodynamics and pharmacokinetics of tepoxalin, ketoprofen and Nasalicylate in an intravenous LPS inflammation model in broiler chickens.
De Boever S., Neirinckx E., Meyer E., De Baere S., Beyaert R., De Backer P. &
Croubels S.
Journal of Veterinary Pharmacology and Therapeutics, conditionally accepted.
Species comparison of enantioselective oral bioavailability and pharmacokinetics
of ketoprofen.
Neirinckx E., Croubels S., De Boever S., Remon J., Bosmans T., Daminet S.,
De Backer P. & Vervaet C.
Research in Veterinary Science, submitted.
209
Scientific abstracts
Influence of administration route and simultaneous dosage of clavulanic acid on
the biotransformation of amoxicillin in pigs
Reyns T., De Boever S., De Baere S., Croubels S. & De Backer P.
Third international Conference on Antimicrobial Agents in Veterinary Medicine,
Orlando, Florida, USA, May 16-20, 2006 (poster).
Quantitative determination of clavulanic acid in animal plasma using LC-MS/MS
as a part of a pharmacokinetic study in pigs
Reyns T., De Boever S., De Baere S., Croubels S. & De Backer P.
10th International EAVPT Congres, Turin, Italy, September 17-22, 2006 (poster).
Characterization of an LPS inflammation model in chickens
De Boever S., Beyaert R., Vandemaele F., Goddeeris B., De Backer P. &
Croubels S.
10th International EAVPT Congres, Turin, Italy, September 17-22, 2006 (oral).
Quantitative analysis of clavulanic acid in swine tissues by LC-MS/MS
Reyns T., De Boever S., Croubels S. & De Backer P.
Annual Meeting of the Belgian Society for Mass Spectrometry, K.U. Leuven,
Leuven, Belgium, February 16, 2007 (oral).
Influence of 2 different ventilation modes on the function of an anaesthetic conserving device (AnaConDa®) in sevoflurane anaesthetized pigs
Schauvliege S., Devisscher L., Reyns T., De Boever S., Croubels S. & Gasthuys F.
Proceedings of Association of Veterinary Anaesthesists, Autumn meeting,
Leipzig, Germany, September 19-20, 2007, p. 32 (poster).
210
The effects of intravenous LPS administration in broiler chickens
De Boever S., Meyer E., Sys S., De Backer P. & Croubels S.
The 10th Biennial Meeting of the International Endotoxin and Innate Immunity
Society (IEIIS), Edinburgh, Scotland, July 30 – Augus 2, 2008 (oral, invited
speaker).
Influence of administration route on the biotransformation of amoxicillin in the
pig.
Reyns T., Croubels S., De Boever S., Schauvliege S., Gasthuys F. &
De Backer P.
Fourth International Conference on Antimicrobial Agents in Veterinary Medicine
(AAVM), Prague, Czech Republic, August 24-28, 2008, p. 30 (oral).
Pharmacodynamic properties of salicylate, tepoxalin and ketoprofen in an intravenous LPS inflammation model in broiler chickens
De Boever S., Neirinckx E., Beyaert R., De Backer P. & Croubels S.
11th International EAVPT Congres, Leipzig, Germany, Juli 12-17, 2009 (oral).
211
Dankwoord
In jullie handen ligt een samenvatting van zes jaar van mijn professionele leven …..
„Vele handen maken licht werk‟, de uitdrukking bestaat al jaren en dagen en zo is het ook
met dit doctoraat. Alhoewel dit werk mijn naam draagt, zal het voor iedereen duidelijk
zijn dat heel wat mensen, elk op hun manier, hun steen(tje) hebben bijgedragen.
In de eerste plaats wil ik mijn promotoren, prof. dr. apr. Siska Croubels en prof. dr. Patrick De Backer bedanken om mij de kans te geven dit doctoraat af te werken aan de onderzoeksgroep. Bedankt voor het vertrouwen dat jullie in mij gesteld hebben, voor de
suggesties, het nalezen van de manucripten en protocols, de goede raad… en zoveel
meer…
Prof. dr. Rudi Beyaert en prof. dr. Richard Ducatelle, als leden van de begeleidingscommissie waren jullie al vrij vroeg bij het onderzoek betrokken. Bedankt voor jullie inbreng,
ik vond het zeer aangenaam om met jullie te overleggen en te „brainstormen‟ over het onderzoek.
De leden van de lees- en examencommissie wens ik te bedanken voor hun opmerkingen
en suggesties: prof. dr. Frank Gasthuys, prof. dr. Evelyne Meyer, prof. dr. Katleen Hermans, dr. Peter De Herdt.
Prof. dr. Peter Lees thank you for your suggestions and comments, they were certainly of
value.
213
Kris, ik denk dat niemand zoveel geluk gehad heeft als ik dat haar voorganger „blijven
plakken is‟ op de vakgroep. De eerste weken heb ik zowat in je bureau gekampeerd om je
telkens weer lastig te vallen met allerhande vragen. Je hebt me letterlijk met raad en daad
bijgestaan doorheen de voorbije zes jaar. Ik wil je bij deze oprecht bedanken voor alles
wat je voor mij gedaan hebt!
An en Eva, in jullie heb ik niet alleen fantastische collega‟s gevonden, meer dan dat heb ik
in jullie vriendinnen gevonden…… ik wil jullie bedanken voor alle leuke momenten (moge er in de toekomst nog vele volgen), de goede raad en schouderklopjes, …………
Virginie, mijn bureaugenootje, ook jij hebt heel wat met mij meegemaakt en zo vaak een
luisterend oor geweest. Ik wens je heel veel succes met het onderzoek en eens zoveel op
het thuisfront!
Tim, mijn bureaugenootje van het eerste uur. Jij zorgde ervoor dat naast ik naast kippen
ook nog wat varkens kon pesten. Samen hebben we heel wat afgelachen, bedankt voor je
gezelschap.
Dieter, mijn stalmaatje, ontelbare uren hebben we samen tussen de kippen en varkens
doorgebracht en telkens was het dolle pret! Bedankt voor al je hulp!
Christel, wat ik van PCR afweet heb ik van jou geleerd. Bedankt om me wegwijs te maken en voor al je hulp met primers, gels, BLAST‟s…….
Sabrina, ook jou wil ik bedanken voor de ettelijke uren die je voor mij doorbracht achter
de flow om stalen te verwerken.
Stanislas, bedankt voor inbreng, de statistische analyse van de resultaten en de samenwerking.
Evelyne en Kristel, hartelijk dank voor alle hulp met het flow cytometrie gebeuren!
Het heeft ons bloed, zweet en tranen gekost, maar wij hebben het bewezen: de aanhouders
winnen!
214
Joline, de sportiefste van ons drietjes in de bureau, Chuiqolina: veel succes met de roze
varkentjes en het wielrennen en bedankt voor alles!
Anja, onze „Miss Metal‟ en zonnetje in huis, zorg er maar voor dat het op de vakgroep
niet te stil wordt! Bedankt voor je hulp met de dierproeven en de analyses.
Frédéric, bedankt voor de analyse van de IgM antilichamen en de bijdrage aan het artikel.
Wilma, het is je nooit teveel geweest om na al die ontelbare stalen.... sommige dan toch
nog maar eens opnieuw te analyseren…. Bedankt voor je inzet!
Maggy, onze „giftige‟ madam, samen hebben we wel enkele verdachte zaakjes uitgeklaard… bedankt voor de samenwerking!
Siegrid, bedankt om op het allerlaatste nippertje dan toch nog een methode te ontwikkelen
voor de PGE2 bepaling en voor alle hulp met de analyses!
Ann, als het tijd is voor kwaliteit, dan kom jij op de proppen…. Bedankt om me een beetje
wegwijs te maken in het GLP gebeuren.
Pascal, de HPLC kent voor jou weinig geheimen, bedankt voor de hulp met methodeontwikkeling en de analyses.
Karl, bedankt voor al je hulp, zowel met de dierproeven, analyses en als het op verfwerken aankomt!
Nathalie, bedankt voor de hulp met de administratie en andere aangelegenheden.
De „Kela-boys‟, Marc en Kris, bedankt voor de tips in het labo en voor de samenwerking.
215
Filip, al vanaf onze studentenjaren ben je iemand geweest waar ik op kon bouwen. Ook
tijdens onze assistentenjaren kon ik bij jou terecht voor goede raad. Ik wens je veel succes
met je verdere carrière.
Aan het LPS-team: Anneleen, Heidi en Elke… jullie hebben er een uitdagende molecule
uitgekozen, weet dat de reaktie wispelturig kan zijn en de weg bezaaid met valkuilen…
maar de overwinning smaakt zoet!
Bert, Jella, Donna en Dieter, bedankt voor de goede raad en de gezellige babbels en veel
succes met het onderzoek.
Ann…. toen waren we met vier in ons bureautje. Kippen en toxines, het is eens iets anders
dan kippen in combinatie met LPS, ik ben ervan overtuigd dat je ze wel kan temmen! Bedankt voor je gezelschap en om het initiatief te nemen voor het fotoboek.
Jelle, spijtig genoeg hebben we niet meer tijd gekregen om mekaar beter te leren kennen,
maar ik hoop dat je je op de vakgroep even goed thuis zal mogen voelen als ik dat deed.
Edith en Noël, stilletjes aan verdwijnt „de oude garde‟ om plaats te maken voor de
„nieuwkes‟, zo vergaat het ook mij. Ik vond het in ieder geval leuk om met jullie samen te
werken.
Sofie en Barbara, mijn vroegere collega‟s, veel succes met jullie carrière en laat ons af en
toe eens bijpraten!
Aan mijn sympathisanten…. Bedankt voor jullie interesse en aanwezigheid!
216
Aan mijn trouwe supporters van het „thuisfront‟: zus, mijn schone broer, Ward(je), Helena
en Mara, bedankt voor jullie geduld!
Mama en papa, dit werk heb ik opgedragen aan jullie. Het was niet genoeg dat ik voor een
studie koos van zes jaar, waar ik jullie al heel wat grijze haren bezorgde, nee…. ik deed er
nog eens zes jaar bovenop! Bedankt voor alles wat jullie voor mij betekenen! „Winnaars
zijn verliezers die niet opgeven‟…. mama en papa, WIJ hebben het gehaald!
Patrick, my Mr. Impossible…. bedankt om me te leren relativeren, voor je steun, interesse
en geduld de voorbije maanden….
Jij zorgt ervoor dat ik me goed voel in mijn vel en het beste van mezelf geef!
A whole new world, a new fantastic point of view
No one to tell us no, or where to go,
or say we're only dreaming.
A whole new world,
A dazzling place I never knew
But when I'm way up here, it's crystal clear
That now I'm in a whole new world with you.
217